The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023301	Lactobacillus plantarum strain pc-26 chromosome, complete genome	3181760	37590	50035	3181760	terminase,integrase,capsid,tail,portal,head	Lactobacillus_phage(37.5%)	17	29971:29983	39612:39624
29971:29983	attL	TTCACATTCATTC	NA	NA	NA	NA
WP_063487674.1|37590_38745_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	37.0	3.6e-60
WP_118130519.1|38801_39488_-	helix-turn-helix domain-containing protein	NA	Q20DG0	Lactobacillus_phage	49.4	7.7e-10
WP_106904620.1|39613_39802_+	hypothetical protein	NA	NA	NA	NA	NA
39612:39624	attR	GAATGAATGTGAA	NA	NA	NA	NA
WP_080376230.1|39844_39952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118130517.1|40072_40303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141874778.1|40316_41117_+	DNA replication protein	NA	NA	NA	NA	NA
WP_141874779.1|41116_42511_+	virulence protein	NA	A0A0A7RTG3	Clostridium_phage	34.3	2.3e-69
WP_118130709.1|42656_43136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054519353.1|43150_43342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118130707.1|43328_43667_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	35.6	2.5e-09
WP_046947486.1|43659_44049_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.6	1.0e-19
WP_118130705.1|44663_45137_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_118130703.1|45133_46837_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.1	7.0e-121
WP_080474079.1|46775_46994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118130701.1|47023_48124_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	35.2	5.5e-50
WP_118130699.1|48120_49650_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.8	2.1e-44
WP_021356366.1|49765_50035_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
>prophage 2
NZ_CP023301	Lactobacillus plantarum strain pc-26 chromosome, complete genome	3181760	344835	456657	3181760	tRNA,bacteriocin,protease,transposase	Tupanvirus(18.18%)	111	NA	NA
WP_044428951.1|344835_345399_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_044428954.1|345592_346261_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_027821520.1|346418_347924_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_013355173.1|348188_348557_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|348669_349179_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003643764.1|349209_350406_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641934.1|350515_350986_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|351004_351460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641936.1|351563_352136_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_011100977.1|352301_353222_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_118130736.1|353358_354258_+	oxidoreductase	NA	NA	NA	NA	NA
WP_053566421.1|354697_356578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011679766.1|356749_357196_-	ribonuclease H	NA	NA	NA	NA	NA
WP_003641940.1|357433_358960_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_015825109.1|358960_359932_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_053566422.1|360009_361341_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|361806_363324_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003643774.1|363338_365168_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003643775.1|365182_365905_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_118130738.1|366487_370183_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_095587192.1|371663_372080_+	EndoU domain-containing protein	NA	NA	NA	NA	NA
WP_053566425.1|372119_372434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080373188.1|372495_372648_+	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_053566426.1|372658_373066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080373231.1|373566_373905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011100991.1|374244_374523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118130740.1|374819_375737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016511577.1|376461_377004_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011100988.1|377018_377282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643788.1|377398_377602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072534814.1|377690_377966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047672646.1|377983_378370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057717859.1|378595_378751_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_072534813.1|378819_379011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057136835.1|379402_379648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643792.1|380222_380642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063204023.1|380923_381397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379760.1|381732_382350_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_118130742.1|382353_383508_-	MFS transporter	NA	NA	NA	NA	NA
WP_011100993.1|383511_384303_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003641965.1|384373_385246_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641966.1|385405_386221_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_063486820.1|386746_388123_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_011100995.1|388167_389352_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003641969.1|389736_389940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643803.1|390174_390327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641971.1|390351_391020_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641972.1|391016_391190_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003641973.1|391220_391388_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641974.1|392249_392450_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641975.1|392577_392745_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641976.1|392862_394062_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_118130879.1|394092_394839_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641978.1|395192_395381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641979.1|395716_395863_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_021356664.1|396053_397382_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_118130877.1|397382_398126_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_063204018.1|398244_398988_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015825123.1|399293_400067_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643811.1|400165_400324_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003641985.1|400348_400519_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_141874781.1|400821_402936_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.0e-45
WP_057136851.1|402951_404328_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_063204065.1|404417_405107_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_063204066.1|405174_405843_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641991.1|405929_406610_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821496.1|407517_407721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063204067.1|407815_410125_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021356643.1|410383_411160_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003643815.1|411599_412616_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003641997.1|413023_413734_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641998.1|413806_415168_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641999.1|415174_415363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642000.1|415352_415775_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003643816.1|415997_417353_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642002.1|417370_418807_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_003642003.1|418927_419824_+	ROK family protein	NA	NA	NA	NA	NA
WP_003642004.1|419973_420720_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063204068.1|420832_421846_+|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_011101008.1|422201_423434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643820.1|423438_424233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642008.1|424401_425319_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_118130772.1|425364_426639_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642010.1|426631_427591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646490.1|427612_428317_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_118130770.1|428316_429159_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_015825136.1|429762_430152_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003643823.1|430473_432525_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_003642016.1|432757_433942_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003642017.1|434064_434841_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_063204069.1|434827_435391_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_003642019.1|435387_436278_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003642020.1|436382_436634_+	Veg protein	NA	NA	NA	NA	NA
WP_003643828.1|436766_437633_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_015639955.1|437714_437897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642022.1|437942_438887_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003642023.1|439154_439853_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_003642024.1|439839_440643_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642030.1|440998_441835_+	pur operon repressor	NA	NA	NA	NA	NA
WP_063204070.1|441903_443286_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_063204071.1|443521_444346_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003643830.1|444711_445692_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_003646506.1|445974_446997_+	YdcF family protein	NA	NA	NA	NA	NA
WP_003643831.1|447079_448066_+	lipoprotein	NA	NA	NA	NA	NA
WP_003646508.1|448235_449045_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_003643832.1|449064_450417_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_003643833.1|450431_451364_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_003642040.1|451726_452167_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003642041.1|452211_452820_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642042.1|452992_454606_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_141874782.1|454944_456657_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.1e-92
>prophage 3
NZ_CP023301	Lactobacillus plantarum strain pc-26 chromosome, complete genome	3181760	594548	603160	3181760		Streptococcus_phage(66.67%)	11	NA	NA
WP_003643940.1|594548_596246_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640956.1|596267_596576_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|596591_597191_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|597205_597457_+	YaaL family protein	NA	NA	NA	NA	NA
WP_016510978.1|597842_598508_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640965.1|598504_598834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640966.1|598850_599870_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640967.1|599894_600242_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_044429290.1|600340_601237_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	7.5e-82
WP_003640969.1|601240_602026_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013355240.1|602164_603160_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	2.0e-51
>prophage 4
NZ_CP023301	Lactobacillus plantarum strain pc-26 chromosome, complete genome	3181760	1219241	1232011	3181760		Lactobacillus_phage(70.0%)	12	NA	NA
WP_118130715.1|1219241_1220471_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	97.7	7.1e-216
WP_072539616.1|1220561_1221533_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.8	2.0e-181
WP_003643099.1|1221718_1222666_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|1223009_1223624_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_118130717.1|1223626_1226065_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.5	0.0e+00
WP_072539614.1|1226152_1226713_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	99.5	3.5e-101
WP_013355470.1|1226783_1227224_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	97.9	1.2e-75
WP_022638020.1|1227319_1227457_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_080475280.1|1227614_1228991_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.4	2.0e-25
WP_021356352.1|1228974_1229667_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.3e-35
WP_013355473.1|1230376_1231042_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_118130719.1|1231066_1232011_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	45.8	6.7e-73
>prophage 5
NZ_CP023301	Lactobacillus plantarum strain pc-26 chromosome, complete genome	3181760	2054785	2117265	3181760	terminase,integrase,protease,transposase,capsid,tail,portal,head	Lactobacillus_phage(29.27%)	75	2102762:2102783	2117443:2117464
WP_044429853.1|2054785_2055250_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.2	8.8e-18
WP_022638105.1|2056345_2056723_-	hypothetical protein	NA	A0A2K9VCG4	Lactobacillus_phage	67.5	7.9e-17
WP_022638106.1|2056709_2057006_-	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	74.5	6.4e-38
WP_021732622.1|2058300_2058735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638108.1|2058737_2059187_-	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	39.9	1.8e-20
WP_112260728.1|2059208_2064464_-	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	59.4	8.2e-144
WP_099739626.1|2064478_2064811_-	hypothetical protein	NA	V5UQS8	Oenococcus_phage	73.4	2.2e-42
WP_141874803.1|2064854_2065286_-	hypothetical protein	NA	V5USK5	Oenococcus_phage	55.9	2.8e-34
WP_044429853.1|2065422_2065887_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.2	8.8e-18
WP_118130551.1|2071465_2071729_-	hypothetical protein	NA	V9QKH3	Oenococcus_phage	64.2	5.2e-23
WP_003642826.1|2071836_2072235_-	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.8	3.0e-46
WP_118130532.1|2072334_2072811_-|tail	phage tail protein	tail	Q6SE73	Lactobacillus_prophage	59.4	7.9e-46
WP_013355729.1|2072819_2073185_-	hypothetical protein	NA	V5UQS4	Oenococcus_phage	53.4	3.0e-29
WP_013355730.1|2073184_2073736_-	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	62.3	2.0e-64
WP_003642822.1|2073737_2074085_-	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
WP_013355731.1|2074084_2074417_-	hypothetical protein	NA	V9QJ97	Oenococcus_phage	45.3	1.8e-12
WP_003642820.1|2074428_2074605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642819.1|2074617_2075640_-	hypothetical protein	NA	V5US24	Oenococcus_phage	62.5	3.7e-117
WP_013355732.1|2075659_2076007_-	hypothetical protein	NA	V5UTH9	Oenococcus_phage	63.8	4.4e-30
WP_013355733.1|2076021_2076699_-	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	32.1	6.0e-15
WP_013355734.1|2076871_2077078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642815.1|2077129_2077408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355736.1|2077382_2079068_-	hypothetical protein	NA	V5US81	Oenococcus_phage	58.0	6.5e-119
WP_024971552.1|2079214_2079511_-|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	1.1e-10
WP_013355738.1|2079440_2080949_-|portal	phage portal protein	portal	V5US18	Oenococcus_phage	52.0	1.8e-136
WP_022638113.1|2080960_2082199_-|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	61.0	7.1e-139
WP_022638114.1|2082188_2082716_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	73.1	5.0e-41
WP_033607771.1|2082893_2083073_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	56.9	4.6e-07
WP_099447637.1|2083182_2084013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118130534.1|2084524_2084986_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	6.9e-39
WP_022638117.1|2085196_2085577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057138635.1|2085573_2086092_-	hypothetical protein	NA	O03915	Lactobacillus_phage	69.1	2.9e-54
WP_022638119.1|2086088_2086376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642799.1|2086372_2087281_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_050578342.1|2087359_2088220_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	48.9	7.8e-76
WP_022638121.1|2088143_2089031_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	53.3	4.6e-63
WP_022638122.1|2089033_2089414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638123.1|2089546_2089717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638124.1|2089784_2090297_-	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	39.4	2.0e-23
WP_003642793.1|2090364_2090670_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_011101086.1|2091010_2091211_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101085.1|2091357_2091594_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	30.7	8.5e-09
WP_013355753.1|2091631_2091946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033099030.1|2092002_2092257_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013355754.1|2092402_2092906_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	42.6	1.7e-22
WP_013355755.1|2092920_2093343_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	35.1	3.0e-12
WP_013355756.1|2093449_2094169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638126.1|2094853_2095933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021356373.1|2096977_2097355_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_022638128.1|2097381_2097741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638129.1|2097771_2098053_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_022638130.1|2098802_2099828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638131.1|2099791_2100670_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_057138560.1|2100776_2101898_+|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.4	1.7e-46
WP_015380645.1|2102248_2102455_-	hypothetical protein	NA	NA	NA	NA	NA
2102762:2102783	attL	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
WP_118130536.1|2102937_2103798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118130538.1|2103774_2104164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118130540.1|2104330_2104600_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_118130542.1|2105009_2106590_-|capsid	phage major capsid protein	capsid	A0A1J0MFW8	Staphylococcus_phage	33.9	4.3e-40
WP_118130544.1|2106579_2107686_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.3	8.0e-49
WP_033611503.1|2107686_2107887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118130546.1|2107840_2109544_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.7	1.1e-121
WP_118130548.1|2109540_2110014_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_069137353.1|2110688_2111078_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	1.0e-19
WP_118130550.1|2111070_2111409_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	35.6	1.2e-08
WP_024971524.1|2111418_2111601_-	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_024971523.1|2111625_2112045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141874804.1|2112191_2113586_-	virulence protein	NA	A0A0A7RTG3	Clostridium_phage	34.1	3.0e-69
WP_141874805.1|2113585_2114386_-	DNA replication protein	NA	NA	NA	NA	NA
WP_118130480.1|2114399_2114630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118130482.1|2114750_2114858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046783487.1|2114898_2115063_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_118130484.1|2115059_2115266_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_118130486.1|2115397_2116015_+	helix-turn-helix transcriptional regulator	NA	A0A1P8BMN9	Lactococcus_phage	54.5	3.1e-10
WP_118130488.1|2116107_2117265_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.8	3.0e-54
2117443:2117464	attR	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
>prophage 6
NZ_CP023301	Lactobacillus plantarum strain pc-26 chromosome, complete genome	3181760	2317517	2326031	3181760		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2317517_2318096_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_003645866.1|2318088_2319114_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	2.7e-59
WP_003642591.1|2319110_2320565_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_003645864.1|2320549_2322769_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
WP_011101895.1|2322761_2323442_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2323441_2323696_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2323697_2324429_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_046811071.1|2324431_2325562_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642585.1|2325545_2326031_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 7
NZ_CP023301	Lactobacillus plantarum strain pc-26 chromosome, complete genome	3181760	2808255	2816542	3181760	bacteriocin	Streptococcus_phage(16.67%)	7	NA	NA
WP_046811086.1|2808255_2809368_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.3	3.0e-35
WP_044432279.1|2809503_2810838_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	1.8e-26
WP_063204300.1|2811032_2811362_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003642490.1|2811583_2812882_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_003643473.1|2813198_2814488_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.0	3.5e-72
WP_003642492.1|2814530_2815508_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.2	1.4e-137
WP_063204301.1|2815600_2816542_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.5	7.3e-19
>prophage 1
NZ_CP023302	Lactobacillus plantarum strain pc-26 plasmid p.pc-2601, complete sequence	61600	34438	42162	61600	transposase	Enterococcus_phage(28.57%)	7	NA	NA
WP_112260613.1|34438_35214_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_013356283.1|35321_36224_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.3	6.3e-52
WP_046783566.1|36310_36943_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.2	3.6e-14
WP_020923859.1|37056_37869_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.0	9.4e-15
WP_021729932.1|37996_38947_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	55.0	1.9e-99
WP_010623241.1|38961_39888_-	ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4P8A9	Corynebacterium_phage	32.1	5.9e-37
WP_080392116.1|39993_42162_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.3	8.1e-255
>prophage 1
NZ_CP023303	Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence	60000	0	11547	60000	transposase	Bacillus_virus(20.0%)	15	NA	NA
WP_027822610.1|1128_1791_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_027822611.1|1926_2211_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_053339260.1|2232_3156_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	46.5	1.8e-78
WP_053339259.1|3171_3822_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_064972126.1|3976_4291_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	32.7	2.8e-15
WP_027822615.1|4312_5650_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.5	1.2e-19
WP_027822616.1|6155_6518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027822617.1|6544_6985_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010495033.1|7121_7559_+	OsmC family protein	NA	NA	NA	NA	NA
WP_111443464.1|7576_7993_+	OsmC family protein	NA	NA	NA	NA	NA
WP_080280605.1|8375_9410_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	34.4	1.8e-42
WP_072534700.1|9492_9726_-	UV-resistance	NA	NA	NA	NA	NA
WP_027822894.1|9839_10151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526748.1|10388_10658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027822893.1|10644_11547_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	32.1	4.1e-27
>prophage 2
NZ_CP023303	Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence	60000	25106	26276	60000		Staphylococcus_phage(100.0%)	1	NA	NA
WP_064775086.1|25106_26276_+	CHAP domain-containing protein	NA	Q4Z9E1	Staphylococcus_phage	38.6	3.6e-15
>prophage 3
NZ_CP023303	Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence	60000	30569	38703	60000		Streptococcus_phage(66.67%)	9	NA	NA
WP_118130432.1|30569_32708_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	46.4	3.0e-108
WP_057138764.1|32830_33046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057138765.1|33049_34174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118130440.1|34359_34500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072534706.1|34584_35556_-	Nisin resistance protein	NA	A0A2P0ZL68	Lactobacillus_phage	27.7	4.7e-13
WP_057138767.1|35845_36583_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_057138768.1|36709_37096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032809155.1|37088_37409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057138769.1|37401_38703_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	39.1	1.0e-79
>prophage 4
NZ_CP023303	Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence	60000	44552	51096	60000	holin	Bacillus_phage(33.33%)	5	NA	NA
WP_057138793.1|44552_46703_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	4.7e-45
WP_085762572.1|46718_48095_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_021353390.1|49092_49182_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_080379115.1|49368_50265_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	28.9	2.0e-10
WP_013356291.1|50541_51096_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.6	2.0e-32
