The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	0	13240	5042960		Cedratvirus(100.0%)	12	NA	NA
WP_029577413.1|653_2033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051594013.1|2491_3481_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_032979769.1|3841_4858_+	cyclase	NA	NA	NA	NA	NA
WP_032979771.1|4906_5878_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_051594014.1|5909_6995_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_032979772.1|6991_7855_-	3-alpha,7-alpha, 12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_032979774.1|7896_9060_-	thiolase	NA	NA	NA	NA	NA
WP_032956188.1|9056_9437_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032962247.1|9439_10222_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_029577421.1|10240_11002_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032979775.1|11294_12449_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_029577423.1|12445_13240_+	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	28.7	6.8e-10
>prophage 2
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	45071	48927	5042960		Bacillus_phage(50.0%)	4	NA	NA
WP_029577452.1|45071_45848_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.4	3.1e-15
WP_029577453.1|45875_46733_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_029577454.1|46747_47761_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_029577455.1|47889_48927_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.6	1.0e-50
>prophage 3
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	53984	62559	5042960		Streptococcus_phage(40.0%)	8	NA	NA
WP_029577459.1|53984_55328_-	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.4e-07
WP_029577460.1|55324_56167_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	1.5e-26
WP_029577461.1|56197_58084_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	42.3	2.3e-112
WP_029577462.1|58258_58930_-	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_032979791.1|58948_59554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029577464.1|59796_60273_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_029577465.1|60579_61059_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I5R1	Streptococcus_phage	32.1	2.1e-06
WP_029577466.1|61242_62559_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	62.2	4.4e-139
>prophage 4
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	66163	70530	5042960		Planktothrix_phage(50.0%)	5	NA	NA
WP_029577470.1|66163_67249_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	4.9e-27
WP_032979799.1|67262_68171_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032979800.1|68163_68802_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_029577473.1|68807_69566_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_029577474.1|69633_70530_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	37.2	8.2e-36
>prophage 5
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	73844	77880	5042960		Halovirus(33.33%)	4	NA	NA
WP_095075210.1|73844_74942_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.5	2.7e-49
WP_029577477.1|75231_76188_+	transaldolase	NA	H6WFR1	Cyanophage	29.2	1.8e-09
WP_029577478.1|76270_77065_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_029577479.1|77070_77880_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	34.4	1.3e-11
>prophage 6
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	81337	83293	5042960		Streptococcus_virus(100.0%)	1	NA	NA
WP_032979804.1|81337_83293_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.4	8.5e-46
>prophage 7
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	94662	98461	5042960		Brevibacillus_phage(33.33%)	3	NA	NA
WP_032978592.1|94662_95589_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.8	2.0e-24
WP_029577493.1|95621_96533_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.1	9.2e-19
WP_048939957.1|96751_98461_+	thiamine pyrophosphate-binding protein	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	1.6e-27
>prophage 8
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	102118	102865	5042960		Bacillus_virus(100.0%)	1	NA	NA
WP_095075211.1|102118_102865_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	5.6e-22
>prophage 9
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	106381	112145	5042960		uncultured_Mediterranean_phage(25.0%)	6	NA	NA
WP_029577503.1|106381_107404_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	6.6e-66
WP_032955576.1|107527_108556_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.4	1.5e-41
WP_029577505.1|108548_109727_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_095075256.1|109813_110287_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.8	1.1e-15
WP_029577507.1|110448_110967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029577509.1|111263_112145_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	36.1	3.4e-50
>prophage 10
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	121144	122634	5042960		Planktothrix_phage(50.0%)	2	NA	NA
WP_032978598.1|121144_121855_-	phosphonate C-P lyase system protein PhnL	NA	G9BWD6	Planktothrix_phage	33.6	7.2e-19
WP_029577520.1|121857_122634_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	24.4	9.0e-15
>prophage 11
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	131043	133872	5042960		Cedratvirus(50.0%)	4	NA	NA
WP_032959536.1|131043_131862_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.7	1.6e-06
WP_029577531.1|132364_132628_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_029577532.1|132717_133008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048940603.1|133047_133872_-	M23 family metallopeptidase	NA	I2E8W3	Clostridium_phage	48.1	1.4e-18
>prophage 12
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	139287	140226	5042960		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_029577542.1|139287_140226_-	DnaJ domain-containing protein	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	25.1	2.3e-12
>prophage 13
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	170927	176901	5042960	tRNA,integrase	uncultured_Mediterranean_phage(75.0%)	5	165201:165214	178693:178706
165201:165214	attL	GGCGATGCTGCGGC	NA	NA	NA	NA
WP_029579459.1|170927_172064_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.3	3.4e-87
WP_029579458.1|172204_172546_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	42.6	2.6e-11
WP_029579457.1|172608_174489_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_029579456.1|174546_175482_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.8	4.0e-41
WP_142028277.1|175701_176901_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	30.2	3.0e-33
178693:178706	attR	GGCGATGCTGCGGC	NA	NA	NA	NA
>prophage 14
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	191505	192144	5042960		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_142028291.1|191505_192144_+	AAA family ATPase	NA	A0A2H4JGZ2	uncultured_Caudovirales_phage	40.5	3.5e-33
>prophage 15
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	219475	220450	5042960		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_029579454.1|219475_220450_+	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	30.4	1.1e-17
>prophage 16
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	225119	226142	5042960		Pseudomonas_phage(100.0%)	1	NA	NA
WP_032956121.1|225119_226142_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.0	8.7e-50
>prophage 17
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	241848	243635	5042960		Mycoplasma_phage(100.0%)	2	NA	NA
WP_029579432.1|241848_242847_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.4	4.4e-06
WP_051350505.1|242843_243635_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	34.9	1.2e-06
>prophage 18
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	256421	261406	5042960		Bacillus_virus(50.0%)	4	NA	NA
WP_029579417.1|256421_258500_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.5	2.8e-15
WP_029579416.1|258601_259717_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_029579415.1|259688_260450_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_048940601.1|260446_261406_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.0	3.8e-23
>prophage 19
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	268938	271453	5042960		Klosneuvirus(50.0%)	2	NA	NA
WP_029579403.1|268938_270207_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	4.0e-12
WP_032978549.1|270298_271453_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	25.9	1.7e-25
>prophage 20
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	275187	276030	5042960		Vibrio_phage(100.0%)	1	NA	NA
WP_029579398.1|275187_276030_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	38.1	9.4e-42
>prophage 21
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	291648	292335	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_032956276.1|291648_292335_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.4	1.0e-09
>prophage 22
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	297840	301164	5042960		Salmonella_phage(50.0%)	3	NA	NA
WP_032956270.1|297840_298365_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	63.4	1.2e-47
WP_029579377.1|298481_299450_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_029579376.1|299622_301164_-	malonyl-CoA synthase	NA	A0A2H4PQM9	Staphylococcus_phage	25.0	1.8e-27
>prophage 23
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	310046	313130	5042960		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_032955816.1|310046_313130_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.8	2.6e-25
>prophage 24
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	317338	318355	5042960		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032979699.1|317338_318355_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.6	1.6e-19
>prophage 25
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	340946	341327	5042960		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_029579338.1|340946_341327_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	46.4	2.6e-15
>prophage 26
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	349966	352570	5042960		Agrobacterium_phage(100.0%)	1	NA	NA
WP_032963084.1|349966_352570_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	33.6	9.4e-125
>prophage 27
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	357788	358292	5042960		Pelagibacter_phage(100.0%)	1	NA	NA
WP_032979689.1|357788_358292_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	48.4	5.1e-27
>prophage 28
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	380761	381280	5042960		Rhizobium_phage(100.0%)	1	NA	NA
WP_032955607.1|380761_381280_-	RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	28.0	1.1e-08
>prophage 29
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	392475	397307	5042960		Cedratvirus(25.0%)	5	NA	NA
WP_029579291.1|392475_393300_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A1M7XV31	Cedratvirus	23.9	1.9e-07
WP_032978207.1|393301_394000_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2K9L0W2	Tupanvirus	24.0	1.1e-06
WP_029579289.1|393996_394479_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_032961035.1|395087_395762_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	34.5	2.0e-10
WP_029579286.1|395921_397307_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	1.6e-06
>prophage 30
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	412148	413819	5042960		Planktothrix_phage(100.0%)	1	NA	NA
WP_032978214.1|412148_413819_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.5e-14
>prophage 31
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	420333	424825	5042960		Bacillus_phage(50.0%)	3	NA	NA
WP_029579261.1|420333_422409_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	28.5	2.1e-63
WP_032979004.1|422486_423386_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_029579259.1|423382_424825_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	28.8	1.4e-16
>prophage 32
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	444670	446335	5042960		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032979016.1|444670_446335_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.9	1.8e-28
>prophage 33
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	458526	467201	5042960		Salmonella_phage(33.33%)	5	NA	NA
WP_032979020.1|458526_460617_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	54.3	8.4e-108
WP_032960989.1|460624_462007_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.5	1.6e-22
WP_032979021.1|462126_462597_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_029579227.1|462566_463571_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032979022.1|463661_467201_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.9e-27
>prophage 34
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	471538	472996	5042960	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_032954999.1|471538_472996_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.0	1.4e-37
>prophage 35
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	476248	477835	5042960		Moraxella_phage(100.0%)	1	NA	NA
WP_029579216.1|476248_477835_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.9	1.0e-36
>prophage 36
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	489687	490509	5042960		Bacillus_virus(100.0%)	1	NA	NA
WP_032954994.1|489687_490509_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	4.0e-29
>prophage 37
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	493920	494469	5042960		Lactobacillus_phage(100.0%)	1	NA	NA
WP_029579198.1|493920_494469_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	29.5	5.0e-12
>prophage 38
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	498207	500802	5042960		Catovirus(100.0%)	1	NA	NA
WP_032954989.1|498207_500802_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	20.5	2.5e-24
>prophage 39
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	506034	506877	5042960		Rhodococcus_phage(100.0%)	1	NA	NA
WP_126623700.1|506034_506877_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	40.2	4.4e-39
>prophage 40
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	517955	518570	5042960	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_126623699.1|517955_518570_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.1	4.3e-28
>prophage 41
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	522871	523993	5042960		Bacillus_virus(100.0%)	1	NA	NA
WP_032954977.1|522871_523993_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	6.0e-28
>prophage 42
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	530075	530861	5042960		Planktothrix_phage(100.0%)	1	NA	NA
WP_029579163.1|530075_530861_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.5	1.4e-34
>prophage 43
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	547454	548471	5042960		Acinetobacter_phage(100.0%)	1	NA	NA
WP_029579147.1|547454_548471_+	XdhC family protein	NA	A0A0P0IKN7	Acinetobacter_phage	29.1	5.5e-12
>prophage 44
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	556993	558649	5042960		Planktothrix_phage(100.0%)	1	NA	NA
WP_029579140.1|556993_558649_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	5.4e-25
>prophage 45
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	585499	585817	5042960		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_032978764.1|585499_585817_-	DUF4102 domain-containing protein	NA	Q8W6M6	Sinorhizobium_phage	42.2	7.4e-08
>prophage 46
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	591983	594695	5042960		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_029579109.1|591983_592742_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	2.2e-13
WP_029579108.1|592738_593668_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_029579107.1|593693_594695_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	41.6	3.9e-63
>prophage 47
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	613569	615285	5042960		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_029579086.1|613569_615285_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	29.4	5.5e-57
>prophage 48
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	627769	631480	5042960		EBPR_podovirus(33.33%)	4	NA	NA
WP_032978790.1|627769_628069_-	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	38.9	9.7e-10
WP_080700940.1|628109_629717_-	TIGR02391 family protein	NA	NA	NA	NA	NA
WP_032978793.1|629748_630816_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	38.5	4.4e-52
WP_080700941.1|631063_631480_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	48.8	8.7e-33
>prophage 49
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	640946	641945	5042960		Cedratvirus(100.0%)	1	NA	NA
WP_032977773.1|640946_641945_+	D-glycerate dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	33.1	2.5e-33
>prophage 50
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	650545	657154	5042960	tRNA	Bacillus_virus(66.67%)	7	NA	NA
WP_029579060.1|650545_651241_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.9	4.1e-11
WP_095075213.1|651248_651407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032954875.1|651734_652058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080666543.1|652248_652497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029579059.1|652741_654091_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.0	2.5e-89
WP_048939890.1|654445_655810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029579057.1|655816_657154_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.0	6.0e-75
>prophage 51
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	662013	663989	5042960		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_032977782.1|662013_663015_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.8	1.8e-07
WP_095075214.1|663011_663989_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	24.7	4.8e-05
>prophage 52
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	667420	670779	5042960		Mycobacterium_phage(50.0%)	2	NA	NA
WP_029579046.1|667420_669784_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.0	3.4e-81
WP_029579045.1|669825_670779_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	41.5	2.1e-61
>prophage 53
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	676617	686106	5042960		Paramecium_bursaria_Chlorella_virus(25.0%)	8	NA	NA
WP_032954868.1|676617_678747_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.3	6.1e-21
WP_029579038.1|678759_679344_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_032977790.1|679377_682101_+	DUF4118 domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.6	3.0e-12
WP_029579036.1|682105_682798_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	33.3	2.8e-28
WP_032977792.1|682909_683659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126623669.1|683756_683978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029579033.1|683987_684935_+	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_029579032.1|684849_686106_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	1.5e-11
>prophage 54
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	690260	696266	5042960		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_032954863.1|690260_693017_+	insulinase family protein	NA	A0A2L2DIR8	Acanthamoeba_polyphaga_mimivirus	27.8	3.3e-19
WP_032971496.1|693098_694223_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	28.6	6.5e-22
WP_029579022.1|694331_696266_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.2	3.8e-147
>prophage 55
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	728906	773006	5042960	integrase,head,terminase	Aeromonas_phage(25.0%)	59	726209:726254	773104:773149
726209:726254	attL	ATTGCAAATCCGTGTACGTCGGTTCGATTCCGGCTTGCGCCTCCAA	NA	NA	NA	NA
WP_142028304.1|728906_729398_-	hypothetical protein	NA	I6NSS1	Burkholderia_phage	57.4	3.8e-43
WP_142028305.1|729401_729845_-	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	38.5	3.7e-13
WP_142028306.1|729942_730413_-	hypothetical protein	NA	B0VK51	Azospirillum_phage	49.3	1.0e-13
WP_142028307.1|730431_731211_-	hypothetical protein	NA	Q8HAM8	Burkholderia_phage	41.8	7.4e-17
WP_142028432.1|731200_731953_-	DUF2612 domain-containing protein	NA	A0A219YBB5	Aeromonas_phage	50.9	2.1e-45
WP_032970920.1|732711_733920_-	phage Mu protein	NA	A0A2R3UAL9	Myoviridae_environmental_samples	49.3	9.8e-101
WP_142028308.1|733927_734278_-	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	40.4	8.1e-16
WP_142028309.1|734279_735050_-	oxidoreductase	NA	H9C0X6	Aeromonas_phage	40.2	1.0e-39
WP_142028310.1|735042_735906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142028311.1|735902_736202_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	42.4	1.3e-17
WP_142028312.1|736198_736834_-	hypothetical protein	NA	K4IBX5	Acinetobacter_phage	32.6	2.9e-19
WP_142028313.1|736833_738645_-	hypothetical protein	NA	H9C0W9	Aeromonas_phage	27.3	5.7e-20
WP_142028314.1|738811_739249_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	45.5	1.4e-17
WP_142028315.1|739250_739682_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	41.3	9.7e-19
WP_142028316.1|739694_741173_-	DUF3383 family protein	NA	H9C0W5	Aeromonas_phage	40.7	2.5e-90
WP_141984728.1|741177_741711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142028317.1|741707_742085_-	hypothetical protein	NA	H9C0W3	Aeromonas_phage	50.4	2.1e-25
WP_051621495.1|742081_742534_-	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	51.6	7.8e-27
WP_141984730.1|742521_742953_-	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	50.4	2.7e-21
WP_142028318.1|742962_743301_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	36.5	5.5e-09
WP_142028319.1|743366_744395_-	DUF2184 domain-containing protein	NA	Q8HAP7	Burkholderia_phage	47.9	1.5e-81
WP_032970948.1|744399_744885_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	55.1	4.0e-37
WP_142028320.1|744885_746268_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	38.8	2.5e-68
WP_141984991.1|746264_746957_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.1	3.2e-56
WP_142028321.1|747060_748611_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	2.5e-101
WP_142028322.1|748607_748796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142028323.1|748792_750283_-|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	37.9	3.2e-69
WP_142028324.1|750242_750818_-|terminase	terminase small subunit	terminase	U5PZD3	Bacillus_phage	38.7	2.6e-27
WP_032970956.1|750867_751170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032970959.1|751166_751523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032970963.1|752065_752395_-	DUF1064 domain-containing protein	NA	A0A0R6PI24	Moraxella_phage	50.0	9.7e-19
WP_142028325.1|752394_753783_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	46.1	4.9e-96
WP_142028326.1|753779_754604_-	hypothetical protein	NA	A0A2I7RQ47	Vibrio_phage	34.6	2.1e-09
WP_142028433.1|754624_755047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142028327.1|755079_755538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080703241.1|755540_755849_-	DNA-binding protein	NA	A0A1S5NNI6	Burkholderia_phage	47.8	6.7e-14
WP_142028328.1|756171_756423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142028329.1|756467_756671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142028330.1|756751_757231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142028331.1|757542_758505_+	helix-turn-helix domain-containing protein	NA	A0A1C6ZDG7	Pseudomonas_phage	29.8	8.3e-10
WP_142028332.1|758607_758895_+	ADP-ribosyl-(dinitrogen reductase) hydrolase	NA	NA	NA	NA	NA
WP_142028333.1|758906_759254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142028434.1|760962_761907_+	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	45.0	4.0e-25
WP_142028334.1|761941_762517_+	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	74.2	2.1e-45
WP_142028335.1|762563_762761_+	hypothetical protein	NA	I6WMY2	Pseudomonas_phage	85.4	8.9e-12
WP_048940010.1|763162_763486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048940009.1|763577_763892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048940008.1|763888_764092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142028336.1|764093_765194_+	hypothetical protein	NA	Q9MC69	Pseudomonas_phage	47.5	6.3e-38
WP_142028337.1|765201_765957_+	single-stranded DNA-binding protein	NA	B5WZW4	Pseudomonas_phage	59.6	1.5e-46
WP_142028338.1|765956_766592_+	YqaJ viral recombinase family protein	NA	R9TG13	Synechococcus_phage	36.1	9.9e-20
WP_142028339.1|766594_767041_+	single-stranded DNA-binding protein	NA	A0A0S2SXT5	Bacillus_phage	39.4	1.7e-05
WP_142028340.1|767635_768364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142028341.1|768363_768657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142028342.1|768659_769709_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	59.0	1.4e-108
WP_142028343.1|769705_771193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141984993.1|771330_771840_+	HD domain-containing protein	NA	A0A1X9SH80	Bradyrhizobium_phage	38.4	2.5e-21
WP_080701616.1|771864_772182_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032961303.1|772019_773006_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	34.2	5.0e-10
773104:773149	attR	ATTGCAAATCCGTGTACGTCGGTTCGATTCCGGCTTGCGCCTCCAA	NA	NA	NA	NA
>prophage 56
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	784900	786340	5042960		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_126623665.1|784900_786340_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.1	1.4e-50
>prophage 57
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	791301	796931	5042960		Bacillus_phage(50.0%)	4	NA	NA
WP_029578970.1|791301_792141_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.6	1.3e-62
WP_029578969.1|792154_793015_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_032954845.1|793087_794209_-	porin	NA	NA	NA	NA	NA
WP_032954844.1|794195_796931_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.8	3.8e-44
>prophage 58
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	803895	805485	5042960		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_032954842.1|803895_805485_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.2	6.7e-65
>prophage 59
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	808583	813794	5042960		Bacillus_phage(66.67%)	4	NA	NA
WP_032954839.1|808583_809651_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	29.2	7.3e-07
WP_029578953.1|809663_811484_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.8	2.1e-75
WP_032954838.1|811594_812950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029578951.1|813092_813794_+	response regulator	NA	W8CYM9	Bacillus_phage	36.2	2.1e-31
>prophage 60
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	817789	819550	5042960	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_029578947.1|817789_819550_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	51.0	1.4e-164
>prophage 61
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	822842	828314	5042960		Tupanvirus(33.33%)	5	NA	NA
WP_029578941.1|822842_824516_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.4	3.4e-43
WP_032955022.1|824783_825662_-	DMT family transporter	NA	NA	NA	NA	NA
WP_029578939.1|825813_826329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029578938.1|826347_827343_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.9	8.0e-16
WP_029578937.1|827339_828314_-	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	25.5	2.3e-07
>prophage 62
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	835143	836472	5042960		Klosneuvirus(100.0%)	1	NA	NA
WP_029578930.1|835143_836472_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.5	2.6e-22
>prophage 63
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	842592	843354	5042960		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_029578923.1|842592_843354_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	2.5e-09
>prophage 64
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	849765	850926	5042960		Stx2-converting_phage(100.0%)	1	NA	NA
WP_032954831.1|849765_850926_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	38.2	6.2e-44
>prophage 65
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	855849	856797	5042960		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032954827.1|855849_856797_-	2-hydroxyacid dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	27.7	4.5e-16
>prophage 66
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	867196	869139	5042960		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_029578466.1|867196_868180_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	9.7e-06
WP_032954823.1|868176_869139_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.3	5.7e-19
>prophage 67
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	881402	882482	5042960		Bacillus_virus(100.0%)	1	NA	NA
WP_032977849.1|881402_882482_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	9.9e-28
>prophage 68
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	886582	888181	5042960		Tupanvirus(100.0%)	1	NA	NA
WP_080666526.1|886582_888181_+	catalase	NA	A0A2K9L0T1	Tupanvirus	40.1	1.0e-97
>prophage 69
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	907972	910538	5042960		Trichoplusia_ni_ascovirus(100.0%)	3	NA	NA
WP_029578438.1|907972_908716_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	6.6e-15
WP_029578437.1|908745_909696_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_029578436.1|909773_910538_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	9.2e-12
>prophage 70
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	914664	922118	5042960		Brazilian_cedratvirus(33.33%)	7	NA	NA
WP_029578431.1|914664_915384_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.4	4.9e-15
WP_029578430.1|915376_916384_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032954808.1|916380_917265_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_029578428.1|917305_919036_-	acetolactate synthase catalytic subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	28.5	2.5e-33
WP_080666524.1|919142_919874_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029578426.1|920038_920716_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029578425.1|920729_922118_-	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	33.0	5.1e-53
>prophage 71
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	937247	941343	5042960		Micromonas_sp._RCC1109_virus(66.67%)	4	NA	NA
WP_032977878.1|937247_938111_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	26.4	3.8e-06
WP_080700905.1|938149_939067_-	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_032958866.1|939351_940389_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.9	4.0e-42
WP_029578404.1|940404_941343_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	33.2	9.8e-32
>prophage 72
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	948000	949971	5042960		uncultured_virus(100.0%)	2	NA	NA
WP_029578395.1|948000_949623_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	59.7	4.6e-170
WP_029578394.1|949653_949971_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	48.9	6.0e-18
>prophage 73
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	954886	955942	5042960		Planktothrix_phage(100.0%)	1	NA	NA
WP_029578390.1|954886_955942_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.4	1.4e-23
>prophage 74
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	974769	979361	5042960		uncultured_virus(66.67%)	6	NA	NA
WP_080700910.1|974769_974994_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	59.7	1.4e-16
WP_080700920.1|975227_975767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032977905.1|975763_976180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032977908.1|976169_976940_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_029578378.1|977398_977686_+	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	51.1	9.0e-21
WP_029578377.1|977720_979361_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.0	3.7e-167
>prophage 75
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	983090	987409	5042960		Pseudomonas_phage(33.33%)	6	NA	NA
WP_032955466.1|983090_983648_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	39.8	9.9e-24
WP_032977917.1|983644_984148_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_032977920.1|984215_985184_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_032955468.1|985191_985683_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_032955469.1|985702_986224_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	34.5	5.3e-11
WP_032955472.1|986233_987409_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	M4QPK3	Synechococcus_phage	41.9	2.4e-35
>prophage 76
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	993151	994604	5042960		Cedratvirus(50.0%)	2	NA	NA
WP_095075263.1|993151_993922_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	27.8	3.1e-15
WP_032977926.1|993908_994604_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	1.0e-09
>prophage 77
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1001336	1002107	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_029578354.1|1001336_1002107_+	phosphonate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	37.2	3.3e-17
>prophage 78
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1007500	1008338	5042960		uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_029578348.1|1007500_1008013_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.9	2.5e-29
WP_029578347.1|1008083_1008338_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.4	3.3e-19
>prophage 79
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1013378	1015457	5042960		Acinetobacter_phage(100.0%)	1	NA	NA
WP_032977940.1|1013378_1015457_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.9	6.8e-09
>prophage 80
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1031870	1035023	5042960		Liberibacter_phage(100.0%)	1	NA	NA
WP_032977961.1|1031870_1035023_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.0	5.8e-68
>prophage 81
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1038468	1039491	5042960		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_126623658.1|1038468_1039491_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	27.5	3.9e-26
>prophage 82
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1044314	1045247	5042960		Tupanvirus(100.0%)	1	NA	NA
WP_095075218.1|1044314_1045247_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.0	2.7e-42
>prophage 83
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1059485	1060832	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_032955511.1|1059485_1060832_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.6	1.4e-10
>prophage 84
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1063865	1065251	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_032978035.1|1063865_1065251_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	32.4	1.3e-53
>prophage 85
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1070219	1075652	5042960		Chrysochromulina_ericina_virus(50.0%)	4	NA	NA
WP_029578300.1|1070219_1072130_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0N9QYX6	Chrysochromulina_ericina_virus	24.4	5.4e-21
WP_032978517.1|1072144_1073269_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_029578298.1|1073269_1074625_-	membrane protein	NA	NA	NA	NA	NA
WP_029578297.1|1074626_1075652_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	E3T4Y8	Cafeteria_roenbergensis_virus	42.5	1.4e-68
>prophage 86
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1080150	1081610	5042960		Equid_gammaherpesvirus(50.0%)	2	NA	NA
WP_029578292.1|1080150_1081122_+	thymidylate synthase	NA	A0A0B4Q5G0	Equid_gammaherpesvirus	38.3	5.5e-54
WP_032954743.1|1081118_1081610_+	dihydrofolate reductase	NA	A0A0S2MU93	Bacillus_phage	38.9	2.9e-27
>prophage 87
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1091229	1092882	5042960		Mycoplasma_phage(100.0%)	1	NA	NA
WP_029578283.1|1091229_1092882_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	31.8	1.1e-06
>prophage 88
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1098168	1101042	5042960		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_029578279.1|1098168_1101042_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	52.1	3.7e-263
>prophage 89
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1107203	1108985	5042960		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_029578271.1|1107203_1108985_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	1.4e-10
>prophage 90
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1117164	1117728	5042960		Pseudomonas_phage(100.0%)	1	NA	NA
WP_029578263.1|1117164_1117728_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	74.7	4.4e-72
>prophage 91
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1124995	1127071	5042960	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_029578258.1|1124995_1127071_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.4	7.7e-29
>prophage 92
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1131467	1135147	5042960		Chrysochromulina_ericina_virus(50.0%)	4	NA	NA
WP_032958091.1|1131467_1132391_-	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	37.0	3.9e-25
WP_080700312.1|1132607_1133033_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_029578249.1|1133029_1133881_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032958093.1|1134091_1135147_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	1.9e-28
>prophage 93
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1148118	1149572	5042960		Cedratvirus(50.0%)	2	NA	NA
WP_032963730.1|1148118_1148862_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	24.0	2.9e-10
WP_029578233.1|1148858_1149572_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.4	1.1e-06
>prophage 94
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1153809	1154853	5042960		Klosneuvirus(100.0%)	1	NA	NA
WP_029578227.1|1153809_1154853_+	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	54.5	8.5e-101
>prophage 95
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1165711	1166437	5042960		Planktothrix_phage(100.0%)	1	NA	NA
WP_029578216.1|1165711_1166437_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.5e-32
>prophage 96
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1191123	1193614	5042960		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_032958170.1|1191123_1191879_-	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	33.5	2.2e-21
WP_032958171.1|1192056_1193016_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032958173.1|1193017_1193614_-	cupin domain-containing protein	NA	Q786F1	Bacillus_phage	41.9	2.9e-05
>prophage 97
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1244328	1246344	5042960		Streptococcus_phage(100.0%)	1	NA	NA
WP_032972638.1|1244328_1246344_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	27.8	9.8e-29
>prophage 98
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1313586	1314822	5042960	transposase	Ralstonia_virus(100.0%)	1	NA	NA
WP_032972546.1|1313586_1314822_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	26.8	8.7e-28
>prophage 99
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1334344	1340092	5042960	integrase	Pseudomonas_phage(50.0%)	4	1327328:1327343	1346390:1346405
1327328:1327343	attL	CATCGTCACCCGCGCC	NA	NA	NA	NA
WP_032972511.1|1334344_1336270_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	48.3	5.9e-100
WP_032979492.1|1336677_1337637_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_048939750.1|1337660_1339130_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_032979493.1|1339126_1340092_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	28.0	4.7e-13
1346390:1346405	attR	GGCGCGGGTGACGATG	NA	NA	NA	NA
>prophage 100
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1344010	1345033	5042960		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_029578084.1|1344010_1345033_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4UUK0	Bodo_saltans_virus	26.5	4.3e-25
>prophage 101
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1350166	1353646	5042960		Bacillus_virus(100.0%)	4	NA	NA
WP_029578077.1|1350166_1350613_+	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	46.9	3.0e-07
WP_032979498.1|1350743_1351451_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_029578075.1|1351447_1352341_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032963496.1|1352563_1353646_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	1.9e-31
>prophage 102
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1359025	1361743	5042960		Sphingobium_phage(33.33%)	4	NA	NA
WP_032958372.1|1359025_1359634_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	29.1	1.2e-06
WP_032979500.1|1359648_1360269_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_029578066.1|1360308_1361016_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	25.7	9.1e-06
WP_032963486.1|1361020_1361743_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	2.1e-10
>prophage 103
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1369591	1377267	5042960	integrase	Oenococcus_phage(25.0%)	5	1361641:1361655	1377345:1377359
1361641:1361655	attL	TGATGGCGACGATCT	NA	NA	NA	NA
WP_029578056.1|1369591_1370740_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	37.2	1.2e-58
WP_029578055.1|1370766_1372068_+	MFS transporter	NA	NA	NA	NA	NA
WP_032959715.1|1372335_1374228_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.5	3.2e-122
WP_032979502.1|1374420_1375812_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	49.3	1.5e-28
WP_032979503.1|1376139_1377267_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.0	4.5e-47
1377345:1377359	attR	AGATCGTCGCCATCA	NA	NA	NA	NA
>prophage 104
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1381842	1387140	5042960		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_126623652.1|1381842_1382058_-	hypothetical protein	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	73.5	1.6e-09
WP_052097482.1|1383100_1383334_+	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_127814772.1|1383455_1384340_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	35.2	2.1e-20
WP_126623651.1|1384336_1384798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126623650.1|1384804_1385497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032979507.1|1385916_1387140_-	glycosyltransferase family 1 protein	NA	A0A1L3KK54	Shahe_endorna-like_virus	38.8	2.0e-08
>prophage 105
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1399294	1400281	5042960		Streptococcus_phage(100.0%)	1	NA	NA
WP_032979533.1|1399294_1400281_+	D-2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.3	4.5e-11
>prophage 106
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1409455	1412047	5042960		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032964274.1|1409455_1412047_-	type II secretion system secretin GspD	NA	G4WZN6	Enterobacteria_phage	35.4	9.9e-34
>prophage 107
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1425435	1432533	5042960		Leptospira_phage(66.67%)	5	NA	NA
WP_029578011.1|1425435_1426623_+	efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	22.9	6.9e-06
WP_142028354.1|1426648_1429834_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.4	2.8e-06
WP_032958410.1|1429848_1431327_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_032979516.1|1431378_1431909_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_029578007.1|1431972_1432533_+	5'-3'-deoxyribonucleotidase	NA	A0A1E1EUN3	Acanthamoeba_castellanii_mimivirus	32.2	1.3e-15
>prophage 108
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1437739	1440149	5042960		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_029578002.1|1437739_1438282_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	42.3	3.9e-25
WP_029578001.1|1438278_1439433_+	MFS transporter	NA	NA	NA	NA	NA
WP_029578000.1|1439429_1440149_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.3	2.3e-49
>prophage 109
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1458833	1459910	5042960		Pseudomonas_phage(100.0%)	1	NA	NA
WP_029577979.1|1458833_1459910_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	3.3e-07
>prophage 110
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1465807	1469859	5042960		Pandoravirus(25.0%)	4	NA	NA
WP_032958446.1|1465807_1466641_+	metallophosphoesterase	NA	S4VP02	Pandoravirus	27.1	5.5e-18
WP_029577972.1|1466637_1468116_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	64.5	1.2e-164
WP_029577971.1|1468409_1469150_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.6e-15
WP_032979519.1|1469151_1469859_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.5	1.1e-16
>prophage 111
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1489867	1494348	5042960		Ralstonia_phage(50.0%)	2	NA	NA
WP_029577951.1|1489867_1491727_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.4	1.9e-26
WP_032979523.1|1491723_1494348_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.1	1.2e-82
>prophage 112
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1503727	1504861	5042960		Streptococcus_phage(100.0%)	1	NA	NA
WP_032979524.1|1503727_1504861_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.2	5.8e-63
>prophage 113
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1510890	1511874	5042960		Escherichia_phage(100.0%)	1	NA	NA
WP_029577932.1|1510890_1511874_+	TerC family protein	NA	K7QKE8	Escherichia_phage	34.0	1.9e-41
>prophage 114
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1516395	1517847	5042960		Moraxella_phage(100.0%)	1	NA	NA
WP_029577927.1|1516395_1517847_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	27.2	1.2e-20
>prophage 115
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1520872	1521130	5042960		Rhizobium_phage(100.0%)	1	NA	NA
WP_029577923.1|1520872_1521130_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	46.2	9.5e-14
>prophage 116
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1554241	1555876	5042960		Klosneuvirus(100.0%)	1	NA	NA
WP_048939731.1|1554241_1555876_+	FAD-binding protein	NA	A0A1V0SI18	Klosneuvirus	30.7	3.2e-54
>prophage 117
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1559859	1566807	5042960	tRNA	Bacillus_virus(20.0%)	9	NA	NA
WP_032958499.1|1559859_1560582_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.9	4.0e-09
WP_029579777.1|1560593_1561784_+	CoA transferase	NA	NA	NA	NA	NA
WP_032958501.1|1561794_1562718_+	hydroxymethylglutaryl-CoA lyase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	35.7	4.1e-06
WP_032958503.1|1562820_1563408_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	23.5	8.9e-07
WP_032979198.1|1563418_1563997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029579781.1|1563993_1564629_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_029579782.1|1564635_1565262_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_029579783.1|1565258_1566200_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	41.8	2.0e-08
WP_029579784.1|1566294_1566807_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.3	6.5e-22
>prophage 118
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1573474	1577091	5042960		Thermus_phage(50.0%)	4	NA	NA
WP_032973730.1|1573474_1574584_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	41.3	3.0e-27
WP_029579792.1|1574660_1575569_+	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_029579793.1|1575600_1576071_+	membrane protein	NA	NA	NA	NA	NA
WP_029579794.1|1576074_1577091_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	43.2	1.0e-74
>prophage 119
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1586107	1594345	5042960		Bacillus_phage(25.0%)	6	NA	NA
WP_032958516.1|1586107_1588030_+	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.5	4.5e-07
WP_029579805.1|1588051_1588774_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.1	4.9e-15
WP_032973708.1|1588806_1590525_-	acid phosphatase	NA	NA	NA	NA	NA
WP_029579807.1|1590709_1591408_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_029579808.1|1591572_1593543_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	23.1	2.4e-35
WP_029579809.1|1593544_1594345_+	ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	21.7	1.9e-07
>prophage 120
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1604797	1605988	5042960		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032979239.1|1604797_1605988_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	59.5	2.7e-103
>prophage 121
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1610686	1617879	5042960	tRNA	Feline_herpesvirus(25.0%)	5	NA	NA
WP_029579829.1|1610686_1611445_+	uracil-DNA glycosylase	NA	O37930	Feline_herpesvirus	50.6	1.0e-42
WP_126623644.1|1611673_1613404_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.3	2.0e-54
WP_032979203.1|1613504_1614677_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_029579832.1|1614673_1615765_-|tRNA	tRNA CCA-pyrophosphorylase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	48.7	2.6e-52
WP_029579833.1|1615761_1617879_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	39.4	3.2e-14
>prophage 122
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1627130	1628552	5042960		Pandoravirus(100.0%)	1	NA	NA
WP_029579845.1|1627130_1628552_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	28.8	3.6e-38
>prophage 123
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1635301	1641080	5042960		Staphylococcus_phage(33.33%)	6	NA	NA
WP_029579853.1|1635301_1636465_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.3	5.3e-128
WP_029579854.1|1636741_1637596_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_029579855.1|1637592_1638486_+	lysophospholipid acyltransferase family protein	NA	A0A1W6JP29	Morganella_phage	29.6	5.1e-30
WP_029579856.1|1638510_1639407_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_029579857.1|1639431_1640100_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_032979206.1|1640108_1641080_+	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	31.5	4.4e-11
>prophage 124
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1646570	1647320	5042960		Planktothrix_phage(100.0%)	1	NA	NA
WP_032959699.1|1646570_1647320_-	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	6.2e-05
>prophage 125
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1650771	1652106	5042960	protease	Erwinia_phage(100.0%)	1	NA	NA
WP_029579868.1|1650771_1652106_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.0	4.2e-44
>prophage 126
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1656264	1660684	5042960		Stx2-converting_phage(50.0%)	5	NA	NA
WP_029579875.1|1656264_1657536_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.5	2.2e-66
WP_029579876.1|1657668_1658316_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_029579877.1|1658348_1658939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032979207.1|1658943_1659870_-	MCE family protein	NA	NA	NA	NA	NA
WP_032958605.1|1659856_1660684_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.9	3.6e-22
>prophage 127
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1666060	1669510	5042960		Escherichia_phage(100.0%)	4	NA	NA
WP_029579885.1|1666060_1666633_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	43.2	3.4e-35
WP_029579886.1|1666629_1667511_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	63.0	2.3e-99
WP_032979209.1|1667507_1668407_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.5	8.0e-23
WP_032958609.1|1668403_1669510_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.1	6.9e-85
>prophage 128
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1676108	1682109	5042960	tRNA,holin	Catovirus(33.33%)	5	NA	NA
WP_032963148.1|1676108_1677899_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	23.6	1.7e-08
WP_032958616.1|1677939_1678575_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	27.6	1.3e-11
WP_029579897.1|1678577_1678892_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_032979211.1|1679064_1680345_-	membrane protein	NA	NA	NA	NA	NA
WP_029579899.1|1680486_1682109_-|holin	choline dehydrogenase	holin	A0A2I2L3D3	Orpheovirus	26.8	1.5e-24
>prophage 129
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1689670	1691164	5042960		Staphylococcus_phage(100.0%)	1	NA	NA
WP_029579906.1|1689670_1691164_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	1.0e-14
>prophage 130
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1700566	1701640	5042960		Bacillus_virus(100.0%)	1	NA	NA
WP_029579914.1|1700566_1701640_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	2.7e-25
>prophage 131
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1707910	1714831	5042960		Acanthocystis_turfacea_Chlorella_virus(33.33%)	5	NA	NA
WP_142028360.1|1707910_1710649_-	HAD-IC family P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	30.0	1.3e-76
WP_029579920.1|1711025_1712072_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_029579921.1|1712080_1712650_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_029579922.1|1712657_1713752_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.8	1.9e-31
WP_029579923.1|1713748_1714831_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	34.4	1.9e-47
>prophage 132
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1718082	1724228	5042960		Moumouvirus(50.0%)	4	NA	NA
WP_032958639.1|1718082_1719969_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	27.2	1.0e-24
WP_032979220.1|1719979_1721200_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032979240.1|1721189_1722248_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_032979221.1|1722359_1724228_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	27.3	6.1e-25
>prophage 133
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1727489	1729370	5042960		Catovirus(100.0%)	1	NA	NA
WP_032979223.1|1727489_1729370_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SBE6	Catovirus	25.2	1.6e-12
>prophage 134
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1736718	1747223	5042960		Staphylococcus_phage(20.0%)	7	NA	NA
WP_126623641.1|1736718_1738203_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	3.0e-11
WP_032979229.1|1738001_1738850_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032979230.1|1738944_1740813_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	27.3	4.7e-25
WP_032979231.1|1740814_1741792_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	35.6	7.0e-41
WP_032958648.1|1742228_1742738_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	50.3	5.3e-40
WP_032958650.1|1743000_1744185_-	MFS transporter	NA	NA	NA	NA	NA
WP_029579943.1|1744364_1747223_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.1	1.3e-297
>prophage 135
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1750415	1751498	5042960		Ostreococcus_mediterraneus_virus(100.0%)	1	NA	NA
WP_029579947.1|1750415_1751498_-	3-dehydroquinate synthase	NA	A0A0P0C619	Ostreococcus_mediterraneus_virus	35.5	9.6e-23
>prophage 136
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1775867	1776686	5042960		Pandoravirus(100.0%)	1	NA	NA
WP_051593812.1|1775867_1776686_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	S4VR59	Pandoravirus	43.4	1.0e-21
>prophage 137
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1782887	1783619	5042960		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_032955620.1|1782887_1783619_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.7	1.2e-08
>prophage 138
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1791249	1797769	5042960		Klosneuvirus(33.33%)	6	NA	NA
WP_029579994.1|1791249_1792440_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	29.6	1.5e-13
WP_029577155.1|1792516_1794619_-	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	26.1	3.6e-58
WP_029577156.1|1794637_1795108_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_005017264.1|1795273_1795651_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_029577157.1|1796081_1796795_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032957244.1|1797070_1797769_+	response regulator transcription factor	NA	A0A220YL79	Alteromonas_virus	27.0	5.8e-05
>prophage 139
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1803140	1819778	5042960		Vibrio_phage(16.67%)	12	NA	NA
WP_029577162.1|1803140_1807382_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	24.9	2.0e-68
WP_029577163.1|1807381_1811494_-	DNA-directed RNA polymerase subunit beta	NA	E3T4Z4	Cafeteria_roenbergensis_virus	23.4	7.4e-23
WP_029577164.1|1811655_1812036_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_029577165.1|1812120_1812645_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_029577166.1|1812888_1813587_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_029577167.1|1813589_1814021_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_029577168.1|1814080_1814614_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	31.2	9.9e-13
WP_029577169.1|1814622_1815003_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_029579994.1|1815300_1816491_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	29.6	1.5e-13
WP_029577879.1|1816988_1817996_-	asparaginase	NA	NA	NA	NA	NA
WP_032972805.1|1817988_1818897_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	35.9	2.3e-14
WP_029577881.1|1818983_1819778_-	ParA family protein	NA	Q8JL10	Natrialba_phage	34.3	7.3e-20
>prophage 140
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1823416	1823623	5042960		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_029577884.1|1823416_1823623_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.5	6.2e-16
>prophage 141
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1852652	1854664	5042960		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_029577184.1|1852652_1853639_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.1	3.9e-07
WP_126623694.1|1853638_1854664_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.9	1.8e-15
>prophage 142
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1860665	1867222	5042960		Staphylococcus_phage(33.33%)	6	NA	NA
WP_080666487.1|1860665_1860953_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	53.6	3.7e-14
WP_032962136.1|1860949_1861321_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_029577875.1|1861443_1861578_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_029577874.1|1862122_1863574_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_095075157.1|1863570_1864686_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	29.6	6.2e-41
WP_029577872.1|1864768_1867222_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.8	7.8e-113
>prophage 143
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1876290	1878552	5042960		Escherichia_phage(100.0%)	1	NA	NA
WP_029577861.1|1876290_1878552_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	29.7	3.9e-66
>prophage 144
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1886524	1888054	5042960		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_032978956.1|1886524_1888054_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.3	1.5e-05
>prophage 145
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1892501	1893677	5042960		Enterococcus_phage(50.0%)	2	NA	NA
WP_029577846.1|1892501_1892996_+	nucleoside 2-deoxyribosyltransferase	NA	A0A1G5S9Z4	Enterococcus_phage	32.2	3.7e-06
WP_032978950.1|1893008_1893677_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.5	2.6e-34
>prophage 146
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1897157	1898984	5042960		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_029577840.1|1897157_1898984_+	biosynthetic-type acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	29.5	9.4e-55
>prophage 147
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1902963	1907520	5042960		Cedratvirus(50.0%)	3	NA	NA
WP_095075158.1|1902963_1903737_-	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	29.0	4.0e-15
WP_032978944.1|1903733_1904780_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032978941.1|1904898_1907520_-	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	26.1	8.0e-23
>prophage 148
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1918713	1923887	5042960		Klosneuvirus(50.0%)	4	NA	NA
WP_029577825.1|1918713_1919904_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.3	2.7e-18
WP_029577824.1|1919960_1920206_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_032978919.1|1920226_1922254_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_029577822.1|1922279_1923887_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	73.6	2.1e-21
>prophage 149
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1941133	1944157	5042960		Planktothrix_phage(50.0%)	3	NA	NA
WP_029577805.1|1941133_1942174_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.9e-20
WP_029577804.1|1942339_1943161_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_032978916.1|1943170_1944157_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.1	1.3e-23
>prophage 150
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1957556	1964775	5042960		Tupanvirus(33.33%)	6	NA	NA
WP_029577790.1|1957556_1959164_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.2	1.2e-13
WP_032957635.1|1959188_1959818_-	LysE family transporter	NA	NA	NA	NA	NA
WP_126623693.1|1959833_1961237_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	29.3	2.5e-39
WP_029577787.1|1961552_1962158_+	LemA family protein	NA	NA	NA	NA	NA
WP_032957640.1|1962138_1963041_+	YgcG family protein	NA	NA	NA	NA	NA
WP_032979422.1|1963047_1964775_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.7	1.0e-10
>prophage 151
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1968649	1970026	5042960		Moraxella_phage(100.0%)	1	NA	NA
WP_029577781.1|1968649_1970026_-	GTPase/DUF3482 domain-containing protein	NA	A0A0R6PFW5	Moraxella_phage	35.7	3.0e-53
>prophage 152
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1975503	1976346	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_032979420.1|1975503_1976346_-	hypothetical protein	NA	S5M4R0	Bacillus_phage	24.0	4.7e-09
>prophage 153
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1982187	1984137	5042960	protease	uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_029577767.1|1982187_1983318_+|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	35.8	5.2e-11
WP_095075159.1|1983378_1984137_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	33.7	3.1e-28
>prophage 154
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	1994373	1998935	5042960		Pithovirus(50.0%)	6	NA	NA
WP_032962866.1|1994373_1995183_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	34.3	7.2e-23
WP_029577749.1|1995314_1995941_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_029577748.1|1995967_1996756_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_029577747.1|1996824_1997307_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_029577746.1|1997319_1998102_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_029577745.1|1998098_1998935_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.8	3.3e-15
>prophage 155
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2007605	2015756	5042960		Prochlorococcus_phage(33.33%)	7	NA	NA
WP_029577740.1|2007605_2008712_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.5	6.1e-33
WP_032979418.1|2008722_2009562_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_029577738.1|2009619_2010303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029577737.1|2010401_2010860_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_029577736.1|2010989_2011877_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.5	1.1e-40
WP_032979425.1|2012184_2012970_-	3',5'-cyclic-nucleotide phosphodiesterase	NA	NA	NA	NA	NA
WP_032962870.1|2013188_2015756_+	cyclic nucleotide-binding domain-containing protein	NA	A0A2H4J178	uncultured_Caudovirales_phage	29.9	6.2e-12
>prophage 156
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2019225	2020827	5042960		Flavobacterium_phage(100.0%)	1	NA	NA
WP_029577730.1|2019225_2020827_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	39.1	5.2e-09
>prophage 157
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2028164	2038640	5042960		Saudi_moumouvirus(25.0%)	7	NA	NA
WP_029577718.1|2028164_2029538_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A1S5V090	Saudi_moumouvirus	35.0	9.6e-28
WP_080700972.1|2029534_2030929_+	MFS transporter	NA	NA	NA	NA	NA
WP_029577716.1|2031006_2032329_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.8e-76
WP_032979415.1|2032325_2033381_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_029577714.1|2033381_2033894_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_029577713.1|2034039_2035872_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	48.9	2.7e-158
WP_032979414.1|2036147_2038640_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	27.2	1.6e-09
>prophage 158
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2058784	2060285	5042960		Indivirus(100.0%)	2	NA	NA
WP_029577691.1|2058784_2059504_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.6	1.1e-09
WP_029577690.1|2059490_2060285_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	22.4	1.9e-07
>prophage 159
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2068008	2069425	5042960		Staphylococcus_phage(50.0%)	2	NA	NA
WP_029577682.1|2068008_2068710_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.1e-14
WP_029577681.1|2068693_2069425_-	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	23.6	3.1e-09
>prophage 160
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2091499	2092543	5042960		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_029577657.1|2091499_2092543_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.7	5.8e-17
>prophage 161
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2102979	2103765	5042960		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_029577647.1|2102979_2103765_-	heme ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	29.2	2.2e-05
>prophage 162
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2116152	2117583	5042960		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_032979618.1|2116152_2117583_-	DUF1254 domain-containing protein	NA	M1HIG9	Paramecium_bursaria_Chlorella_virus	25.8	2.2e-22
>prophage 163
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2124901	2126830	5042960		Tupanvirus(100.0%)	1	NA	NA
WP_032979620.1|2124901_2126830_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	30.3	1.1e-16
>prophage 164
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2131707	2136897	5042960		Acinetobacter_phage(60.0%)	5	NA	NA
WP_032957975.1|2131707_2132742_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	30.1	2.5e-36
WP_029577620.1|2132911_2133700_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	50.8	2.1e-64
WP_029577619.1|2133696_2134728_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.9	1.4e-71
WP_029577618.1|2134744_2135308_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	61.5	2.8e-66
WP_029577617.1|2135376_2136897_-	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	33.3	8.1e-44
>prophage 165
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2143515	2144466	5042960	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_029577609.1|2143515_2144466_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	67.2	8.2e-95
>prophage 166
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2148660	2150154	5042960		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_029577604.1|2148660_2150154_+	DUF1254 domain-containing protein	NA	M1I2Z8	Paramecium_bursaria_Chlorella_virus	30.1	1.5e-42
>prophage 167
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2162644	2167828	5042960		Bacillus_phage(50.0%)	4	NA	NA
WP_032957956.1|2162644_2164705_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.8	3.4e-101
WP_029577591.1|2164770_2165901_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_032979624.1|2165909_2166815_-	hydrolase	NA	NA	NA	NA	NA
WP_029577589.1|2166817_2167828_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	8.4e-13
>prophage 168
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2186383	2186905	5042960		Tupanvirus(100.0%)	1	NA	NA
WP_029577572.1|2186383_2186905_-	lipocalin family protein	NA	A0A2K9L662	Tupanvirus	33.8	3.1e-19
>prophage 169
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2200144	2200927	5042960		Streptococcus_phage(100.0%)	1	NA	NA
WP_032979627.1|2200144_2200927_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	29.3	1.8e-23
>prophage 170
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2218164	2222541	5042960		Caulobacter_phage(25.0%)	6	NA	NA
WP_029580011.1|2218164_2218767_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	35.4	9.7e-17
WP_032959509.1|2218792_2219230_-	YraN family protein	NA	NA	NA	NA	NA
WP_029580012.1|2219271_2220204_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_032957901.1|2220200_2220758_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.1	1.3e-23
WP_032979629.1|2220766_2221672_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	46.1	2.8e-15
WP_029580015.1|2221668_2222541_-	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	37.0	1.7e-09
>prophage 171
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2226958	2229636	5042960		Cedratvirus(50.0%)	4	NA	NA
WP_029580021.1|2226958_2227744_-	LPS export ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	29.6	8.8e-18
WP_029580022.1|2227788_2228406_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_032957892.1|2228402_2229026_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_029580024.1|2229030_2229636_-	HAD hydrolase family protein	NA	E3T535	Cafeteria_roenbergensis_virus	26.8	8.9e-10
>prophage 172
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2235690	2239700	5042960		Organic_Lake_phycodnavirus(66.67%)	3	NA	NA
WP_032970193.1|2235690_2237433_+	thiol reductant ABC exporter subunit CydD	NA	F2Y1V6	Organic_Lake_phycodnavirus	30.4	3.6e-11
WP_032958007.1|2237429_2239085_+	thiol reductant ABC exporter subunit CydC	NA	F2Y302	Organic_Lake_phycodnavirus	26.6	7.1e-17
WP_029580033.1|2239151_2239700_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	2.4e-30
>prophage 173
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2254149	2255349	5042960		Catovirus(100.0%)	1	NA	NA
WP_029580046.1|2254149_2255349_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	43.8	4.8e-92
>prophage 174
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2261176	2263195	5042960		Hokovirus(50.0%)	2	NA	NA
WP_032957876.1|2261176_2262484_-	phosphate regulon sensor histidine kinase PhoR	NA	A0A1V0SGX0	Hokovirus	25.5	2.5e-17
WP_029580053.1|2262496_2263195_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	37.6	1.0e-33
>prophage 175
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2271311	2272031	5042960		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_029580063.1|2271311_2272031_+	ABC transporter ATP-binding protein	NA	M1H3A1	Paramecium_bursaria_Chlorella_virus	28.9	6.4e-07
>prophage 176
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2279020	2294928	5042960		uncultured_Mediterranean_phage(33.33%)	12	NA	NA
WP_032979286.1|2279020_2280172_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	43.5	3.1e-80
WP_029580073.1|2280251_2280893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029580074.1|2280889_2282443_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4QMK7	Micromonas_pusilla_virus	32.4	7.0e-35
WP_029580075.1|2282626_2283514_+	ferritin	NA	NA	NA	NA	NA
WP_029580076.1|2283540_2284029_+	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	38.1	4.9e-19
WP_029580077.1|2284041_2285373_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_029580078.1|2285377_2286058_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.7	3.9e-14
WP_032963281.1|2286134_2286977_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_029580080.1|2286973_2287771_-	thiazole synthase	NA	NA	NA	NA	NA
WP_095075232.1|2287940_2288816_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032979287.1|2288866_2290813_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	36.1	4.0e-11
WP_032957853.1|2291151_2294928_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	49.2	3.3e-09
>prophage 177
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2309741	2314864	5042960		Pithovirus(33.33%)	5	NA	NA
WP_029580095.1|2309741_2310413_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	28.5	2.1e-12
WP_029580096.1|2310655_2311672_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	42.7	1.2e-72
WP_029580097.1|2311778_2312969_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032957310.1|2312970_2314071_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_029580099.1|2314123_2314864_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	3.7e-34
>prophage 178
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2334776	2335736	5042960		Barns_Ness_breadcrumb_sponge_sobemo-like_virus(100.0%)	1	NA	NA
WP_029580116.1|2334776_2335736_-	Nudix family hydrolase	NA	A0A221LFJ1	Barns_Ness_breadcrumb_sponge_sobemo-like_virus	38.2	5.0e-07
>prophage 179
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2343843	2345327	5042960		Cedratvirus(50.0%)	2	NA	NA
WP_032979295.1|2343843_2344629_+	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	26.3	5.7e-09
WP_032979296.1|2344622_2345327_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.3	1.1e-08
>prophage 180
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2348570	2349383	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_029580130.1|2348570_2349383_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.8	1.3e-19
>prophage 181
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2383030	2391365	5042960		Pseudomonas_phage(75.0%)	6	NA	NA
WP_029580165.1|2383030_2384158_+	cytochrome c552	NA	A0A125RNP0	Pseudomonas_phage	31.9	2.3e-27
WP_032979302.1|2384169_2385600_+	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9L3I8	Tupanvirus	28.1	7.7e-28
WP_029580167.1|2385642_2386197_-	YggT family protein	NA	NA	NA	NA	NA
WP_032956587.1|2386354_2386927_-	histone	NA	NA	NA	NA	NA
WP_029580169.1|2387222_2388416_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	28.0	1.9e-32
WP_029580170.1|2388437_2391365_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	44.2	3.0e-172
>prophage 182
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2401755	2403206	5042960		Staphylococcus_phage(50.0%)	2	NA	NA
WP_032963339.1|2401755_2402460_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.5	3.8e-12
WP_029580178.1|2402456_2403206_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.9	9.0e-12
>prophage 183
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2407126	2408683	5042960		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032956575.1|2407126_2408683_-	benzoate-CoA ligase family protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.0	4.9e-52
>prophage 184
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2425126	2436013	5042960	tRNA	Lake_Baikal_phage(20.0%)	11	NA	NA
WP_029580200.1|2425126_2425498_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	58.3	5.6e-31
WP_032979310.1|2425561_2426689_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_029580202.1|2426696_2428112_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	42.7	2.3e-16
WP_032979311.1|2428388_2429618_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_029580204.1|2429656_2430313_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_032956558.1|2430517_2431768_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.3	3.1e-97
WP_032979312.1|2432025_2432511_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_032979313.1|2432515_2433478_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_029580208.1|2433477_2434038_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_029580209.1|2434235_2435351_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.5	4.4e-39
WP_029580210.1|2435371_2436013_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.6	5.0e-27
>prophage 185
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2445394	2448279	5042960		Lactobacillus_phage(50.0%)	2	NA	NA
WP_032979315.1|2445394_2446291_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	1.1e-13
WP_029580219.1|2446752_2448279_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.3e-54
>prophage 186
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2463756	2465418	5042960		IC4_retrovirus(100.0%)	1	NA	NA
WP_051593971.1|2463756_2465418_-	bifunctional protein-serine/threonine kinase/phosphatase	NA	Q67624	IC4_retrovirus	32.6	9.0e-12
>prophage 187
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2474922	2475264	5042960		Pseudomonas_phage(100.0%)	1	NA	NA
WP_051350509.1|2474922_2475264_-	helix-turn-helix transcriptional regulator	NA	H2BD63	Pseudomonas_phage	40.0	1.7e-05
>prophage 188
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2481370	2494110	5042960		Bacillus_phage(20.0%)	9	NA	NA
WP_032979323.1|2481370_2482789_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	27.5	8.2e-06
WP_029580254.1|2482796_2483606_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_032963396.1|2483623_2484388_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_029580256.1|2484457_2484919_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	51.5	7.6e-38
WP_032979324.1|2485047_2486121_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032979325.1|2486136_2489202_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.1	7.3e-76
WP_029580259.1|2489209_2489944_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.1	4.5e-40
WP_032963400.1|2490405_2491392_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032979326.1|2491395_2494110_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	8.6e-20
>prophage 189
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2497520	2502318	5042960		Shigella_phage(50.0%)	5	NA	NA
WP_029580266.1|2497520_2498567_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	40.1	1.0e-58
WP_029580267.1|2498563_2500153_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_051621624.1|2500088_2500598_-	GtrA family protein	NA	NA	NA	NA	NA
WP_051621623.1|2500523_2501432_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_032955396.1|2501421_2502318_-	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	31.8	2.4e-11
>prophage 190
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2506724	2508839	5042960		Streptococcus_phage(100.0%)	1	NA	NA
WP_029580275.1|2506724_2508839_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.4	3.3e-59
>prophage 191
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2517305	2519036	5042960	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_029580287.1|2517305_2519036_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L0T2	Tupanvirus	31.7	1.3e-10
>prophage 192
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2549040	2550849	5042960		Tupanvirus(100.0%)	1	NA	NA
WP_032964679.1|2549040_2550849_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.4	1.6e-46
>prophage 193
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2570727	2571708	5042960		Xanthomonas_phage(100.0%)	1	NA	NA
WP_142028440.1|2570727_2571708_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	47.7	1.2e-27
>prophage 194
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2584806	2586507	5042960		Staphylococcus_phage(100.0%)	1	NA	NA
WP_142028377.1|2584806_2586507_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	29.3	3.2e-33
>prophage 195
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2591999	2593088	5042960		Cedratvirus(100.0%)	1	NA	NA
WP_142028381.1|2591999_2593088_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.9	6.5e-11
>prophage 196
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2600815	2612044	5042960		Catovirus(28.57%)	8	NA	NA
WP_032956949.1|2600815_2601472_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	21.5	5.8e-07
WP_142028385.1|2601842_2605463_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.9	7.2e-14
WP_142028386.1|2605487_2606846_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.1	7.1e-15
WP_032956956.1|2606904_2608023_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	66.7	3.4e-132
WP_142028387.1|2608044_2608971_+	NAD-dependent epimerase/dehydratase family protein	NA	M4R1H4	Synechococcus_phage	38.4	3.0e-57
WP_142028388.1|2608972_2610136_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A218MN59	uncultured_virus	33.9	1.6e-44
WP_142028389.1|2610128_2610629_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_142028390.1|2610631_2612044_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.2	2.6e-52
>prophage 197
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2616761	2618967	5042960		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_032979160.1|2616761_2617613_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.5	2.1e-49
WP_032964603.1|2617626_2618967_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	31.1	1.9e-44
>prophage 198
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2639775	2640525	5042960		Pithovirus(100.0%)	1	NA	NA
WP_029581576.1|2639775_2640525_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	24.4	8.4e-10
>prophage 199
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2653514	2655496	5042960		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_032979150.1|2653514_2654468_+	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	32.9	6.2e-34
WP_032979149.1|2654464_2655496_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	3.8e-45
>prophage 200
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2665580	2666501	5042960		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_032979143.1|2665580_2666501_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.6	5.3e-14
>prophage 201
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2688251	2689394	5042960		Streptococcus_phage(100.0%)	1	NA	NA
WP_032979133.1|2688251_2689394_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.3	2.1e-36
>prophage 202
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2694545	2695079	5042960		Synechococcus_phage(100.0%)	1	NA	NA
WP_032956999.1|2694545_2695079_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	34.8	9.9e-13
>prophage 203
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2714328	2732584	5042960	tRNA	uncultured_Mediterranean_phage(20.0%)	9	NA	NA
WP_029581532.1|2714328_2715681_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.3	8.9e-26
WP_032957015.1|2715680_2716379_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_032957018.1|2716375_2717071_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_032957020.1|2717319_2718369_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.4	5.9e-70
WP_126623615.1|2718419_2719370_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_032957023.1|2719372_2721238_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.2	1.4e-82
WP_032957115.1|2721358_2721994_+	membrane protein	NA	NA	NA	NA	NA
WP_080700949.1|2722001_2731112_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	28.2	6.0e-25
WP_029581524.1|2731201_2732584_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.5	4.5e-17
>prophage 204
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2741425	2746338	5042960		Moraxella_phage(50.0%)	2	NA	NA
WP_080700948.1|2741425_2745493_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.8	2.4e-10
WP_029581516.1|2745489_2746338_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	42.5	3.9e-11
>prophage 205
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2750936	2754082	5042960		Dickeya_phage(50.0%)	2	NA	NA
WP_029581510.1|2750936_2752118_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	56.6	6.2e-15
WP_029581509.1|2752114_2754082_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	5.8e-34
>prophage 206
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2760422	2767322	5042960		Pandoravirus(50.0%)	2	NA	NA
WP_032957048.1|2760422_2761553_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	39.6	1.6e-36
WP_032957049.1|2761559_2767322_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	40.1	3.4e-199
>prophage 207
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2775338	2777741	5042960		Catovirus(50.0%)	2	NA	NA
WP_032957064.1|2775338_2776961_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	22.6	2.8e-18
WP_029581492.1|2776982_2777741_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.5	6.7e-15
>prophage 208
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2782918	2787094	5042960		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_032979104.1|2782918_2783425_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	48.4	1.2e-31
WP_029581484.1|2783559_2784636_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_032979102.1|2784724_2785618_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032979100.1|2785648_2787094_-	DUF1254 domain-containing protein	NA	M1I2Z9	Paramecium_bursaria_Chlorella_virus	22.3	2.2e-14
>prophage 209
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2799244	2800033	5042960		Staphylococcus_phage(100.0%)	1	NA	NA
WP_029581472.1|2799244_2800033_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.7	1.3e-13
>prophage 210
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2814947	2823718	5042960		Leptospira_phage(33.33%)	5	NA	NA
WP_029581463.1|2814947_2818043_+	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.2	1.0e-56
WP_029581462.1|2818055_2819459_+	TolC family protein	NA	NA	NA	NA	NA
WP_029581461.1|2819474_2820134_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_029581460.1|2820248_2821538_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.4	5.9e-19
WP_032979094.1|2821549_2823718_-	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	26.9	3.4e-51
>prophage 211
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2851106	2855217	5042960		Bacillus_virus(66.67%)	5	NA	NA
WP_032979077.1|2851106_2851865_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.9	2.0e-14
WP_032979075.1|2851854_2852583_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.5	1.2e-08
WP_029581430.1|2852778_2852994_+	transporter	NA	NA	NA	NA	NA
WP_029581429.1|2853002_2854352_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_029581428.1|2854368_2855217_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	2.9e-27
>prophage 212
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2869068	2873177	5042960		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_032962937.1|2869068_2870445_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	4.0e-34
WP_029581413.1|2870485_2871658_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_032978247.1|2871671_2873177_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.8	4.9e-33
>prophage 213
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2877200	2878663	5042960		Mycoplasma_phage(50.0%)	2	NA	NA
WP_029581407.1|2877200_2877953_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	29.1	3.7e-05
WP_032955764.1|2877949_2878663_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	9.1e-14
>prophage 214
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2924943	2925948	5042960		Bacillus_virus(100.0%)	1	NA	NA
WP_048940294.1|2924943_2925948_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.0	4.7e-16
>prophage 215
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2944865	2946479	5042960		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_080700975.1|2944865_2946479_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.2	9.0e-09
>prophage 216
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2949771	2951592	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_080700976.1|2949771_2951592_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	1.7e-27
>prophage 217
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2975268	2977569	5042960		Streptococcus_phage(50.0%)	2	NA	NA
WP_032979447.1|2975268_2976543_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	55.1	1.4e-121
WP_032955430.1|2976693_2977569_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	26.8	2.2e-09
>prophage 218
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	2995532	2996216	5042960		Synechococcus_phage(100.0%)	1	NA	NA
WP_029581305.1|2995532_2996216_+	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	26.9	2.7e-15
>prophage 219
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3051072	3051615	5042960		Clostridium_phage(100.0%)	1	NA	NA
WP_029581256.1|3051072_3051615_+	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	32.5	1.7e-12
>prophage 220
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3075711	3077454	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_029578915.1|3075711_3077454_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	22.9	6.1e-19
>prophage 221
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3081846	3091933	5042960	tRNA	Streptococcus_phage(33.33%)	8	NA	NA
WP_032979738.1|3081846_3083106_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.9	9.9e-96
WP_032979737.1|3083135_3084176_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_032955283.1|3084175_3084853_-	lipoprotein	NA	NA	NA	NA	NA
WP_029578905.1|3084864_3087522_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.1	1.9e-173
WP_029578904.1|3087594_3088755_-	MFS transporter	NA	NA	NA	NA	NA
WP_032955268.1|3088787_3089300_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029578902.1|3089416_3089863_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_029578901.1|3090163_3091933_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.8	5.1e-13
>prophage 222
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3099161	3106701	5042960		Bacillus_virus(33.33%)	7	NA	NA
WP_029578894.1|3099161_3100391_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	2.3e-28
WP_029578893.1|3100468_3100843_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_029578892.1|3100891_3102073_+	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_032955272.1|3102129_3102753_-	toxin	NA	NA	NA	NA	NA
WP_032979733.1|3102764_3103211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029578889.1|3103298_3103928_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KU27	Synechococcus_phage	36.1	2.3e-16
WP_032955274.1|3103980_3106701_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	1.6e-71
>prophage 223
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3114777	3115449	5042960		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_029578880.1|3114777_3115449_-	HAD family phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	30.5	2.9e-09
>prophage 224
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3127352	3132831	5042960		Bacillus_virus(66.67%)	4	NA	NA
WP_029578873.1|3127352_3127679_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.1	3.6e-18
WP_048940262.1|3127902_3129915_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.8	1.1e-93
WP_032964089.1|3129914_3130502_+	YcxB family protein	NA	NA	NA	NA	NA
WP_032964087.1|3130515_3132831_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	3.1e-79
>prophage 225
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3158524	3209096	5042960	tRNA,tail,protease	Klosneuvirus(10.53%)	48	NA	NA
WP_032979716.1|3158524_3161146_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	3.6e-84
WP_029578844.1|3161132_3161384_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_029578843.1|3161448_3162057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029578842.1|3162362_3162623_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_029578841.1|3162933_3163527_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_142028402.1|3163526_3164339_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_032979709.1|3164403_3167283_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.7	2.4e-137
WP_029578838.1|3167598_3168024_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	43.6	4.9e-23
WP_032979708.1|3168053_3169202_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_029578836.1|3169198_3169672_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_029578835.1|3169692_3170979_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_080700270.1|3171020_3172307_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_029578833.1|3172310_3172949_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_029578832.1|3172954_3174112_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_029578831.1|3174136_3175492_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_032955349.1|3175488_3176562_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_003810707.1|3176745_3176982_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_029578829.1|3177069_3178176_+	GTPase HflX	NA	NA	NA	NA	NA
WP_029578828.1|3178141_3179440_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_029578827.1|3179457_3180345_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_029578826.1|3180593_3181751_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_095075177.1|3181815_3183123_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	33.0	8.8e-63
WP_029578824.1|3183245_3183785_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_006218592.1|3184074_3184287_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_126623598.1|3184304_3186353_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	42.9	1.6e-66
WP_029578822.1|3186990_3189255_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.8	1.4e-36
WP_029578821.1|3189650_3190052_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_126623688.1|3190205_3192875_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_029578820.1|3192885_3193182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095075243.1|3193416_3193641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080700799.1|3193709_3194474_-	LexA family transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	39.2	1.7e-05
WP_126623597.1|3194651_3195311_+	hypothetical protein	NA	Q3HR05	Burkholderia_phage	34.7	7.1e-21
WP_080700928.1|3195314_3195896_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_032978388.1|3195959_3196424_+	hypothetical protein	NA	S4TNM8	Salmonella_phage	38.0	7.5e-17
WP_032978385.1|3196427_3196886_+|tail	tail protein	tail	Q6JIM0	Burkholderia_virus	44.4	6.2e-24
WP_032978382.1|3196885_3197173_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	42.5	8.2e-14
WP_051593925.1|3197179_3198193_+|tail	phage tail tape measure protein	tail	K7PM62	Enterobacteria_phage	35.3	1.2e-14
WP_032978379.1|3198192_3198531_+|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	53.2	5.6e-30
WP_051593924.1|3198530_3201179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051593923.1|3201178_3201751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032978376.1|3201753_3202497_+|tail	phage minor tail protein L	tail	A0A2R3UA90	Siphoviridae_environmental_samples	47.3	4.7e-61
WP_080700927.1|3202496_3203321_+	C40 family peptidase	NA	Q3HQU3	Burkholderia_phage	49.2	6.1e-62
WP_032978371.1|3203308_3203911_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	50.8	1.1e-47
WP_080700926.1|3203907_3207633_+|tail	phage tail protein	tail	Q8W6T0	Burkholderia_virus	44.3	8.2e-247
WP_032978369.1|3207629_3208007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060833232.1|3207984_3208173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080700930.1|3208229_3208688_+	hypothetical protein	NA	Q6TM82	Pseudomonas_phage	36.7	5.9e-14
WP_032978359.1|3208691_3209096_+	M15 family metallopeptidase	NA	A0A2I6PFM8	Proteus_phage	51.6	3.2e-32
>prophage 226
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3214163	3226233	5042960		Yersinia_phage(25.0%)	10	NA	NA
WP_048940256.1|3214163_3215075_-	prohibitin family protein	NA	A0A2C9CWL5	Yersinia_phage	54.7	8.9e-46
WP_032955363.1|3215455_3216082_-	LysE family translocator	NA	NA	NA	NA	NA
WP_032978351.1|3216151_3217384_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_029578808.1|3217957_3219577_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.2	2.8e-10
WP_029578807.1|3219582_3220086_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_032978348.1|3220082_3221327_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_029578805.1|3221319_3221946_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_032978345.1|3221942_3224171_+	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.0	5.4e-12
WP_032978342.1|3224167_3225199_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_029578802.1|3225210_3226233_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.1	3.0e-18
>prophage 227
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3265780	3266515	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_003813882.1|3265780_3266515_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	36.3	1.3e-34
>prophage 228
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3275017	3277882	5042960		Ralstonia_phage(50.0%)	2	NA	NA
WP_032978319.1|3275017_3277102_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	45.3	3.2e-152
WP_029578755.1|3277111_3277882_-	amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.3	9.9e-14
>prophage 229
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3283360	3284038	5042960		Bacillus_virus(100.0%)	1	NA	NA
WP_029578747.1|3283360_3284038_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	3.1e-11
>prophage 230
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3287811	3289647	5042960		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_048940247.1|3287811_3289647_+	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	2.0e-12
>prophage 231
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3297067	3298548	5042960		Tupanvirus(50.0%)	2	NA	NA
WP_029578735.1|3297067_3297778_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	26.3	2.0e-05
WP_029578734.1|3297774_3298548_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.3	4.4e-14
>prophage 232
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3302784	3303960	5042960		Agrobacterium_phage(100.0%)	1	NA	NA
WP_032957276.1|3302784_3303960_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.5	9.4e-48
>prophage 233
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3308184	3309498	5042960		Burkholderia_virus(100.0%)	1	NA	NA
WP_029578723.1|3308184_3309498_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	40.2	6.5e-82
>prophage 234
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3321653	3322433	5042960		Agrobacterium_phage(100.0%)	1	NA	NA
WP_029578712.1|3321653_3322433_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	32.0	4.2e-12
>prophage 235
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3327985	3338284	5042960	protease	Trichoplusia_ni_ascovirus(16.67%)	11	NA	NA
WP_029578704.1|3327985_3328738_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	1.6e-16
WP_003813816.1|3328954_3329194_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	46.6	5.4e-11
WP_032978299.1|3329366_3330596_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_080666534.1|3330598_3331027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012194.1|3331023_3331623_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.9	2.6e-06
WP_029578702.1|3331635_3332121_+	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_029578701.1|3332120_3333152_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_032963963.1|3333192_3334677_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.6	1.9e-21
WP_029578699.1|3334821_3336615_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	2.1e-22
WP_029578698.1|3336638_3337523_+	signal peptidase I	NA	NA	NA	NA	NA
WP_095075180.1|3337519_3338284_+	ribonuclease III	NA	M4QNJ2	Ostreococcus_lucimarinus_virus	33.5	1.2e-19
>prophage 236
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3341346	3342861	5042960		Mycoplasma_phage(100.0%)	1	NA	NA
WP_032978296.1|3341346_3342861_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.3	7.3e-53
>prophage 237
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3349659	3356305	5042960		Staphylococcus_phage(66.67%)	5	NA	NA
WP_029578684.1|3349659_3350325_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	35.3	1.8e-16
WP_080700566.1|3350532_3352458_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	30.9	2.2e-62
WP_029578682.1|3352457_3352865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032957228.1|3352948_3354175_+	MFS transporter	NA	NA	NA	NA	NA
WP_095075181.1|3354262_3356305_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.3	5.4e-83
>prophage 238
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3365370	3367257	5042960		Mycoplasma_phage(100.0%)	1	NA	NA
WP_029578670.1|3365370_3367257_+	dipeptide ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.1	4.9e-06
>prophage 239
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3372784	3383567	5042960		Acinetobacter_phage(20.0%)	10	NA	NA
WP_029578664.1|3372784_3374581_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	49.3	3.8e-165
WP_029578663.1|3374819_3376472_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	4.5e-157
WP_029578662.1|3376632_3376917_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_029578661.1|3376920_3378207_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	63.8	1.4e-150
WP_029578660.1|3378281_3378653_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_051593918.1|3378664_3379321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032957198.1|3379375_3380296_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_029578657.1|3380334_3380856_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_029578656.1|3380879_3382544_-	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	22.9	5.4e-17
WP_032957195.1|3382727_3383567_-	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	47.7	4.9e-67
>prophage 240
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3393776	3395555	5042960		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032978285.1|3393776_3395555_+	succinate dehydrogenase flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	24.3	2.3e-05
>prophage 241
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3399016	3400093	5042960		Bacillus_virus(100.0%)	1	NA	NA
WP_029578638.1|3399016_3400093_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	8.1e-30
>prophage 242
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3406954	3407638	5042960		Synechococcus_phage(100.0%)	1	NA	NA
WP_029578630.1|3406954_3407638_-	Fe2+-dependent dioxygenase	NA	A0A1D8KSK5	Synechococcus_phage	41.0	3.6e-15
>prophage 243
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3421955	3423383	5042960		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_029578623.1|3421955_3423383_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.9	4.9e-43
>prophage 244
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3430901	3432947	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_032955832.1|3430901_3432947_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	29.5	1.6e-74
>prophage 245
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3450157	3458633	5042960		Escherichia_phage(33.33%)	4	NA	NA
WP_029578595.1|3450157_3450688_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	43.3	1.8e-11
WP_032955825.1|3450834_3453408_-	cyanophycin synthetase	NA	S4VXG8	Pandoravirus	26.6	4.3e-05
WP_095075245.1|3453478_3456127_-	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_029578592.1|3456356_3458633_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.1	1.5e-57
>prophage 246
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3462865	3467330	5042960		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_029578586.1|3462865_3463705_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	43.3	3.3e-55
WP_032955821.1|3464085_3465648_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_029578584.1|3465719_3467330_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.3	1.9e-11
>prophage 247
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3479209	3485207	5042960		Bacillus_virus(33.33%)	4	NA	NA
WP_032978152.1|3479209_3481849_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	6.0e-103
WP_029577247.1|3481856_3482987_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.0	5.4e-77
WP_029577248.1|3482979_3484065_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_032978149.1|3484085_3485207_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	24.9	3.2e-13
>prophage 248
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3492127	3497625	5042960		Synechococcus_phage(50.0%)	6	NA	NA
WP_051350494.1|3492127_3493069_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	M4QF80	Synechococcus_phage	30.2	1.2e-13
WP_032955094.1|3493065_3494055_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SJ87	Synechococcus_phage	31.1	1.2e-27
WP_032978148.1|3494170_3494524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032955093.1|3494585_3495497_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.7	2.9e-49
WP_029577259.1|3495551_3496691_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032955110.1|3496710_3497625_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.7	3.5e-42
>prophage 249
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3506916	3510946	5042960		Bacillus_virus(50.0%)	4	NA	NA
WP_029577269.1|3506916_3507981_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	6.3e-27
WP_029577270.1|3507977_3508706_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_029577271.1|3508719_3509628_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_029577272.1|3509641_3510946_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	29.1	6.1e-32
>prophage 250
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3518454	3519000	5042960		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_032955086.1|3518454_3519000_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	38.4	4.2e-27
>prophage 251
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3525772	3526861	5042960		Synechococcus_phage(100.0%)	1	NA	NA
WP_029577291.1|3525772_3526861_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	44.9	9.0e-13
>prophage 252
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3531640	3534344	5042960		Staphylococcus_phage(66.67%)	3	NA	NA
WP_029577297.1|3531640_3532870_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	58.4	4.7e-135
WP_029577298.1|3532893_3533586_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.3e-17
WP_029577299.1|3533600_3534344_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	3.5e-16
>prophage 253
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3537906	3542185	5042960		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_032978128.1|3537906_3541302_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.9	1.1e-29
WP_029577304.1|3541270_3542185_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.3	4.0e-14
>prophage 254
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3553675	3554803	5042960		Mycoplasma_phage(100.0%)	1	NA	NA
WP_032978123.1|3553675_3554803_+	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.7	3.1e-24
>prophage 255
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3564966	3573418	5042960		Catovirus(33.33%)	3	NA	NA
WP_032955077.1|3564966_3568857_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.9	9.6e-49
WP_029577329.1|3568887_3569787_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	36.3	1.0e-33
WP_029577330.1|3569926_3573418_+	DNA polymerase III subunit alpha	NA	A0A1C9LWS4	Streptomyces_phage	37.3	2.9e-185
>prophage 256
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3581240	3586121	5042960		Bacillus_phage(50.0%)	2	NA	NA
WP_029577340.1|3581240_3583016_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	29.1	4.4e-49
WP_048940218.1|3583367_3586121_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	31.3	8.6e-52
>prophage 257
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3595412	3596432	5042960		Tupanvirus(100.0%)	1	NA	NA
WP_029579745.1|3595412_3596432_-	histone deacetylase family protein	NA	A0A2K9L473	Tupanvirus	35.9	8.4e-29
>prophage 258
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3599667	3600318	5042960		Pandoravirus(100.0%)	1	NA	NA
WP_029579742.1|3599667_3600318_+	HD domain-containing protein	NA	S4W232	Pandoravirus	32.1	9.5e-10
>prophage 259
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3614169	3615684	5042960		Klebsiella_phage(100.0%)	1	NA	NA
WP_032957442.1|3614169_3615684_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.6	2.0e-79
>prophage 260
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3622087	3626424	5042960		Tupanvirus(33.33%)	4	NA	NA
WP_029579720.1|3622087_3623152_-	histone deacetylase family protein	NA	A0A2K9L4C2	Tupanvirus	36.8	2.5e-44
WP_029579719.1|3623172_3623463_-	cupin	NA	NA	NA	NA	NA
WP_032977606.1|3623481_3624774_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.0	9.1e-28
WP_029579717.1|3624783_3626424_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	2.0e-16
>prophage 261
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3630346	3631891	5042960		Streptococcus_phage(100.0%)	1	NA	NA
WP_029579713.1|3630346_3631891_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.7	1.1e-14
>prophage 262
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3643838	3646851	5042960		Tupanvirus(50.0%)	3	NA	NA
WP_029579701.1|3643838_3644405_-	HD domain-containing protein	NA	A0A2K9L141	Tupanvirus	32.1	4.5e-16
WP_029579700.1|3644555_3645707_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_032977619.1|3645846_3646851_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.9	5.2e-15
>prophage 263
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3655846	3661086	5042960		Burkholderia_phage(50.0%)	4	NA	NA
WP_029579687.1|3655846_3657220_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_029579686.1|3657280_3658240_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_029579685.1|3658327_3659305_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_029579684.1|3659433_3661086_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.9	1.1e-70
>prophage 264
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3666651	3670388	5042960		Klosneuvirus(50.0%)	2	NA	NA
WP_029579677.1|3666651_3667671_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.1	2.5e-49
WP_029579676.1|3667679_3670388_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.1	4.7e-18
>prophage 265
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3673877	3674951	5042960		Edwardsiella_phage(100.0%)	1	NA	NA
WP_029579672.1|3673877_3674951_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.3	5.1e-77
>prophage 266
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3685587	3690733	5042960	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_029579662.1|3685587_3686508_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	31.2	1.4e-27
WP_029579661.1|3686516_3687629_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_029579660.1|3687716_3688538_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_029579659.1|3688602_3689211_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_029579658.1|3689356_3690733_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.6	9.4e-108
>prophage 267
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3697971	3699129	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_126623591.1|3697971_3699129_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.3	3.9e-14
>prophage 268
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3707548	3712070	5042960	integrase	Cellulophaga_phage(50.0%)	6	3700943:3700962	3712153:3712172
3700943:3700962	attL	CTTGGTGGCGCATCCCTGAT	NA	NA	NA	NA
WP_142028413.1|3707548_3708856_-	relaxase/mobilization nuclease domain-containing protein	NA	M1Q738	Cellulophaga_phage	29.5	4.6e-19
WP_142028414.1|3708830_3709154_-	MobC family plasmid mobilization relaxosome protein	NA	NA	NA	NA	NA
WP_142028415.1|3709150_3709360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142028416.1|3709601_3710096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142028417.1|3710143_3710443_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_142028418.1|3710498_3712070_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059XK29	uncultured_phage	33.0	3.7e-07
3712153:3712172	attR	CTTGGTGGCGCATCCCTGAT	NA	NA	NA	NA
>prophage 269
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3720007	3721291	5042960		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_029579639.1|3720007_3721291_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.8	8.7e-156
>prophage 270
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3724374	3729592	5042960		Lactococcus_phage(33.33%)	4	NA	NA
WP_126623590.1|3724374_3726849_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.4	6.1e-65
WP_029579634.1|3726958_3727699_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_029579633.1|3727750_3728995_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	28.0	2.2e-10
WP_005012769.1|3729319_3729592_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
>prophage 271
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3733055	3742602	5042960		Bacillus_phage(16.67%)	8	NA	NA
WP_029579628.1|3733055_3734177_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	7.6e-15
WP_032959497.1|3734196_3736041_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	31.4	2.6e-68
WP_029579626.1|3736275_3737463_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_029579625.1|3737530_3738868_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	5.6e-57
WP_032956815.1|3738965_3739907_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	25.2	9.9e-16
WP_029579623.1|3739962_3741144_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	1.4e-22
WP_029579622.1|3741302_3741593_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_029579621.1|3741648_3742602_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.6	5.9e-16
>prophage 272
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3762059	3763418	5042960		Indivirus(100.0%)	1	NA	NA
WP_029579600.1|3762059_3763418_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	34.3	1.9e-31
>prophage 273
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3767016	3768382	5042960	protease	Synechococcus_phage(33.33%)	3	NA	NA
WP_029579596.1|3767016_3767466_-	DUF192 domain-containing protein	NA	A0A222YVT9	Synechococcus_phage	45.6	8.9e-15
WP_012249572.1|3767599_3767845_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	2.9e-20
WP_029579595.1|3768067_3768382_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.1	6.4e-12
>prophage 274
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3775877	3778187	5042960	protease	Agrobacterium_phage(100.0%)	1	NA	NA
WP_029579592.1|3775877_3778187_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.7	7.0e-164
>prophage 275
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3789287	3794123	5042960		Staphylococcus_phage(50.0%)	5	NA	NA
WP_029579584.1|3789287_3790094_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	1.8e-13
WP_029579583.1|3790090_3790816_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_029579582.1|3790812_3792108_-	MFS transporter	NA	NA	NA	NA	NA
WP_029579581.1|3792191_3792797_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029579580.1|3792884_3794123_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	30.2	3.4e-32
>prophage 276
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3797977	3809245	5042960	tRNA	Bodo_saltans_virus(20.0%)	12	NA	NA
WP_029579576.1|3797977_3799000_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.6	1.0e-26
WP_032979591.1|3799012_3801430_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_029579574.1|3801432_3801783_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	43.3	1.3e-13
WP_029579573.1|3801840_3802239_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080700993.1|3802418_3803582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095075187.1|3804143_3804299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029579571.1|3804634_3805381_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.7	2.5e-22
WP_032979592.1|3805449_3807411_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	29.7	8.1e-28
WP_029579569.1|3807531_3808038_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_029579568.1|3808050_3808293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029579567.1|3808421_3808700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029579566.1|3808792_3809245_+	low affinity iron permease family protein	NA	A0A1C9EHA1	Mycobacterium_phage	39.5	2.2e-05
>prophage 277
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3814697	3820660	5042960		Bacillus_phage(33.33%)	6	NA	NA
WP_032979595.1|3814697_3816497_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	27.6	7.4e-44
WP_080700994.1|3816645_3817449_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.4	4.4e-65
WP_029579553.1|3817452_3818439_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_032961629.1|3818460_3818655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029579551.1|3818651_3819827_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_095075188.1|3819931_3820660_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	50.0	1.9e-59
>prophage 278
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3827526	3827988	5042960		Xanthomonas_phage(100.0%)	1	NA	NA
WP_029579544.1|3827526_3827988_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.1	1.1e-17
>prophage 279
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3849843	3855839	5042960	protease	Bacillus_virus(50.0%)	5	NA	NA
WP_029579522.1|3849843_3850593_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	7.3e-30
WP_032979600.1|3850607_3851480_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_032955635.1|3851496_3852381_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080700158.1|3852581_3853355_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_032979601.1|3853511_3855839_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	43.4	4.9e-125
>prophage 280
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3860090	3861725	5042960		Agrobacterium_phage(100.0%)	1	NA	NA
WP_048940188.1|3860090_3861725_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.6	8.3e-87
>prophage 281
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3871692	3873555	5042960		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_032979605.1|3871692_3873555_+	dipeptide ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.1	5.7e-07
>prophage 282
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3888989	3889844	5042960		Enterococcus_phage(100.0%)	1	NA	NA
WP_032979606.1|3888989_3889844_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.2	4.4e-31
>prophage 283
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3897131	3903317	5042960		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_060833324.1|3897131_3898898_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	3.5e-38
WP_126623588.1|3899039_3903317_-	FkbM family methyltransferase	NA	A0A2N9QVW1	Dishui_lake_phycodnavirus	34.7	1.4e-11
>prophage 284
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3908916	3918411	5042960		Bacillus_thuringiensis_phage(50.0%)	9	NA	NA
WP_029579476.1|3908916_3909297_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.0e-08
WP_060833323.1|3909350_3911438_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_029579474.1|3911451_3911955_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_126623587.1|3912009_3913686_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.2	1.2e-11
WP_095075189.1|3913705_3914539_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_029577896.1|3914538_3915588_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_029577897.1|3915630_3916020_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.7	7.0e-08
WP_029577898.1|3916028_3916658_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_048940178.1|3916848_3918411_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.6	1.8e-09
>prophage 285
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3932365	3933340	5042960		Sulfitobacter_phage(100.0%)	1	NA	NA
WP_032956135.1|3932365_3933340_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	30.6	1.2e-11
>prophage 286
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3936404	3944281	5042960		uncultured_Caudovirales_phage(75.0%)	5	NA	NA
WP_048940176.1|3936404_3938234_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.5	4.1e-10
WP_048940175.1|3938343_3940140_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.2	4.8e-11
WP_032955314.1|3940211_3940646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048940174.1|3940763_3942497_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.2e-13
WP_048940173.1|3942646_3944281_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	43.9	6.1e-37
>prophage 287
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3968198	3969719	5042960		Mollivirus(100.0%)	1	NA	NA
WP_029581212.1|3968198_3969719_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.9	7.0e-96
>prophage 288
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3978463	3979222	5042960		Flavobacterium_phage(100.0%)	1	NA	NA
WP_029581203.1|3978463_3979222_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	33.1	2.1e-16
>prophage 289
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	3989482	3997914	5042960		Emiliania_huxleyi_virus(25.0%)	9	NA	NA
WP_029581193.1|3989482_3990091_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	41.5	3.0e-26
WP_032956766.1|3990087_3990867_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_029581191.1|3990938_3991334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029581190.1|3991344_3992172_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_029581189.1|3992331_3994698_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.1	4.5e-166
WP_029581188.1|3994864_3995296_+	NfeD-like family protein 1	NA	NA	NA	NA	NA
WP_029581187.1|3995329_3996256_+	paraslipin	NA	NA	NA	NA	NA
WP_032956776.1|3996312_3997443_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.8	2.0e-15
WP_029581185.1|3997452_3997914_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.9	1.4e-28
>prophage 290
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4005133	4005757	5042960		Bacteriophage(100.0%)	1	NA	NA
WP_029581176.1|4005133_4005757_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	39.2	3.8e-24
>prophage 291
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4010796	4011561	5042960		Planktothrix_phage(100.0%)	1	NA	NA
WP_029581169.1|4010796_4011561_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	4.2e-33
>prophage 292
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4019013	4019610	5042960	protease	Agrobacterium_phage(100.0%)	1	NA	NA
WP_032955126.1|4019013_4019610_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.0	2.0e-54
>prophage 293
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4023596	4024103	5042960		Canarypox_virus(100.0%)	1	NA	NA
WP_032955130.1|4023596_4024103_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	39.0	4.0e-24
>prophage 294
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4027414	4030915	5042960		Hokovirus(50.0%)	3	NA	NA
WP_029581148.1|4027414_4028827_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	27.5	3.0e-40
WP_029581147.1|4029050_4030505_+	carnitine dehydratase	NA	NA	NA	NA	NA
WP_029581146.1|4030555_4030915_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.0	3.0e-29
>prophage 295
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4037740	4038433	5042960		Streptococcus_phage(100.0%)	1	NA	NA
WP_032955136.1|4037740_4038433_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.9	3.7e-12
>prophage 296
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4041860	4044590	5042960		Staphylococcus_phage(100.0%)	1	NA	NA
WP_029581130.1|4041860_4044590_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.6	6.0e-21
>prophage 297
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4049727	4054313	5042960		uncultured_virus(50.0%)	2	NA	NA
WP_029581125.1|4049727_4051914_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.6	1.9e-78
WP_029581124.1|4051940_4054313_-	DNA ligase D	NA	A0A068CDF3	Rhizobium_phage	39.9	7.9e-54
>prophage 298
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4057677	4059921	5042960		Acidianus_spindle-shaped_virus(100.0%)	1	NA	NA
WP_032979257.1|4057677_4059921_+	ATP-dependent DNA helicase	NA	D1GF97	Acidianus_spindle-shaped_virus	25.6	1.3e-05
>prophage 299
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4065271	4066255	5042960		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_029581113.1|4065271_4066255_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	1.1e-12
>prophage 300
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4078801	4080756	5042960		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_029581101.1|4078801_4079785_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	21.5	1.3e-05
WP_029581100.1|4079781_4080756_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	27.3	3.1e-12
>prophage 301
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4116998	4117739	5042960		Tupanvirus(100.0%)	1	NA	NA
WP_029581066.1|4116998_4117739_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	24.5	3.9e-07
>prophage 302
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4128861	4129773	5042960		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_029581051.1|4128861_4129773_+	3-phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	1.7e-20
>prophage 303
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4149066	4150137	5042960		Bacillus_virus(100.0%)	1	NA	NA
WP_032979268.1|4149066_4150137_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.7	7.8e-25
>prophage 304
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4158196	4158997	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_032956507.1|4158196_4158997_+	amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.1	8.7e-05
>prophage 305
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4172620	4173997	5042960		Ochrobactrum_phage(100.0%)	1	NA	NA
WP_032962087.1|4172620_4173997_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	67.4	2.3e-29
>prophage 306
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4208148	4209192	5042960		Niemeyer_virus(100.0%)	1	NA	NA
WP_048940125.1|4208148_4209192_+	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	32.1	2.9e-32
>prophage 307
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4214379	4224659	5042960		Bacillus_phage(25.0%)	11	NA	NA
WP_032955922.1|4214379_4215225_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	49.6	1.0e-64
WP_032955923.1|4215375_4216359_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	40.6	2.7e-48
WP_051593974.1|4216302_4216926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080700966.1|4216897_4217812_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_048940123.1|4217804_4218509_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_032955924.1|4218632_4218899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080700273.1|4218904_4219984_-	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	43.4	2.1e-70
WP_032979353.1|4219944_4220898_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_048940121.1|4220887_4221943_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_032962598.1|4221939_4222923_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032955929.1|4222919_4224659_-	carbamoyltransferase	NA	A0A1B1IVF2	uncultured_Mediterranean_phage	34.1	6.4e-53
>prophage 308
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4229779	4232482	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_060833254.1|4229779_4232482_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.6	9.0e-46
>prophage 309
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4246269	4251540	5042960		Brazilian_cedratvirus(33.33%)	6	NA	NA
WP_029580979.1|4246269_4247136_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	6.7e-11
WP_032979349.1|4247119_4247857_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_048940114.1|4247872_4249591_+	FAD-binding protein	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	27.9	3.1e-23
WP_032955949.1|4249587_4249944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048940112.1|4249969_4250512_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_051593838.1|4250703_4251540_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.2	5.5e-34
>prophage 310
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4255913	4256837	5042960		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_032972829.1|4255913_4256837_-	hypothetical protein	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	28.4	1.1e-19
>prophage 311
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4261245	4262757	5042960		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032979565.1|4261245_4262757_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.2	2.1e-15
>prophage 312
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4274842	4276501	5042960		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_095075197.1|4274842_4276501_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	24.4	7.3e-06
>prophage 313
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4287908	4288952	5042960		Enterobacteria_phage(100.0%)	1	NA	NA
WP_029580940.1|4287908_4288952_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	26.9	1.7e-21
>prophage 314
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4297709	4301131	5042960		Bacillus_virus(33.33%)	4	NA	NA
WP_032956010.1|4297709_4298438_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.3	1.7e-07
WP_029580930.1|4298430_4299951_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.7	4.2e-32
WP_029580929.1|4299947_4300331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032962664.1|4300333_4301131_+	alpha/beta hydrolase	NA	Q857G1	Mycobacterium_phage	39.3	5.6e-12
>prophage 315
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4309269	4310731	5042960		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_029580920.1|4309269_4310043_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.2	9.3e-12
WP_029580919.1|4310032_4310731_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.8	2.5e-08
>prophage 316
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4315305	4315521	5042960		Pseudomonas_phage(100.0%)	1	NA	NA
WP_029580914.1|4315305_4315521_-	DUF3596 domain-containing protein	NA	A0A1W6JTA0	Pseudomonas_phage	54.7	7.2e-07
>prophage 317
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4323399	4324152	5042960		Cedratvirus(100.0%)	1	NA	NA
WP_029580907.1|4323399_4324152_-	amino acid ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.1	5.1e-15
>prophage 318
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4329672	4330437	5042960		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_032956101.1|4329672_4330437_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	2.2e-13
>prophage 319
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4340389	4341937	5042960		Moraxella_phage(100.0%)	1	NA	NA
WP_029580891.1|4340389_4341937_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.5	2.0e-37
>prophage 320
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4346364	4350030	5042960		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_032978473.1|4346364_4350030_+	transporter substrate-binding domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	31.1	6.7e-36
>prophage 321
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4360552	4362250	5042960		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_032956041.1|4360552_4362250_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.7	4.7e-32
>prophage 322
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4375930	4377400	5042960		Bacillus_virus(50.0%)	2	NA	NA
WP_029580860.1|4375930_4376632_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	23.2	3.3e-08
WP_029580859.1|4376632_4377400_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	2.2e-13
>prophage 323
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4381125	4381656	5042960		Vibrio_phage(100.0%)	1	NA	NA
WP_095075250.1|4381125_4381656_-	queuosine precursor transporter	NA	A0A2I7SAW6	Vibrio_phage	35.8	1.9e-16
>prophage 324
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4386097	4387186	5042960		Bacillus_virus(100.0%)	1	NA	NA
WP_029580849.1|4386097_4387186_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	31.7	3.0e-24
>prophage 325
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4397600	4398938	5042960		Catovirus(100.0%)	1	NA	NA
WP_080700989.1|4397600_4398938_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.1	4.5e-14
>prophage 326
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4403776	4406366	5042960		Pithovirus(50.0%)	3	NA	NA
WP_029580835.1|4403776_4404277_-	DNA starvation/stationary phase protection protein	NA	W5S6G8	Pithovirus	35.5	2.4e-13
WP_032960163.1|4404339_4404756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032979549.1|4404752_4406366_-	dehydrogenase	NA	A0A1V0SI18	Klosneuvirus	28.9	2.0e-48
>prophage 327
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4409715	4411552	5042960		Bacillus_virus(50.0%)	3	NA	NA
WP_029580829.1|4409715_4410534_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	4.0e-29
WP_029580828.1|4410538_4411141_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_029580827.1|4411174_4411552_-	RidA family protein	NA	S4W0G3	Pandoravirus	35.8	1.1e-05
>prophage 328
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4417296	4418256	5042960		Lactobacillus_phage(100.0%)	1	NA	NA
WP_029580821.1|4417296_4418256_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.1	4.7e-13
>prophage 329
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4426147	4426924	5042960		Pithovirus(100.0%)	1	NA	NA
WP_032979546.1|4426147_4426924_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.4	6.0e-19
>prophage 330
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4431907	4440253	5042960		Hokovirus(33.33%)	4	NA	NA
WP_126623576.1|4431907_4436335_+	response regulator	NA	A0A1V0SGX0	Hokovirus	27.0	1.8e-75
WP_029580807.1|4436389_4437541_+	two-component system response regulator	NA	W8CYM9	Bacillus_phage	41.9	5.1e-14
WP_029580806.1|4437677_4439189_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_029580805.1|4439188_4440253_-	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.4	1.1e-07
>prophage 331
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4445655	4447317	5042960		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_080700987.1|4445655_4447317_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.5	1.6e-08
>prophage 332
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4457776	4463237	5042960		Clostridium_phage(25.0%)	6	NA	NA
WP_080666610.1|4457776_4458319_+	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	39.8	1.5e-21
WP_029580789.1|4458337_4459108_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_029580788.1|4459281_4459914_+	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	33.3	3.3e-15
WP_003811126.1|4459953_4460157_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_029580787.1|4460180_4462478_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9LAT2	Tupanvirus	36.2	8.9e-10
WP_029580786.1|4462508_4463237_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.3	9.6e-35
>prophage 333
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4481034	4506843	5042960		uncultured_Mediterranean_phage(22.22%)	19	NA	NA
WP_126623574.1|4481034_4488540_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.2	3.9e-22
WP_032955215.1|4488891_4489836_+	DMT family transporter	NA	NA	NA	NA	NA
WP_029580770.1|4489847_4490528_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.2	3.8e-09
WP_032955214.1|4490565_4491189_+	arylesterase	NA	NA	NA	NA	NA
WP_029580768.1|4491170_4493126_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_032962805.1|4493389_4494139_+	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	29.5	1.2e-16
WP_029580766.1|4494149_4495022_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_032962804.1|4495032_4496445_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_029580764.1|4496554_4497283_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	56.6	1.9e-43
WP_029580763.1|4497414_4497615_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_029580762.1|4497766_4500040_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.0	4.0e-87
WP_029580761.1|4500036_4500432_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_032979541.1|4500428_4501823_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	25.6	5.7e-28
WP_032955234.1|4501924_4502677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580758.1|4502964_4503540_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_032979540.1|4503657_4504437_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_029580756.1|4504433_4505285_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	45.0	2.4e-13
WP_095075253.1|4505302_4505941_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.4	4.3e-31
WP_029580754.1|4506084_4506843_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.5	3.6e-69
>prophage 334
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4511655	4524783	5042960	tRNA	Moraxella_phage(28.57%)	14	NA	NA
WP_029580747.1|4511655_4512693_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.3	6.2e-96
WP_029580746.1|4512778_4514071_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.5	4.4e-67
WP_029580745.1|4514253_4515270_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_029580744.1|4515378_4515762_+	thiol reductase thioredoxin	NA	V9SJ74	Achromobacter_phage	26.8	1.6e-09
WP_032955207.1|4515765_4516371_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.9	4.0e-18
WP_032955206.1|4516394_4517192_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_095075204.1|4517196_4517985_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032955204.1|4517960_4518959_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_029580738.1|4519008_4519773_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.0	1.0e-31
WP_032955203.1|4519897_4520767_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032979539.1|4520883_4521540_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_095075254.1|4521509_4523171_-	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.5	8.9e-52
WP_029580734.1|4523338_4524310_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_032959135.1|4524306_4524783_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	5.0e-08
>prophage 335
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4543388	4544183	5042960		Escherichia_phage(100.0%)	1	NA	NA
WP_029580716.1|4543388_4544183_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	9.8e-25
>prophage 336
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4549280	4550219	5042960		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032979644.1|4549280_4550219_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.9	1.9e-19
>prophage 337
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4553347	4554115	5042960		Turkeypox_virus(100.0%)	1	NA	NA
WP_032955690.1|4553347_4554115_+	NRDE family protein	NA	A0A0M3ZEJ9	Turkeypox_virus	31.2	1.4e-23
>prophage 338
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4558442	4559450	5042960		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_032955693.1|4558442_4559450_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.2	1.3e-10
>prophage 339
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4573188	4578350	5042960		Rhodococcus_phage(50.0%)	4	NA	NA
WP_032979645.1|4573188_4576350_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	28.5	6.8e-53
WP_032979646.1|4576379_4576901_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_048940066.1|4576890_4577715_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_029580682.1|4577711_4578350_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.0	3.7e-06
>prophage 340
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4583923	4594992	5042960		Streptococcus_phage(16.67%)	13	NA	NA
WP_029580676.1|4583923_4585387_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.7e-14
WP_029580675.1|4585383_4585680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580674.1|4585808_4587167_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	1.3e-45
WP_080666605.1|4587174_4587834_-	O-acetyl-ADP-ribose deacetylase	NA	F1SVT2	Red_sea_bream_iridovirus	52.0	2.4e-37
WP_029580672.1|4587677_4588481_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_126623573.1|4588553_4589198_+	LysE family translocator	NA	NA	NA	NA	NA
WP_029580670.1|4589216_4589840_+	LysE family translocator	NA	NA	NA	NA	NA
WP_029580669.1|4589903_4591025_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	47.6	7.2e-82
WP_029580668.1|4591095_4591440_+	lipoprotein	NA	NA	NA	NA	NA
WP_029580667.1|4591444_4592287_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	29.9	2.3e-16
WP_029580666.1|4592306_4592918_-	peptidase S16	NA	NA	NA	NA	NA
WP_029580665.1|4593100_4593517_+	VOC family protein	NA	NA	NA	NA	NA
WP_048940064.1|4593555_4594992_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	38.0	3.7e-54
>prophage 341
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4614202	4615009	5042960		Indivirus(100.0%)	1	NA	NA
WP_029580639.1|4614202_4615009_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	34.0	1.4e-31
>prophage 342
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4620700	4623685	5042960		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032979655.1|4620700_4623685_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	41.8	7.0e-07
>prophage 343
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4681374	4681986	5042960		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_029580616.1|4681374_4681986_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	72.3	5.7e-81
>prophage 344
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4695309	4697786	5042960		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_029580605.1|4695309_4696026_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.1	6.8e-09
WP_032979431.1|4696025_4697786_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FG22	Brazilian_cedratvirus	29.0	2.3e-10
>prophage 345
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4702693	4704704	5042960		Bordetella_phage(50.0%)	2	NA	NA
WP_060833148.1|4702693_4704154_+	DNA-3-methyladenine glycosylase 2 family protein	NA	A0A291LAM3	Bordetella_phage	33.3	5.5e-05
WP_032978891.1|4704164_4704704_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	48.5	4.8e-31
>prophage 346
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4708915	4723375	5042960	integrase	Burkholderia_phage(16.67%)	13	4705497:4705514	4722526:4722543
4705497:4705514	attL	CCGCGGCCGCCGCCCTGG	NA	NA	NA	NA
WP_032978881.1|4708915_4710664_-	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	23.6	2.0e-17
WP_032978878.1|4710820_4714324_-	DEAD/DEAH box helicase	NA	M1H1D9	Paramecium_bursaria_Chlorella_virus	24.6	4.5e-13
WP_032978897.1|4714310_4715093_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_080700866.1|4715318_4715777_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	45.8	4.2e-12
WP_032978875.1|4715788_4716049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032978872.1|4716049_4716340_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032957511.1|4716327_4716606_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_032978869.1|4716810_4717062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032978894.1|4717184_4717916_+	recombinase family protein	NA	NA	NA	NA	NA
WP_080700867.1|4718090_4718450_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_032957508.1|4718710_4719919_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	53.7	2.5e-120
WP_029580584.1|4720227_4721820_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.0	1.3e-15
WP_029580583.1|4721914_4723375_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.8	2.6e-95
4722526:4722543	attR	CCAGGGCGGCGGCCGCGG	NA	NA	NA	NA
>prophage 347
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4730213	4731212	5042960		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_032957507.1|4730213_4731212_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	3.2e-12
>prophage 348
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4739852	4743902	5042960		Burkholderia_phage(100.0%)	1	NA	NA
WP_032964469.1|4739852_4743902_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	68.9	8.8e-162
>prophage 349
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4754884	4765824	5042960	tRNA	Catovirus(40.0%)	10	NA	NA
WP_029580552.1|4754884_4755574_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	3.1e-35
WP_142028427.1|4755566_4756847_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_029580550.1|4756944_4757883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029580549.1|4757864_4759571_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	5.0e-50
WP_126623568.1|4759648_4760752_+	peptide chain release factor 2	NA	W8EDB3	Pseudomonas_phage	38.0	7.5e-07
WP_032978849.1|4760802_4761552_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_029580547.1|4761558_4763073_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.8	5.2e-83
WP_029580546.1|4763085_4763373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029580545.1|4763377_4763995_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032978846.1|4763991_4765824_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.2	1.2e-54
>prophage 350
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4769775	4770588	5042960		Bacillus_phage(100.0%)	1	NA	NA
WP_032957478.1|4769775_4770588_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	8.2e-11
>prophage 351
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4773680	4776822	5042960		Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_029580534.1|4773680_4775543_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.2	2.6e-100
WP_032978840.1|4775582_4776089_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_029580532.1|4776092_4776416_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	2.3e-25
WP_029580531.1|4776417_4776822_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	4.8e-52
>prophage 352
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4783046	4791931	5042960	protease	Lake_Baikal_phage(28.57%)	9	NA	NA
WP_029580525.1|4783046_4783700_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
WP_029580524.1|4783826_4786256_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	2.0e-222
WP_032955669.1|4786421_4787720_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	1.4e-129
WP_029580522.1|4787824_4788478_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.4	1.5e-55
WP_029580521.1|4788480_4789791_-	trigger factor	NA	NA	NA	NA	NA
WP_029580520.1|4789996_4790536_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.7	1.1e-22
WP_029580519.1|4790589_4790796_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	7.4e-17
WP_032955668.1|4791053_4791605_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|4791727_4791931_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
>prophage 353
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4801891	4806280	5042960		Tupanvirus(50.0%)	2	NA	NA
WP_126623566.1|4801891_4803817_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	32.3	5.6e-66
WP_032978667.1|4804006_4806280_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	3.1e-108
>prophage 354
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4809679	4815996	5042960	tRNA	Synechococcus_phage(33.33%)	5	NA	NA
WP_032955663.1|4809679_4810348_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.7	2.2e-25
WP_029580500.1|4810396_4811362_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_032978664.1|4811351_4814213_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.3	9.5e-70
WP_029580498.1|4814215_4814731_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_029580497.1|4814793_4815996_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.6	6.9e-38
>prophage 355
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4820659	4823058	5042960		Xanthomonas_phage(50.0%)	3	NA	NA
WP_029580490.1|4820659_4821109_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.5	2.2e-45
WP_142028428.1|4821124_4822234_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_029580488.1|4822287_4823058_-	amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.4	3.7e-13
>prophage 356
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4829618	4835812	5042960	tRNA	Hokovirus(33.33%)	6	NA	NA
WP_029580480.1|4829618_4831313_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.6	6.3e-05
WP_029580479.1|4831422_4831692_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_029580478.1|4831753_4832152_-	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
WP_029580477.1|4832165_4833122_-	glutathione synthase	NA	NA	NA	NA	NA
WP_080666590.1|4833290_4833839_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.9	3.5e-13
WP_029580475.1|4833859_4835812_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.2	3.7e-126
>prophage 357
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4841984	4845539	5042960	terminase	Salmonella_phage(50.0%)	4	NA	NA
WP_029580468.1|4841984_4843640_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	48.9	5.7e-35
WP_032978656.1|4843778_4844279_+	membrane protein	NA	NA	NA	NA	NA
WP_126623564.1|4844603_4844930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032978653.1|4845053_4845539_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	62.3	9.5e-39
>prophage 358
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4848699	4852118	5042960	integrase	Vibrio_phage(33.33%)	7	4842639:4842654	4859324:4859339
4842639:4842654	attL	TGGCGGGCCAGGCGCT	NA	NA	NA	NA
WP_032978647.1|4848699_4849323_+	3'-5' exonuclease	NA	I3PUZ1	Vibrio_phage	49.2	3.5e-46
WP_032978644.1|4849674_4850025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060833146.1|4850053_4850317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032978637.1|4850371_4850569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051593933.1|4850565_4850835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142028430.1|4850849_4851617_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PH06	Moraxella_phage	42.2	4.7e-08
WP_051593977.1|4851665_4852118_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	46.7	1.7e-26
4859324:4859339	attR	TGGCGGGCCAGGCGCT	NA	NA	NA	NA
>prophage 359
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4865051	4866110	5042960		Pandoravirus(100.0%)	1	NA	NA
WP_029580392.1|4865051_4866110_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.4	8.3e-80
>prophage 360
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4871370	4872843	5042960		Microcystis_phage(100.0%)	1	NA	NA
WP_029580388.1|4871370_4872843_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	30.5	6.4e-46
>prophage 361
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4887540	4889880	5042960		Moraxella_phage(100.0%)	1	NA	NA
WP_029580371.1|4887540_4889880_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	41.0	2.4e-151
>prophage 362
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4894203	4894896	5042960		Staphylococcus_phage(100.0%)	1	NA	NA
WP_029580365.1|4894203_4894896_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.4	4.9e-12
>prophage 363
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4898239	4900374	5042960		Trichoplusia_ni_ascovirus(50.0%)	3	NA	NA
WP_032979370.1|4898239_4898995_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	1.7e-18
WP_029580359.1|4899008_4899836_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029580358.1|4899840_4900374_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
>prophage 364
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4905037	4907779	5042960		Pseudomonas_phage(66.67%)	3	NA	NA
WP_029580352.1|4905037_4905760_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	48.2	1.7e-44
WP_029580351.1|4905903_4906602_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	29.6	1.3e-17
WP_029580350.1|4906897_4907779_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.6	2.3e-19
>prophage 365
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4913685	4922113	5042960		Bacillus_phage(50.0%)	7	NA	NA
WP_032956477.1|4913685_4914747_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.3	2.6e-113
WP_029580343.1|4915075_4915771_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_029580342.1|4915886_4917266_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.8	2.0e-20
WP_029580341.1|4917449_4919126_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_029580340.1|4919483_4919702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580339.1|4919853_4920753_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.6	1.4e-43
WP_029580338.1|4920820_4922113_-	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	36.6	1.1e-41
>prophage 366
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4926687	4927602	5042960		Salmonella_phage(100.0%)	1	NA	NA
WP_080700357.1|4926687_4927602_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.7	1.2e-63
>prophage 367
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4977251	4978910	5042960		Cedratvirus(100.0%)	1	NA	NA
WP_032979387.1|4977251_4978910_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	23.3	3.9e-07
>prophage 368
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4984320	4985364	5042960		Tupanvirus(100.0%)	1	NA	NA
WP_032979388.1|4984320_4985364_-	histone deacetylase family protein	NA	A0A2K9L4C2	Tupanvirus	38.5	5.4e-31
>prophage 369
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	4997163	4998495	5042960		Klosneuvirus(100.0%)	1	NA	NA
WP_029577378.1|4997163_4998495_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.9	1.1e-20
>prophage 370
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	5002697	5007649	5042960		Acanthamoeba_polyphaga_mimivirus(50.0%)	5	NA	NA
WP_032979393.1|5002697_5003492_-	SDR family oxidoreductase	NA	A0A0G2Y601	Acanthamoeba_polyphaga_mimivirus	33.1	2.6e-09
WP_029577383.1|5003584_5004505_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032979394.1|5004560_5005010_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032979395.1|5005092_5006235_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_029577386.1|5006239_5007649_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	36.7	2.9e-64
>prophage 371
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	5021160	5025159	5042960		Mycobacterium_phage(50.0%)	4	NA	NA
WP_029577394.1|5021160_5021940_-	cellulose synthase operon protein YhjQ	NA	A0A142F1W4	Mycobacterium_phage	31.6	2.2e-08
WP_029577395.1|5021936_5022605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048940486.1|5022655_5023051_-	cellulose synthase	NA	NA	NA	NA	NA
WP_032979762.1|5023740_5025159_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	27.9	1.1e-45
>prophage 372
NZ_CP021396	Bordetella hinzii strain 4134 chromosome, complete genome	5042960	5034482	5035547	5042960		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_029577406.1|5034482_5035547_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	26.7	2.4e-18
