The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041131	Serratia marcescens strain WVU-008 chromosome, complete genome	5271698	819963	894281	5271698	tRNA,plate,transposase,tail	Erwinia_phage(21.21%)	65	NA	NA
WP_142109283.1|819963_821010_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_094460532.1|820987_821752_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.5	2.4e-52
WP_047728898.1|821745_822372_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	5.3e-34
WP_142109284.1|822679_823693_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	38.6	8.2e-08
WP_004932578.1|823747_824746_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.2e-32
WP_142110720.1|827693_828578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084826825.1|828715_829687_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_033638672.1|829699_830458_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.5	9.4e-17
WP_102985435.1|830606_831500_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033641898.1|831918_832236_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_049200339.1|832248_833610_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_142109285.1|833653_835039_+	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_060425318.1|835054_835903_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_142109286.1|836051_836813_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_142109287.1|836822_838202_-	MFS transporter	NA	NA	NA	NA	NA
WP_142109288.1|838445_838934_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	46.7	1.8e-24
WP_004932541.1|839045_840110_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	1.7e-112
WP_142109289.1|840170_840683_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_142109290.1|840815_843443_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.7	3.2e-80
WP_004091602.1|843695_843881_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_033637176.1|844812_845379_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_004932520.1|845375_845804_+	DedA family protein	NA	NA	NA	NA	NA
WP_142109291.1|845886_847449_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_019455133.1|847615_848131_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_038871814.1|848197_849487_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004932506.1|849529_850321_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004932504.1|850490_851852_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004932501.1|852065_852314_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_019455135.1|852332_852881_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004932485.1|852933_853701_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015376707.1|853749_854106_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016929021.1|854248_854476_-	transcriptional regulator	NA	Q37973	Salmonella_virus	65.7	3.5e-20
WP_089185487.1|854565_855717_-	hypothetical protein	NA	Q6K1G4	Salmonella_virus	51.8	1.3e-105
WP_084826814.1|855713_856175_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	59.3	5.8e-46
WP_142109292.1|856187_858242_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	31.5	1.6e-31
WP_084826812.1|858234_858357_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	74.3	2.8e-08
WP_084826811.1|858389_858677_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	62.5	3.0e-24
WP_084826810.1|858741_859251_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	69.0	1.6e-65
WP_142109293.1|859263_860433_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	79.4	1.2e-180
WP_084826808.1|860573_861131_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	38.0	2.3e-28
WP_142109294.1|862977_866271_-|tail	phage tail protein I	tail	A0A2L0V120	Salmonella_phage	48.2	5.3e-274
WP_084826807.1|866263_867172_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	76.2	8.4e-121
WP_084826806.1|867176_867527_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	69.0	1.2e-38
WP_142109295.1|867523_868159_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	55.9	3.5e-57
WP_084826804.1|868244_868709_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	53.3	2.9e-37
WP_142109296.1|868761_869274_-	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	63.1	9.0e-56
WP_074055887.1|869257_869476_-	hypothetical protein	NA	B6SD15	Bacteriophage	50.9	1.4e-05
WP_084827882.1|869479_869683_-|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	68.7	1.2e-19
WP_084826803.1|869886_870069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142110721.1|870131_872207_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	48.6	3.6e-196
WP_084826802.1|872211_872433_-	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	53.6	6.9e-13
WP_084826801.1|872512_872818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089185495.1|873040_873949_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	52.4	2.9e-81
WP_047728881.1|873997_874762_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_038871801.1|875265_876342_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	1.2e-89
WP_060425327.1|877527_878685_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_101428074.1|878805_878853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004932457.1|878976_879318_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004932456.1|879630_880362_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_004932452.1|880493_881471_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_142109297.1|881470_882202_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_025301647.1|882332_884906_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.0	7.6e-127
WP_142109298.1|890909_891713_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	29.6	1.3e-27
WP_142109299.1|891759_892644_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142110722.1|893843_894281_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
>prophage 2
NZ_CP041131	Serratia marcescens strain WVU-008 chromosome, complete genome	5271698	2088066	2114129	5271698	terminase,transposase,integrase	Clostridium_botulinum_C_phage(11.11%)	26	2091879:2091921	2112737:2112779
WP_142110744.1|2088066_2088504_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	38.5	5.2e-20
WP_033638067.1|2088568_2088799_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	64.7	4.8e-17
WP_038875847.1|2089141_2089660_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_142109697.1|2089953_2090370_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_142109698.1|2090372_2091254_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_061872086.1|2091323_2091665_+	YebY family protein	NA	NA	NA	NA	NA
2091879:2091921	attL	TAGGAATCGTATTCGGTCTTTTTTTGTGTGATTGATTTATAAG	NA	NA	NA	NA
WP_142109699.1|2091983_2092454_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.8	3.2e-39
WP_142109700.1|2094347_2094776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142110745.1|2095387_2095579_-	hypothetical protein	NA	A0A248SL66	Klebsiella_phage	53.3	1.4e-09
WP_142109701.1|2096285_2096567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142109702.1|2096550_2096730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142109703.1|2097178_2097541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142109704.1|2099091_2100264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142109705.1|2100623_2101877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142109706.1|2101893_2102637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142109707.1|2102703_2103519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142109708.1|2103543_2104209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004940920.1|2104352_2104592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142109709.1|2104588_2105137_+	glycoside hydrolase family protein	NA	I6PBN2	Cronobacter_phage	42.6	6.8e-25
WP_142109710.1|2105808_2106021_+	hypothetical protein	NA	A0A2I6PFS5	Proteus_phage	44.4	4.9e-08
WP_142109711.1|2106089_2106953_+|terminase	terminase	terminase	A0A1I9KFG9	Aeromonas_phage	49.0	4.2e-45
WP_142110746.1|2107000_2108665_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	74.5	3.5e-250
WP_142110747.1|2110725_2111496_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_142109712.1|2112373_2112586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537152.1|2112993_2113278_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
2112737:2112779	attR	TAGGAATCGTATTCGGTCTTTTTTTGTGTGATTGATTTATAAG	NA	NA	NA	NA
WP_142109713.1|2113274_2114129_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	2.3e-80
>prophage 3
NZ_CP041131	Serratia marcescens strain WVU-008 chromosome, complete genome	5271698	4553653	4592691	5271698	tRNA,terminase,lysis,head,portal,plate,tail,capsid,integrase	Erwinia_phage(51.28%)	47	4559832:4559887	4593772:4593827
WP_049198481.1|4553653_4554667_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	3.3e-110
WP_001144069.1|4554992_4555208_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_025304325.1|4555344_4557093_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	6.6e-74
WP_004937194.1|4557250_4559092_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_060419767.1|4559166_4559655_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4559832:4559887	attL	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTTAGCT	NA	NA	NA	NA
WP_071998163.1|4560035_4560266_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	3.2e-21
WP_142110537.1|4560356_4561505_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	64.9	8.9e-136
WP_015379102.1|4561501_4561987_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
WP_142110538.1|4562167_4564837_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	39.6	2.2e-105
WP_102984926.1|4564829_4564952_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
WP_015379104.1|4564984_4565266_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.1	1.8e-26
WP_023447563.1|4565320_4565830_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
WP_142110539.1|4565845_4567015_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	82.0	2.1e-185
WP_142110540.1|4567291_4567837_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	46.9	1.5e-37
WP_015379109.1|4570678_4571212_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.6	4.3e-77
WP_033639347.1|4571204_4572113_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	68.9	5.6e-109
WP_142110541.1|4572117_4572468_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	65.5	8.4e-37
WP_121976857.1|4572615_4573245_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	72.3	1.4e-74
WP_128868867.1|4573318_4573765_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	57.7	7.9e-40
WP_033639343.1|4573751_4574225_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	62.5	3.4e-49
WP_033639342.1|4574320_4574749_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	35.9	1.2e-13
WP_142110542.1|4574745_4575258_-	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	66.9	1.9e-58
WP_031231709.1|4575241_4575451_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
WP_043148052.1|4575455_4575659_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	68.7	7.0e-20
WP_033639340.1|4575658_4576147_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.1e-39
WP_033649039.1|4576240_4576900_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.4	5.2e-80
WP_142110543.1|4576902_4578087_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.3	1.7e-158
WP_060431382.1|4578129_4578945_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	52.8	1.0e-69
WP_103101123.1|4579087_4580860_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	82.0	2.0e-291
WP_060445964.1|4580859_4581546_+	hypothetical protein	NA	V9IQL5	Stenotrophomonas_phage	29.7	2.0e-18
WP_033639335.1|4581542_4582577_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.2	5.0e-162
WP_033633573.1|4582621_4582963_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_142110544.1|4583385_4583592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072269783.1|4583747_4584398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060431383.1|4584394_4585288_-	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	39.9	2.5e-32
WP_142110545.1|4585872_4588089_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	58.7	3.3e-243
WP_089197475.1|4588085_4588412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126502296.1|4588408_4588726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379131.1|4588715_4588997_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
WP_033639330.1|4589119_4589344_-	hypothetical protein	NA	Q6K1F5	Salmonella_virus	58.3	9.8e-15
WP_122078013.1|4589343_4589586_-	DUF2732 family protein	NA	A0A218M4I9	Erwinia_phage	49.2	2.8e-07
WP_043148063.1|4589649_4589952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126502299.1|4589963_4590143_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	49.0	5.6e-05
WP_142110546.1|4590153_4590663_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	54.2	7.1e-45
WP_072009646.1|4590694_4590958_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.7	5.1e-39
WP_142110547.1|4591093_4591681_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	61.3	7.9e-64
WP_142110548.1|4591680_4592691_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	91.8	8.0e-181
4593772:4593827	attR	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTTAGCT	NA	NA	NA	NA
