The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041302	Escherichia coli strain MSHS 472 chromosome, complete genome	4782773	1046032	1053172	4782773		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1046032_1046671_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1046667_1047930_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1047926_1048835_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1049030_1049798_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141333.1|1049848_1050505_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272898.1|1050610_1053172_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP041302	Escherichia coli strain MSHS 472 chromosome, complete genome	4782773	1687948	1697390	4782773		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|1687948_1688875_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1688879_1689611_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1689591_1689699_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1689758_1690490_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1690711_1692397_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1692393_1693113_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1693159_1693630_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_139534366.1|1693670_1694132_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	1.2e-75
WP_001317947.1|1694256_1696257_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|1696253_1697390_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 3
NZ_CP041302	Escherichia coli strain MSHS 472 chromosome, complete genome	4782773	2323230	2342376	4782773	tail,lysis	Enterobacteria_phage(33.33%)	25	NA	NA
WP_000598292.1|2323230_2323557_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2323762_2324977_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_141874714.1|2324988_2326008_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
WP_001389342.1|2326065_2326194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|2326195_2327476_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_097443922.1|2327855_2328215_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|2328286_2329357_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151216.1|2329397_2329820_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_014639476.1|2330011_2330974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023277548.1|2330989_2331991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001557860.1|2332399_2332507_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_021541900.1|2332551_2332764_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.3e-29
WP_001332495.1|2333222_2333501_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_023277547.1|2333502_2334552_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.9e-109
WP_000904114.1|2334564_2334939_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762863.1|2334935_2335757_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.2e-78
WP_000562553.1|2336661_2336793_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506936.1|2337159_2337588_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2337759_2338134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|2338385_2338601_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_000192451.1|2338605_2338950_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_001593363.1|2338915_2339188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101168.1|2339293_2339836_+	lysozyme	NA	Q08J98	Stx2-converting_phage	87.8	3.0e-94
WP_001611687.1|2340097_2341795_+|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	61.6	1.4e-174
WP_001593356.1|2341794_2342376_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
>prophage 4
NZ_CP041302	Escherichia coli strain MSHS 472 chromosome, complete genome	4782773	2546963	2556379	4782773	tail,lysis	Enterobacteria_phage(50.0%)	11	NA	NA
WP_023277540.1|2546963_2548166_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	88.0	4.7e-188
WP_023277539.1|2548363_2548945_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	2.9e-103
WP_077613687.1|2548944_2549889_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	65.7	2.2e-47
WP_023277537.1|2549973_2550762_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	5.7e-49
WP_001697073.1|2550899_2552357_-	TrkG potassium ion Trk transporter	NA	NA	NA	NA	NA
WP_077613672.1|2552553_2552739_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	77.2	1.1e-14
WP_001135296.1|2552955_2553453_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_000839596.1|2553452_2553668_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_141874725.1|2554950_2555493_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.8	1.2e-77
WP_000228032.1|2555489_2555780_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_141874726.1|2555779_2556379_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.0	4.7e-104
>prophage 5
NZ_CP041302	Escherichia coli strain MSHS 472 chromosome, complete genome	4782773	2559549	2576747	4782773	tRNA	Escherichia_phage(73.68%)	21	NA	NA
WP_001595666.1|2559549_2559972_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.3	6.5e-60
WP_141874728.1|2559987_2560749_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	6.3e-122
WP_104888917.1|2560771_2561518_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	8.4e-111
WP_000693801.1|2562393_2562816_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	97.1	8.2e-71
WP_001072343.1|2562812_2563067_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233320.1|2563146_2563566_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_089642810.1|2563998_2564154_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.6e-08
WP_001312793.1|2564150_2564639_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2565080_2565302_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2565301_2565472_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2565546_2565822_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_104888914.1|2565923_2568524_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	4.4e-247
WP_000166319.1|2568516_2569326_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_042038331.1|2569382_2569577_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.3	1.3e-31
WP_023277533.1|2569569_2569758_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	96.8	6.1e-26
WP_000079604.1|2569857_2570073_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_023277532.1|2570074_2571310_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.0	2.5e-237
WP_001157407.1|2571361_2572297_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123745.1|2572425_2573799_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2574276_2575260_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2575514_2576747_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 6
NZ_CP041302	Escherichia coli strain MSHS 472 chromosome, complete genome	4782773	3379662	3434085	4782773	integrase,tRNA,terminase,lysis,protease,transposase	Enterobacteria_phage(34.78%)	54	3379194:3379240	3397802:3397848
3379194:3379240	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201829.1|3379662_3380616_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226386.1|3380802_3382287_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239881.1|3382832_3383501_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023277493.1|3383555_3385565_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	93.3	0.0e+00
WP_000453623.1|3385539_3386085_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	5.2e-94
WP_001421937.1|3386473_3386668_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3386832_3387039_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001403557.1|3387324_3387735_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	9.4e-72
WP_000738500.1|3388025_3388319_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3388409_3388592_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3388808_3389306_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|3389305_3389521_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|3390109_3391207_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|3391396_3391780_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_023277492.1|3391797_3392787_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	5.4e-190
WP_001061408.1|3392794_3393592_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_000767127.1|3393611_3394001_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210176.1|3393997_3394324_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_077613723.1|3394323_3394818_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	2.1e-86
WP_000206812.1|3396092_3396398_+	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	9.2e-48
WP_001298992.1|3396624_3397788_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805428.1|3398122_3398755_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3397802:3397848	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250422.1|3398757_3399273_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691054.1|3399283_3400291_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001347862.1|3400303_3402913_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988379.1|3402943_3403636_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|3403855_3404398_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|3404878_3405745_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3405746_3405959_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|3406066_3406588_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3406623_3408009_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_000255997.1|3408182_3408677_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000212253.1|3408679_3409402_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_001295318.1|3409519_3410029_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000815510.1|3410025_3411093_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000855388.1|3411297_3412191_-	carbamate kinase	NA	NA	NA	NA	NA
WP_001331011.1|3412187_3413003_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000495407.1|3413013_3414273_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_141874748.1|3414282_3415950_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000703911.1|3416266_3417316_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_001347861.1|3417337_3418573_+	allantoate deiminase	NA	NA	NA	NA	NA
WP_000540968.1|3418583_3419369_+	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_000706355.1|3419497_3420643_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
WP_001298987.1|3420664_3421966_-	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000006887.1|3422022_3423384_-	allantoinase AllB	NA	NA	NA	NA	NA
WP_000401121.1|3423443_3424898_-	putative allantoin permease	NA	NA	NA	NA	NA
WP_000765854.1|3425067_3425946_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000943584.1|3426044_3426821_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_001347858.1|3426833_3428615_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	4.1e-39
WP_000141275.1|3428704_3429520_-	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_000776392.1|3429597_3430080_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000460129.1|3430309_3431236_+	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_001158001.1|3431304_3432399_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_085947771.1|3432923_3434085_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 1
NZ_CP041301	Escherichia coli strain MSHS 472 plasmid pCys-6, complete sequence	150137	37130	71539	150137	protease,bacteriocin,integrase,transposase	Macacine_betaherpesvirus(33.33%)	21	28170:28183	73268:73281
28170:28183	attL	CCCTGGCTGTCCAG	NA	NA	NA	NA
WP_001066953.1|37130_37871_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_072652414.1|37991_38180_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_137521412.1|38553_39441_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|39523_40633_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000280980.1|41065_42019_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|43289_43448_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_072834405.1|44680_44962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031942297.1|47136_48105_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.5e-184
WP_000450494.1|49055_50249_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000738422.1|53334_53628_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|56772_57888_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001111199.1|58027_61687_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.2e-45
WP_001552738.1|61790_63020_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271276.1|63104_64061_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_072657522.1|64105_66283_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_014640552.1|67241_67478_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|67941_68223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203272.1|68580_69108_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|69351_70167_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|70216_70570_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|70747_71539_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
73268:73281	attR	CTGGACAGCCAGGG	NA	NA	NA	NA
>prophage 2
NZ_CP041301	Escherichia coli strain MSHS 472 plasmid pCys-6, complete sequence	150137	81063	113090	150137	transposase,integrase,protease	Salmonella_phage(30.0%)	33	81039:81068	102563:102592
81039:81068	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001138064.1|81063_84030_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|84032_84593_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|84718_85069_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|85271_86285_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|86429_86927_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|87038_87329_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|87334_88126_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|88289_88637_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|88630_89470_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|89597_89801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|89956_91162_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|91172_91478_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|91704_92469_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|92961_93546_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100620385.1|94779_95685_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067834.1|95806_96511_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_001300294.1|97900_98569_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|98604_98841_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|98837_99200_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|99217_100912_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|100963_101386_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|101421_101697_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|101710_102061_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|102132_102567_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|103568_103811_+|transposase	transposase	transposase	NA	NA	NA	NA
102563:102592	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
WP_000164043.1|103842_104493_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|104598_105798_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001214976.1|106850_107258_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000509965.1|108019_108625_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_141874665.1|108719_111578_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.3	1.2e-173
WP_001398199.1|111752_112154_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|112086_112344_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|112436_113090_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
