The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041132	Serratia marcescens strain WVU-009 chromosome, complete genome	5309876	516016	523518	5309876		Enterobacteria_phage(33.33%)	10	NA	NA
WP_047569171.1|516016_516271_-	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	51.7	5.2e-12
WP_142074953.1|516267_516993_-	NAD-dependent aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_142074955.1|517535_517793_+	AlpA family phage regulatory protein	NA	Q7M299	Enterobacteria_phage	55.8	1.1e-17
WP_142074957.1|517789_518035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142074960.1|518040_518586_+	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	39.0	6.1e-10
WP_046688297.1|518582_518846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142074962.1|518842_519178_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_142074964.1|519188_521537_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	59.9	2.1e-261
WP_127146762.1|522018_522927_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.0	8.5e-73
WP_016929262.1|523284_523518_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	55.8	4.9e-17
>prophage 2
NZ_CP041132	Serratia marcescens strain WVU-009 chromosome, complete genome	5309876	828545	886444	5309876	tail,tRNA,plate	Salmonella_phage(25.0%)	58	NA	NA
WP_033641888.1|828545_829592_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_089191195.1|829569_830334_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.3	5.7e-54
WP_004932585.1|830327_830954_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	5.3e-34
WP_071845092.1|831261_832278_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	37.5	3.1e-07
WP_019455119.1|832332_833331_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.2e-32
WP_033651712.1|833410_835966_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.0	1.8e-27
WP_089191196.1|836524_837142_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_033644195.1|837336_838221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142075053.1|838358_839330_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_042785642.1|839342_840101_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	5.5e-17
WP_123061396.1|840249_841143_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004932561.1|841560_841878_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_033641899.1|841890_843252_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_142075055.1|843295_844681_+	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_004932550.1|844696_845545_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_142075057.1|845693_846455_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_033641904.1|846464_847844_-	MFS transporter	NA	NA	NA	NA	NA
WP_033641905.1|848087_848576_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	46.1	1.0e-24
WP_004932541.1|848687_849752_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	1.7e-112
WP_033641906.1|849812_850328_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_142075060.1|850461_853089_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.7	1.1e-80
WP_004091602.1|853341_853527_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_033641908.1|854882_855449_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_004932520.1|855445_855874_+	DedA family protein	NA	NA	NA	NA	NA
WP_046688257.1|855956_857519_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_033641910.1|857685_858201_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_016929024.1|858266_859556_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004932506.1|859598_860390_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004932504.1|860559_861921_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004932501.1|862135_862384_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_019455135.1|862402_862951_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_046688258.1|863003_863771_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015376707.1|863819_864176_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_033641912.1|864319_864547_-	transcriptional regulator	NA	Q37973	Salmonella_virus	65.7	4.6e-20
WP_069101122.1|864636_865731_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	49.7	2.5e-103
WP_033641914.1|865727_866201_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	57.2	8.1e-43
WP_142075062.1|866223_868317_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	45.5	2.4e-14
WP_033641916.1|868309_868432_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	74.3	2.8e-08
WP_033641917.1|868464_868752_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	58.9	3.0e-24
WP_033641919.1|868816_869326_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	69.0	1.6e-65
WP_033641920.1|869338_870508_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	79.9	5.8e-183
WP_050594401.1|870648_871206_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	39.6	1.7e-28
WP_033641921.1|871205_873083_-|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	53.2	1.0e-59
WP_069101124.1|873079_876373_-|tail	phage tail protein I	tail	G5DEL7	Salmonella_phage	48.8	1.5e-273
WP_033641923.1|876365_877274_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	76.5	1.5e-122
WP_033641924.1|877278_877629_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	4.4e-38
WP_033641925.1|877625_878261_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	55.0	3.2e-58
WP_033641926.1|878346_878811_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	52.6	1.7e-37
WP_142075064.1|878864_879377_-	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	64.7	8.7e-59
WP_033641928.1|879360_879579_-	hypothetical protein	NA	B6SD15	Bacteriophage	50.9	8.1e-06
WP_033641929.1|879582_879786_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	68.7	1.8e-20
WP_033641930.1|879977_880172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142075067.1|880235_882332_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	48.4	1.7e-193
WP_142075069.1|882315_882537_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	55.1	1.2e-12
WP_033641932.1|882615_882921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071845089.1|883163_884060_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	53.1	9.9e-82
WP_142075070.1|884107_884872_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_033641934.1|885367_886444_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	6.9e-90
>prophage 3
NZ_CP041132	Serratia marcescens strain WVU-009 chromosome, complete genome	5309876	1706557	1784235	5309876	head,protease,plate,capsid,terminase,portal,lysis,integrase,tail	Erwinia_phage(32.61%)	87	1696210:1696229	1757699:1757718
1696210:1696229	attL	CAGGCGTTCGACAGCCTGAT	NA	NA	NA	NA
WP_033642514.1|1706557_1707070_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_142075271.1|1707485_1708967_+	phospholipase	NA	NA	NA	NA	NA
WP_046686750.1|1708963_1709737_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_142075273.1|1709825_1710599_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_060453234.1|1710912_1711998_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	59.7	2.4e-114
WP_072270167.1|1712115_1712685_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	33.7	6.4e-26
WP_072270972.1|1712825_1713056_+	regulator	NA	NA	NA	NA	NA
WP_060438900.1|1713085_1713595_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.0	7.9e-44
WP_072010285.1|1713605_1713785_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
WP_060453213.1|1713796_1714099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060453214.1|1714163_1714457_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_060453215.1|1714456_1714780_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_142002183.1|1714767_1714992_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	56.9	3.7e-14
WP_048321968.1|1715114_1715396_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
WP_142075275.1|1715392_1717609_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	57.7	3.7e-239
WP_033644912.1|1717647_1717872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142002187.1|1717919_1718117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142003263.1|1718250_1719135_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142002189.1|1719308_1720445_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_142002191.1|1720622_1721816_+	MFS transporter	NA	NA	NA	NA	NA
WP_071605322.1|1722317_1722572_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	5.9e-16
WP_033633573.1|1722571_1722913_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_142002193.1|1723082_1723625_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_142002195.1|1723651_1724686_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	81.0	2.0e-163
WP_142002197.1|1724685_1726458_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	82.2	3.3e-291
WP_142002198.1|1726600_1727416_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	53.1	4.6e-70
WP_128868863.1|1727458_1728643_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.6	3.5e-159
WP_060436856.1|1728645_1729305_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	68.9	1.7e-78
WP_128868864.1|1729398_1729887_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	52.5	1.6e-38
WP_015379118.1|1729886_1730090_+	phage Tail protein X	NA	A0A0F7LCN2	Escherichia_phage	68.7	2.4e-20
WP_015379117.1|1730092_1730302_+	hypothetical protein	NA	B6SD15	Bacteriophage	48.2	9.2e-07
WP_142002200.1|1730285_1730798_+	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	67.1	4.3e-58
WP_142002202.1|1730794_1731223_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.6	2.1e-13
WP_142002204.1|1731318_1731795_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	65.4	6.9e-50
WP_043148046.1|1731781_1732228_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	59.1	2.1e-40
WP_142002206.1|1732300_1732930_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	74.1	1.3e-75
WP_142002208.1|1732926_1733277_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	66.4	3.8e-37
WP_142002210.1|1733281_1734190_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	67.9	5.3e-107
WP_142002212.1|1734182_1734716_+|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	77.1	5.7e-77
WP_142002214.1|1734722_1737260_+	hypothetical protein	NA	Q858V4	Yersinia_virus	54.6	9.3e-61
WP_060453274.1|1737261_1737783_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	45.9	1.1e-35
WP_142002216.1|1738059_1739229_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	82.0	2.8e-185
WP_060453186.1|1739244_1739754_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	75.6	1.1e-69
WP_060418393.1|1739807_1740089_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.1	1.4e-26
WP_023456045.1|1740121_1740244_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
WP_142075277.1|1740236_1743083_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	41.6	1.5e-112
WP_015379102.1|1743087_1743573_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
WP_142002220.1|1743569_1744718_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	63.4	3.2e-125
WP_072265518.1|1744817_1745036_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.2	3.2e-26
WP_004938680.1|1745329_1747018_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_033642521.1|1747312_1747702_+	membrane protein	NA	NA	NA	NA	NA
WP_004938676.1|1747741_1748005_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	1.7e-26
WP_033642522.1|1748235_1748550_+	YbjC family protein	NA	NA	NA	NA	NA
WP_033642523.1|1748606_1749509_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	37.0	9.4e-40
WP_004938666.1|1749645_1750125_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_033642524.1|1750531_1751641_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_069100891.1|1751761_1752895_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	7.2e-29
WP_042784087.1|1752919_1753882_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_042784088.1|1753878_1754724_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_047024958.1|1754885_1755365_+	YbjO family protein	NA	NA	NA	NA	NA
WP_122004040.1|1755433_1756561_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.8	2.1e-28
WP_033633469.1|1756557_1756842_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	1.0e-24
WP_004928423.1|1756831_1757083_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_015377297.1|1757184_1757919_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1757699:1757718	attR	ATCAGGCTGTCGAACGCCTG	NA	NA	NA	NA
WP_025302241.1|1758119_1758788_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_025159684.1|1758787_1759504_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004928409.1|1759513_1760245_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_089192582.1|1760277_1761006_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	1.8e-28
WP_033642535.1|1761270_1761813_-	lipoprotein	NA	NA	NA	NA	NA
WP_004928400.1|1761972_1762296_+	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	43.3	2.9e-15
WP_033642536.1|1762349_1763915_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_123061544.1|1764102_1764939_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	29.7	1.1e-10
WP_069100885.1|1764939_1765950_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_047572070.1|1766108_1767548_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_099783632.1|1767698_1768046_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_101453223.1|1768075_1769092_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_103101140.1|1769167_1770889_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_142075279.1|1771088_1772090_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_033650659.1|1772146_1773796_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_033642544.1|1773976_1774873_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_033642546.1|1775060_1776719_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_033642547.1|1776733_1777687_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_033642548.1|1777881_1778997_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_033642549.1|1778996_1780943_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.3	4.7e-36
WP_004928349.1|1781030_1781252_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	1.1e-15
WP_004928347.1|1781607_1781928_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_025302261.1|1781955_1784235_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	8.7e-167
>prophage 4
NZ_CP041132	Serratia marcescens strain WVU-009 chromosome, complete genome	5309876	2025917	2035260	5309876	integrase	Pectobacterium_phage(45.45%)	13	2017967:2017981	2031317:2031331
2017967:2017981	attL	TCGCCCCGCGCGCCG	NA	NA	NA	NA
WP_142075340.1|2025917_2027000_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	49.6	2.0e-97
WP_142075342.1|2026974_2027316_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.5	2.2e-10
WP_142075343.1|2027281_2027488_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	52.4	1.6e-08
WP_142075345.1|2027756_2028257_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	70.5	2.3e-56
WP_142075347.1|2028253_2030431_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.7	3.2e-126
WP_089194571.1|2030482_2030761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142075349.1|2030771_2031089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142075352.1|2031615_2032071_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	49.7	3.3e-33
2031317:2031331	attR	CGGCGCGCGGGGCGA	NA	NA	NA	NA
WP_142075354.1|2032178_2032412_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	47.2	5.2e-11
WP_142075356.1|2032473_2032926_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	3.7e-29
WP_047568246.1|2032949_2033168_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	59.4	9.2e-18
WP_142075359.1|2033170_2033890_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	74.2	1.3e-28
WP_142075360.1|2033886_2035260_+	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	49.7	2.1e-115
>prophage 5
NZ_CP041132	Serratia marcescens strain WVU-009 chromosome, complete genome	5309876	2038420	2070554	5309876	head,terminase,lysis	Edwardsiella_phage(24.24%)	40	NA	NA
WP_142075371.1|2038420_2039014_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	67.0	2.0e-75
WP_142075373.1|2039010_2039295_+	DUF1364 family protein	NA	A0A088CE53	Shigella_phage	75.5	4.4e-36
WP_142075375.1|2039294_2039693_+	antitermination protein Q	NA	B6SCY2	Bacteriophage	57.5	2.9e-33
WP_142076247.1|2041005_2041449_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_142075377.1|2041563_2041827_+|lysis	lysis protein	lysis	Q7Y3V4	Yersinia_phage	51.7	1.2e-19
WP_142075379.1|2041826_2042357_+	glycoside hydrolase family protein	NA	H9C184	Pectobacterium_phage	83.4	2.4e-83
WP_142075380.1|2042353_2042734_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_142076249.1|2042714_2042894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142075382.1|2043641_2044664_+|terminase	terminase small subunit	terminase	A0A1Y0SUQ3	Pseudomonas_phage	41.8	1.3e-40
WP_142076251.1|2044884_2045352_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_142075384.1|2045441_2047061_+	TerL protein	NA	A9YWZ6	Burkholderia_phage	74.0	1.5e-234
WP_142075386.1|2047060_2048611_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.4	3.4e-98
WP_142076253.1|2048651_2049335_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	3.2e-56
WP_060419454.1|2049338_2050664_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	41.2	4.7e-72
WP_038875760.1|2050665_2051148_+	hypothetical protein	NA	E2GLV4	Acinetobacter_phage	51.5	3.0e-29
WP_142075388.1|2051147_2052176_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.4	1.0e-82
WP_142075390.1|2052179_2052524_+	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	39.6	2.8e-13
WP_038875751.1|2052527_2052998_+	DUF4054 domain-containing protein	NA	K4HYQ8	Acinetobacter_phage	37.0	4.8e-11
WP_142075392.1|2052998_2053478_+	hypothetical protein	NA	I6ZXX4	Escherichia_phage	30.5	2.9e-08
WP_142075393.1|2053474_2053840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060419446.1|2053824_2054376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142075395.1|2054356_2055841_+	DUF3383 family protein	NA	A0A077KGV4	Edwardsiella_phage	38.2	3.0e-91
WP_038875737.1|2055840_2056278_+	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	38.1	2.3e-20
WP_110157888.1|2056277_2056682_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.5	4.1e-19
WP_047730619.1|2056684_2056891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142076255.1|2056896_2058783_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	40.4	1.2e-49
WP_142075397.1|2058779_2059586_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	37.4	1.3e-27
WP_047730622.1|2059585_2059888_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	52.5	1.3e-25
WP_142075398.1|2059884_2060730_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.2	5.5e-34
WP_142075400.1|2060731_2061418_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.3	5.5e-32
WP_038875867.1|2061417_2061774_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	50.0	9.1e-23
WP_060424826.1|2061770_2063018_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.2	7.7e-101
WP_089191830.1|2063019_2063607_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.7	2.7e-35
WP_142075402.1|2063608_2065120_+	hypothetical protein	NA	H9C0Y2	Aeromonas_phage	52.4	5.8e-26
WP_122004116.1|2065122_2065680_+	hypothetical protein	NA	A0A0C4UQZ5	Shigella_phage	39.3	8.7e-28
WP_142076257.1|2065693_2067136_-	hypothetical protein	NA	A8CG94	Salmonella_phage	22.9	3.4e-15
WP_060447306.1|2067149_2068061_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	76.9	4.6e-135
WP_072271515.1|2068057_2068414_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	57.1	3.1e-31
WP_033637997.1|2068863_2069286_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	55.0	3.0e-33
WP_060447304.1|2069285_2070554_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	71.5	6.7e-177
>prophage 6
NZ_CP041132	Serratia marcescens strain WVU-009 chromosome, complete genome	5309876	2206083	2248145	5309876	protease,coat	Moraxella_phage(25.0%)	39	NA	NA
WP_142075435.1|2206083_2207502_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_033642834.1|2207648_2207858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033638276.1|2208637_2209030_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_046686935.1|2209034_2209634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033642836.1|2209689_2209929_-	YebV family protein	NA	NA	NA	NA	NA
WP_142076261.1|2210064_2210997_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_142076263.1|2211016_2213359_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_046686936.1|2213510_2214278_-	molecular chaperone	NA	NA	NA	NA	NA
WP_033642838.1|2214298_2214841_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033642839.1|2214834_2215338_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033642840.1|2215340_2215877_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_033652487.1|2216150_2216687_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_142075437.1|2216952_2218389_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_142075439.1|2218491_2221122_-	MCE family protein	NA	NA	NA	NA	NA
WP_142075441.1|2221090_2222338_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_033642843.1|2222593_2223091_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004931497.1|2223187_2223898_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033642845.1|2223917_2225966_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	1.5e-85
WP_033642846.1|2226033_2226879_-	DMT family transporter	NA	NA	NA	NA	NA
WP_142075443.1|2226875_2228183_-	opine metallophore biosynthesis dehydrogenase	NA	NA	NA	NA	NA
WP_033642848.1|2228175_2228973_-	nicotianamine synthase	NA	NA	NA	NA	NA
WP_004931489.1|2228960_2229746_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	5.2e-10
WP_052133798.1|2229742_2230783_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_046686943.1|2230785_2231877_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033652481.1|2232245_2233124_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_142075445.1|2233462_2234170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033642854.1|2234274_2235669_-	MFS transporter	NA	NA	NA	NA	NA
WP_033642855.1|2235899_2236691_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_142075447.1|2236736_2237540_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_142075449.1|2237542_2238406_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_139120318.1|2238407_2239544_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	9.7e-26
WP_089196976.1|2239540_2240551_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069100110.1|2240728_2241448_-	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_033652472.1|2241600_2242704_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_047576043.1|2242713_2243523_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_089194670.1|2243586_2244984_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_033642861.1|2245164_2245713_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.8	8.3e-07
WP_033652469.1|2246134_2246800_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_046686946.1|2246864_2248145_-|protease	protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP041132	Serratia marcescens strain WVU-009 chromosome, complete genome	5309876	3819689	3826783	5309876		Salmonella_phage(33.33%)	10	NA	NA
WP_033644018.1|3819689_3820043_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	47.0	1.6e-19
WP_033644019.1|3820243_3820474_+	hypothetical protein	NA	J9Q735	Salmonella_phage	50.7	4.2e-13
WP_142075867.1|3820487_3821027_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	56.0	3.4e-45
WP_025159568.1|3821040_3821742_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_142075869.1|3822014_3822530_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_016926728.1|3822563_3822812_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_033651534.1|3822859_3824149_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.2	6.0e-64
WP_004941642.1|3824225_3824852_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025303843.1|3825107_3826145_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.9	3.8e-69
WP_033644022.1|3826144_3826783_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.2	3.2e-26
>prophage 8
NZ_CP041132	Serratia marcescens strain WVU-009 chromosome, complete genome	5309876	4601580	4642201	5309876	head,plate,capsid,terminase,portal,tRNA,lysis,integrase,tail	Erwinia_phage(41.46%)	51	4595452:4595472	4648578:4648598
4595452:4595472	attL	CGCCAGCCCGCTCAGCTGCAG	NA	NA	NA	NA
WP_004937199.1|4601580_4602594_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	5.7e-110
WP_001144069.1|4602919_4603135_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_019453084.1|4603271_4605020_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.7e-74
WP_025304326.1|4605177_4607019_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_060660225.1|4607074_4607527_-	polyketide cyclase	NA	NA	NA	NA	NA
WP_033644588.1|4607543_4608032_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_033644586.1|4608454_4608685_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	9.4e-21
WP_141972498.1|4608768_4609929_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	63.6	8.4e-126
WP_015379102.1|4609925_4610411_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
WP_141972496.1|4610415_4613262_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	37.5	2.8e-106
WP_023456045.1|4613254_4613377_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
WP_060418393.1|4613409_4613691_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.1	1.4e-26
WP_023447563.1|4613745_4614255_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
WP_141972494.1|4614270_4615440_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	82.0	1.8e-184
WP_141972492.1|4615713_4616235_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	46.2	2.1e-36
WP_142076083.1|4616236_4618774_-	hypothetical protein	NA	Q858V4	Yersinia_virus	53.7	6.1e-60
WP_015379109.1|4618780_4619314_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.6	4.3e-77
WP_142076085.1|4619306_4620215_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	69.2	7.3e-109
WP_033639346.1|4620219_4620570_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	66.4	6.4e-37
WP_141972486.1|4620566_4621196_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	73.1	4.1e-74
WP_141972484.1|4621270_4622020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141972482.1|4622103_4622550_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	59.1	2.1e-40
WP_142076087.1|4622536_4623013_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	64.7	3.1e-50
WP_015379115.1|4623108_4623537_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.6	5.5e-14
WP_141972478.1|4623533_4624046_-	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	66.5	3.3e-58
WP_015379117.1|4624029_4624239_-	hypothetical protein	NA	B6SD15	Bacteriophage	48.2	9.2e-07
WP_141972476.1|4624241_4624445_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	67.2	9.2e-20
WP_102984937.1|4624444_4624933_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	53.7	3.3e-39
WP_060436856.1|4625026_4625686_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	68.9	1.7e-78
WP_060453263.1|4625688_4626873_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.9	1.6e-159
WP_122078038.1|4626915_4627731_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	53.5	6.4e-72
WP_142076090.1|4627873_4629646_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.9	9.7e-291
WP_142076092.1|4629645_4630680_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	81.0	9.1e-164
WP_033633573.1|4630724_4631066_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_071605322.1|4631065_4631320_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	5.9e-16
WP_142076094.1|4631780_4632044_-	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	71.2	1.5e-25
WP_142076096.1|4632190_4632517_+	killer suppression protein HigA	NA	NA	NA	NA	NA
WP_142076098.1|4632513_4633596_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	34.2	9.6e-07
WP_142076100.1|4633599_4634544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142076102.1|4634540_4635521_-	thymidylate synthase	NA	A0A218MKK4	uncultured_virus	30.0	2.4e-20
WP_142076104.1|4635793_4636018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142076106.1|4636056_4638273_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	57.7	3.7e-239
WP_141972461.1|4638269_4638551_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	50.0	5.9e-17
WP_060426813.1|4638673_4638898_-	hypothetical protein	NA	Q6K1F5	Salmonella_virus	56.9	3.7e-14
WP_141972459.1|4638897_4639140_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	48.5	2.8e-07
WP_031221632.1|4639203_4639506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322123.1|4639517_4639697_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
WP_128868617.1|4639707_4640217_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.6	7.1e-45
WP_033644552.1|4640247_4640469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128868618.1|4640578_4641163_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	40.8	1.7e-29
WP_141972457.1|4641166_4642201_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	62.3	8.6e-122
4648578:4648598	attR	CGCCAGCCCGCTCAGCTGCAG	NA	NA	NA	NA
