The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041247	Raoultella electrica strain DSM 102253 chromosome, complete genome	5266426	1131897	1150282	5266426	integrase,plate,capsid	Enterobacteria_phage(71.43%)	19	1137915:1137928	1151626:1151639
WP_141963816.1|1131897_1133682_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_141963817.1|1133678_1134713_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_141963819.1|1135231_1137565_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.2	0.0e+00
WP_001472077.1|1137579_1137900_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_141963821.1|1137896_1138124_-	hypothetical protein	NA	NA	NA	NA	NA
1137915:1137928	attL	GGTCAGCCACTGCT	NA	NA	NA	NA
WP_141963823.1|1138120_1138672_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	59.3	1.6e-29
WP_000556587.1|1138668_1138935_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_167686263.1|1139039_1139168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167686221.1|1139475_1140219_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_000468231.1|1140222_1140462_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_141963829.1|1140477_1141044_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_162623967.1|1141328_1142885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141963833.1|1143014_1144001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000124713.1|1144160_1145348_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.6	4.8e-108
WP_141963835.1|1145828_1146674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137474826.1|1146954_1147161_+	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	8.5e-05
WP_141963837.1|1147180_1147495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141963839.1|1147776_1148979_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_141963841.1|1148971_1150282_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1151626:1151639	attR	GGTCAGCCACTGCT	NA	NA	NA	NA
>prophage 2
NZ_CP041247	Raoultella electrica strain DSM 102253 chromosome, complete genome	5266426	1298156	1319949	5266426	holin,tail,integrase	Morganella_phage(38.46%)	24	1297909:1297935	1318097:1318123
1297909:1297935	attL	CACATCAAGAAAAGCAAATAAGCTATC	NA	NA	NA	NA
WP_141963941.1|1298156_1299419_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JPG6	Morganella_phage	60.0	2.9e-148
WP_032421644.1|1299415_1300066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087808184.1|1300621_1300837_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_141963943.1|1300836_1301268_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	47.5	9.1e-25
WP_141963945.1|1301281_1301872_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.3e-58
WP_087825907.1|1301871_1302051_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_141963947.1|1302047_1303010_+	HAD family hydrolase	NA	A0A1C9IHV9	Salmonella_phage	53.4	7.0e-17
WP_141963949.1|1303006_1303324_+	ubiquinol-cytochrome C reductase	NA	NA	NA	NA	NA
WP_141963951.1|1303320_1303584_+|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
WP_029602623.1|1303580_1303802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141963953.1|1303798_1304428_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.1	5.7e-28
WP_064371072.1|1304437_1304788_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.9	2.4e-39
WP_141963955.1|1304780_1307543_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.7	3.4e-290
WP_142255852.1|1307882_1308329_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_167686264.1|1308309_1308693_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213172.1|1308697_1309171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213173.1|1309354_1309525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213174.1|1309524_1309851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141963957.1|1309858_1312924_+|tail	tail protein (tape measure)	tail	B1GS57	Salmonella_phage	40.4	3.5e-94
WP_029602632.1|1313466_1313838_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	52.1	5.2e-29
WP_032752615.1|1314768_1315197_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	65.7	4.6e-45
WP_141963961.1|1315608_1316640_+	Abi family protein	NA	A0A059NT88	Lactococcus_phage	25.1	1.5e-17
WP_141963963.1|1316881_1317997_+|integrase	tyrosine-type recombinase/integrase	integrase	U5P434	Shigella_phage	58.7	8.7e-128
WP_141963965.1|1318167_1319949_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	5.8e-17
1318097:1318123	attR	CACATCAAGAAAAGCAAATAAGCTATC	NA	NA	NA	NA
>prophage 3
NZ_CP041247	Raoultella electrica strain DSM 102253 chromosome, complete genome	5266426	2324320	2333925	5266426	integrase	Enterobacteria_phage(50.0%)	14	2319478:2319490	2330296:2330308
2319478:2319490	attL	GTCGCGGCGACCG	NA	NA	NA	NA
WP_100683653.1|2324320_2325346_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	6.9e-31
WP_004862736.1|2325641_2325731_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_141964477.1|2325894_2327058_+	MFS transporter	NA	NA	NA	NA	NA
WP_141964478.1|2327100_2327682_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_141964479.1|2328099_2328978_-	NlpC/P60 family protein	NA	A0A217EQL1	Bacillus_phage	38.7	1.4e-16
WP_131047991.1|2329165_2329582_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	59.1	8.7e-41
WP_160704758.1|2329578_2329710_-	hypothetical protein	NA	K7PHK0	Enterobacteria_phage	79.4	1.6e-09
WP_141964480.1|2329687_2329906_-	excisionase	NA	Q77WA4	Escherichia_phage	68.6	4.9e-19
WP_131048035.1|2329968_2330094_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	74.4	1.2e-06
WP_131048036.1|2330312_2330651_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	78.5	1.8e-44
2330296:2330308	attR	GTCGCGGCGACCG	NA	NA	NA	NA
WP_100683657.1|2331273_2332530_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_141964481.1|2332693_2332966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100683659.1|2333027_2333291_+	immunity protein	NA	NA	NA	NA	NA
WP_141964482.1|2333505_2333925_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	43.4	5.5e-27
>prophage 4
NZ_CP041247	Raoultella electrica strain DSM 102253 chromosome, complete genome	5266426	3177588	3215635	5266426	portal,transposase,protease,coat,tail,tRNA	Salmonella_phage(36.36%)	35	NA	NA
WP_141964153.1|3177588_3178263_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	31.6	8.9e-11
WP_141964154.1|3178259_3178607_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	9.2e-44
WP_141964155.1|3178626_3180183_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	55.5	9.8e-162
WP_100684903.1|3181067_3182318_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
WP_131050549.1|3182551_3183202_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_100684901.1|3183222_3183681_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_141964882.1|3183737_3184844_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_100684899.1|3184904_3185546_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_131050550.1|3185549_3186920_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	3.6e-107
WP_032688316.1|3187343_3188018_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_100684897.1|3188014_3189481_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_141964883.1|3189605_3190727_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_131050553.1|3190790_3192020_-	peptidase T	NA	NA	NA	NA	NA
WP_131050554.1|3192294_3193413_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	35.1	4.4e-31
WP_141964884.1|3193396_3194260_+	spermidine/putrescine ABC transporter permease PotB	NA	NA	NA	NA	NA
WP_141964885.1|3194493_3194733_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	60.8	3.7e-20
WP_141964886.1|3195147_3197388_-	hypothetical protein	NA	Q9AYY6	Salmonella_phage	55.8	2.8e-32
WP_141964887.1|3197525_3197780_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	66.3	1.2e-21
WP_141964888.1|3197852_3198383_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	86.3	4.5e-82
WP_141964889.1|3198598_3199045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141964890.1|3199062_3201777_-	transglycosylase SLT domain-containing protein	NA	A0A088CQ71	Enterobacteria_phage	51.6	4.7e-212
WP_141964891.1|3201776_3203111_-	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	47.4	3.9e-66
WP_141964892.1|3203120_3203816_-	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	63.2	9.1e-67
WP_141964893.1|3203818_3204277_-	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	84.1	4.6e-75
WP_141964894.1|3204273_3205107_-|tail	phage tail protein	tail	A0A192Y6T9	Salmonella_phage	62.9	2.7e-41
WP_141964895.1|3205103_3206531_-	hypothetical protein	NA	A0A075B8I2	Enterobacteria_phage	69.5	2.1e-203
WP_141964896.1|3206490_3206994_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	83.8	2.5e-74
WP_141964897.1|3207400_3208690_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	76.0	2.7e-189
WP_141964898.1|3208689_3209589_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	73.3	1.4e-112
WP_141964899.1|3209603_3211775_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	82.3	0.0e+00
WP_141964900.1|3211774_3213223_-	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	69.1	6.9e-202
WP_142255914.1|3213191_3213638_-	DNA packaging protein	NA	A0A2K8HN72	Pseudomonas_phage	48.3	2.6e-27
WP_141964901.1|3213985_3214573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167686240.1|3214757_3214928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141964902.1|3215074_3215635_+|protease	Clp protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP041247	Raoultella electrica strain DSM 102253 chromosome, complete genome	5266426	4205506	4215175	5266426	integrase	Enterobacteria_phage(100.0%)	11	4204640:4204656	4237122:4237138
4204640:4204656	attL	AGGAAATATCAATAAAA	NA	NA	NA	NA
WP_095094204.1|4205506_4206682_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.7	4.1e-144
WP_141965255.1|4206733_4208719_-	DNA mismatch repair protein	NA	NA	NA	NA	NA
WP_167686284.1|4209116_4209266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141965256.1|4209337_4209904_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	5.1e-60
WP_002889919.1|4209922_4210168_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_141965257.1|4210164_4210902_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	58.6	1.2e-69
WP_004132554.1|4211472_4211739_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_141965258.1|4211735_4212287_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	64.8	1.2e-26
WP_064152985.1|4212283_4212511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141965259.1|4212507_4212828_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_141965260.1|4212841_4215175_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.5	0.0e+00
4237122:4237138	attR	AGGAAATATCAATAAAA	NA	NA	NA	NA
>prophage 1
NZ_CP041248	Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence	303830	6141	42163	303830	integrase,transposase	Escherichia_phage(33.33%)	34	2805:2818	30816:30829
2805:2818	attL	TTTTGCTCTCATAT	NA	NA	NA	NA
WP_001067855.1|6141_6846_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_009310076.1|8050_9031_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_016807539.1|9559_9997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807538.1|9996_10674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001000409.1|11359_12895_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_000609174.1|12944_13292_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|13288_13672_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_016807536.1|15778_17236_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007372207.1|17387_17576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009652915.1|17611_18802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099531002.1|18914_19316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372203.1|19473_19980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|20761_21913_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_016241518.1|22971_23397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099531012.1|23410_23686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009652923.1|23972_24287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|24501_25905_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|25933_26566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|26784_28188_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|28216_28849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611902.1|29076_30423_+|transposase	ISNCY-like element ISLad2 family transposase	transposase	NA	NA	NA	NA
WP_000589340.1|30481_31285_+	hypothetical protein	NA	NA	NA	NA	NA
30816:30829	attR	ATATGAGAGCAAAA	NA	NA	NA	NA
WP_000482601.1|31298_32660_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_016239970.1|32812_33253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239971.1|33270_34077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045269655.1|34442_34847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045269657.1|34843_35179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045269654.1|35195_35555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045269653.1|36337_37270_+	hypothetical protein	NA	A0A223LHZ3	Pseudoalteromonas_phage	30.8	1.1e-11
WP_007372199.1|38205_39168_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	41.1	9.6e-59
WP_009652914.1|39181_39568_+	plasmid stability protein	NA	NA	NA	NA	NA
WP_080940394.1|39594_40311_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043016718.1|40635_41241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141963343.1|41318_42163_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.8	8.3e-22
>prophage 2
NZ_CP041248	Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence	303830	74138	119164	303830	transposase	Salmonella_phage(62.5%)	49	NA	NA
WP_001572362.1|74138_75161_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_045269834.1|75184_78223_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	5.0e-295
WP_045269835.1|78390_79032_+	recombinase family protein	NA	NA	NA	NA	NA
WP_025760366.1|79295_80954_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000928911.1|81114_81465_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000043177.1|81769_82246_-	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
WP_016241611.1|82360_82798_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000626969.1|82958_83420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137910.1|83394_83715_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|84174_85179_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_045269836.1|85257_86655_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	32.1	1.3e-117
WP_001162010.1|86657_87215_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
WP_032492248.1|87344_87557_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|87519_87639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|87622_87859_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|87855_88221_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|88238_89924_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|89962_90388_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|90415_90691_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294653.1|90706_91102_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|91173_91629_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012561145.1|92086_93247_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_012561144.1|93288_94284_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_000792636.1|94283_94817_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_000091613.1|94989_95304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|95558_95915_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|95904_96306_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|96302_96593_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_032640605.1|96751_99718_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_022542389.1|99796_100801_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_011191356.1|101395_102445_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_011191355.1|102441_103662_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_018429611.1|103661_103901_+	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_011191354.1|103897_104794_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004357616.1|105050_105584_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004099025.1|105610_106570_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_004099026.1|106608_106995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004099027.1|107265_107754_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_004357657.1|107812_107995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026227539.1|108230_108806_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004357654.1|109202_110228_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_025760400.1|110227_110821_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_045269764.1|110823_112056_-	OsmC family protein	NA	NA	NA	NA	NA
WP_004099034.1|112200_113160_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004099035.1|113305_113749_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_004099036.1|113750_114290_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_004099038.1|114422_115127_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_045269763.1|115123_116092_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_012817690.1|116155_119164_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
>prophage 3
NZ_CP041248	Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence	303830	133738	174584	303830	transposase	Escherichia_phage(33.33%)	35	NA	NA
WP_004099053.1|133738_134707_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_022631502.1|135007_135208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023307208.1|135737_138635_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_000509966.1|138729_139335_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_016241527.1|139724_142412_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.5	1.2e-71
WP_016241528.1|142462_142894_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	44.1	2.0e-24
WP_016241530.1|143418_144504_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_045270087.1|144503_147560_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	2.5e-52
WP_024196075.1|147752_148676_+	acyltransferase	NA	NA	NA	NA	NA
WP_045270086.1|148683_149259_-	lipid IV(A) palmitoyltransferase PagP	NA	NA	NA	NA	NA
WP_001166628.1|149307_149763_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294653.1|149834_150230_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|150245_150521_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|150548_150974_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|151012_152698_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|152715_153081_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|153077_153314_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|153297_153417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|153379_153592_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001162010.1|153721_154279_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
WP_001067855.1|154363_155068_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001752509.1|155388_155889_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_004118358.1|156215_156920_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.6e-138
WP_016947617.1|157039_158020_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_000780222.1|158297_158579_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|158559_158889_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_001572362.1|159935_160958_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_167686288.1|161142_164169_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.1	0.0e+00
WP_001067855.1|164145_164850_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000948259.1|168563_169205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449980.1|169204_170143_-	MCE family protein	NA	NA	NA	NA	NA
WP_000254595.1|170144_170948_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
WP_001325018.1|170941_172087_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001067855.1|172510_173215_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_085954994.1|173457_174584_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	1.4e-48
>prophage 1
NZ_CP041249	Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence	92370	7544	15477	92370	transposase	Stx2-converting_phage(42.86%)	10	NA	NA
WP_048757065.1|7544_8051_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	32.4	1.5e-07
WP_000761848.1|8093_8285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048757064.1|8485_8749_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	53.8	2.0e-14
WP_064343513.1|8777_9098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141964155.1|9273_10830_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	55.5	9.8e-162
WP_141964154.1|10849_11197_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	9.2e-44
WP_141964153.1|11193_11868_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	31.6	8.9e-11
WP_064343514.1|12573_13110_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	73.2	5.9e-50
WP_076752086.1|13159_13408_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_048757533.1|13476_15477_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	3.0e-22
>prophage 1
NZ_CP041250	Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence	83988	2881	58441	83988	integrase,transposase	Stx2-converting_phage(23.08%)	55	1754:1766	63255:63267
1754:1766	attL	ATGACTTTGTCAT	NA	NA	NA	NA
WP_004197635.1|2881_3676_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_019706038.1|3829_5857_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_032436768.1|5853_7128_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_019705992.1|7128_10386_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_142255980.1|10390_11659_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	33.1	1.5e-59
WP_020315256.1|11993_13010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644730.1|13006_13330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072158608.1|13356_13752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568026.1|13920_14226_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001568025.1|14227_14446_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_023340900.1|15023_16106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032415726.1|20341_20590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040214107.1|20586_21159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065242274.1|21189_21684_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001568014.1|21916_22225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074405024.1|22718_23267_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_023316587.1|23462_25001_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	6.1e-281
WP_000612626.1|25049_25397_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839182.1|25393_25798_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_167686290.1|25796_26210_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001567368.1|26480_27884_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|27912_28545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086074166.1|28721_29045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117254344.1|29218_30250_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_167686291.1|30620_30797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310076.1|30897_31878_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_000509966.1|32214_32820_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_023307208.1|32914_35812_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_023280901.1|36187_36457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023280902.1|36471_36810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074186234.1|37000_37444_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_142255981.1|37668_38352_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	4.1e-128
WP_142255982.1|38388_38802_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_142255983.1|38801_41441_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_014343490.1|41512_41911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197817.1|42286_42691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142255984.1|42757_43069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386199.1|43069_43288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020805158.1|43630_43810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020277945.1|44183_44768_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_142255985.1|44841_46266_-	F-type conjugal transfer pilus assembly protein TraB	NA	NA	NA	NA	NA
WP_048235042.1|46265_47006_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_004144423.1|46992_47559_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_142255986.1|47578_47884_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_019706001.1|48253_49201_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_041204928.1|49327_50455_+|transposase	ISAs1-like element ISKpn9 family transposase	transposase	NA	NA	NA	NA
WP_046664192.1|50713_50914_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_025712700.1|50999_51701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194114.1|51930_52323_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_001568108.1|52754_53240_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_011977736.1|53272_53602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004182076.1|53634_54456_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
WP_001101446.1|54808_55834_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_167686292.1|56128_57097_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	2.5e-179
WP_001101446.1|57415_58441_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
63255:63267	attR	ATGACTTTGTCAT	NA	NA	NA	NA
