The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041129	Serratia marcescens strain WVU-006 chromosome, complete genome	5233072	77889	85375	5233072		Enterobacteria_phage(50.0%)	10	NA	NA
WP_142001747.1|77889_78144_-	transcriptional regulator	NA	Q858U4	Yersinia_virus	51.6	5.2e-12
WP_142001749.1|78140_78866_-	NAD-dependent aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_142001751.1|79397_79661_+	AlpA family phage regulatory protein	NA	Q7M299	Enterobacteria_phage	56.2	6.5e-18
WP_142001752.1|79657_79903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134267934.1|79908_80454_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	57.1	3.1e-22
WP_142001754.1|80450_80714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060431171.1|80710_81046_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_142001756.1|81057_83391_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	59.5	3.8e-258
WP_075205901.1|83875_84784_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.6	1.4e-72
WP_016929262.1|85141_85375_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	55.8	4.9e-17
>prophage 2
NZ_CP041129	Serratia marcescens strain WVU-006 chromosome, complete genome	5233072	819530	877418	5233072	plate,tail,tRNA	Salmonella_phage(25.0%)	58	NA	NA
WP_142001930.1|819530_820577_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_089191195.1|820554_821319_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.3	5.7e-54
WP_033641890.1|821312_821939_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	5.3e-34
WP_071845092.1|822246_823263_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	37.5	3.1e-07
WP_019455119.1|823317_824316_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.2e-32
WP_033644194.1|824395_826951_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.0	1.4e-27
WP_089191196.1|827509_828127_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_042785641.1|828321_829206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089194293.1|829344_830316_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_042785642.1|830328_831087_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	5.5e-17
WP_042783708.1|831235_832129_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033641898.1|832546_832864_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_142001932.1|832876_834238_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_142001934.1|834281_835667_+	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_004932550.1|835682_836531_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_033641902.1|836679_837441_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_033641904.1|837450_838830_-	MFS transporter	NA	NA	NA	NA	NA
WP_042783712.1|839073_839562_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	46.7	1.3e-24
WP_004932541.1|839673_840738_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	1.7e-112
WP_047025225.1|840798_841302_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_033641907.1|841435_844063_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.7	3.2e-80
WP_004091602.1|844315_844501_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_033641908.1|845856_846423_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_004932520.1|846419_846848_+	DedA family protein	NA	NA	NA	NA	NA
WP_046688257.1|846930_848493_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_033641910.1|848659_849175_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_142001936.1|849240_850530_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_004932506.1|850572_851364_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004932504.1|851533_852895_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004932501.1|853109_853358_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_019455135.1|853376_853925_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_033641911.1|853977_854745_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015376707.1|854793_855150_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_033641912.1|855293_855521_-	transcriptional regulator	NA	Q37973	Salmonella_virus	65.7	4.6e-20
WP_069101122.1|855610_856705_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	49.7	2.5e-103
WP_033641914.1|856701_857175_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	57.2	8.1e-43
WP_142001938.1|857197_859291_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	45.5	2.4e-14
WP_033641916.1|859283_859406_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	74.3	2.8e-08
WP_033641917.1|859438_859726_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	58.9	3.0e-24
WP_033641919.1|859790_860300_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	69.0	1.6e-65
WP_033641920.1|860312_861482_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	79.9	5.8e-183
WP_050594401.1|861622_862180_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	39.6	1.7e-28
WP_142001940.1|862179_864057_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	52.8	2.2e-59
WP_033641922.1|864053_867347_-|tail	phage tail protein I	tail	G5DEL7	Salmonella_phage	48.6	2.0e-273
WP_033641923.1|867339_868248_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	76.5	1.5e-122
WP_033641924.1|868252_868603_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	4.4e-38
WP_069101126.1|868599_869235_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	54.5	1.2e-57
WP_046688263.1|869320_869785_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	53.3	1.3e-37
WP_046688264.1|869838_870351_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	64.1	1.1e-58
WP_033641928.1|870334_870553_-	hypothetical protein	NA	B6SD15	Bacteriophage	50.9	8.1e-06
WP_033641929.1|870556_870760_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	68.7	1.8e-20
WP_033641930.1|870951_871146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080376447.1|871209_873306_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	48.4	1.0e-193
WP_033641931.1|873289_873511_-	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	56.5	6.9e-13
WP_033641932.1|873589_873895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103101724.1|874137_875034_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	53.1	5.8e-82
WP_033641933.1|875081_875846_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016929016.1|876341_877418_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	9.0e-90
>prophage 3
NZ_CP041129	Serratia marcescens strain WVU-006 chromosome, complete genome	5233072	1694367	1772927	5233072	lysis,capsid,head,terminase,portal,integrase,protease,plate,tail	Erwinia_phage(32.61%)	88	1684020:1684039	1746385:1746404
1684020:1684039	attL	CAGGCGTTCGACAGCCTGAT	NA	NA	NA	NA
WP_033642514.1|1694367_1694880_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_089196838.1|1695295_1696777_+	phospholipase	NA	NA	NA	NA	NA
WP_046686750.1|1696773_1697547_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_033642517.1|1697635_1698409_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_096242099.1|1698497_1699241_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_060453234.1|1699598_1700684_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	59.7	2.4e-114
WP_072270167.1|1700801_1701371_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	33.7	6.4e-26
WP_072270972.1|1701511_1701742_+	regulator	NA	NA	NA	NA	NA
WP_060438900.1|1701771_1702281_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.0	7.9e-44
WP_072010285.1|1702291_1702471_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
WP_060453213.1|1702482_1702785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060453214.1|1702849_1703143_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_060453215.1|1703142_1703466_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_142002183.1|1703453_1703678_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	56.9	3.7e-14
WP_048321968.1|1703800_1704082_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
WP_142002185.1|1704078_1706295_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	57.9	1.3e-239
WP_033644912.1|1706333_1706558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142002187.1|1706605_1706803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142003263.1|1706936_1707821_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142002189.1|1707994_1709131_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_142002191.1|1709308_1710502_+	MFS transporter	NA	NA	NA	NA	NA
WP_071605322.1|1711003_1711258_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	5.9e-16
WP_033633573.1|1711257_1711599_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_142002193.1|1711768_1712311_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_142002195.1|1712337_1713372_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	81.0	2.0e-163
WP_142002197.1|1713371_1715144_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	82.2	3.3e-291
WP_142002198.1|1715286_1716102_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	53.1	4.6e-70
WP_128868863.1|1716144_1717329_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.6	3.5e-159
WP_033649039.1|1717331_1717991_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.4	5.2e-80
WP_128868864.1|1718084_1718573_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	52.5	1.6e-38
WP_015379118.1|1718572_1718776_+	phage Tail protein X	NA	A0A0F7LCN2	Escherichia_phage	68.7	2.4e-20
WP_015379117.1|1718778_1718988_+	hypothetical protein	NA	B6SD15	Bacteriophage	48.2	9.2e-07
WP_142002200.1|1718971_1719484_+	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	67.1	4.3e-58
WP_142002202.1|1719480_1719909_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.6	2.1e-13
WP_142002204.1|1720004_1720481_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	65.4	6.9e-50
WP_043148046.1|1720467_1720914_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	59.1	2.1e-40
WP_142002206.1|1720986_1721616_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	74.1	1.3e-75
WP_142002208.1|1721612_1721963_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	66.4	3.8e-37
WP_142002210.1|1721967_1722876_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	67.9	5.3e-107
WP_142002212.1|1722868_1723402_+|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	77.1	5.7e-77
WP_142002214.1|1723408_1725946_+	hypothetical protein	NA	Q858V4	Yersinia_virus	54.6	9.3e-61
WP_060453274.1|1725947_1726469_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	45.9	1.1e-35
WP_142002216.1|1726745_1727915_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	82.0	2.8e-185
WP_060453186.1|1727930_1728440_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	75.6	1.1e-69
WP_060418393.1|1728493_1728775_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.1	1.4e-26
WP_023456045.1|1728807_1728930_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
WP_142002218.1|1728922_1731769_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	50.4	6.1e-109
WP_015379102.1|1731773_1732259_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
WP_142002220.1|1732255_1733404_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	63.4	3.2e-125
WP_072265518.1|1733503_1733722_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.2	3.2e-26
WP_004938680.1|1734015_1735704_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_033642521.1|1735998_1736388_+	membrane protein	NA	NA	NA	NA	NA
WP_004938676.1|1736427_1736691_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	1.7e-26
WP_033642522.1|1736921_1737236_+	YbjC family protein	NA	NA	NA	NA	NA
WP_142002222.1|1737292_1738195_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.9	2.8e-36
WP_004938666.1|1738331_1738811_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_033650647.1|1739217_1740327_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_004938650.1|1740447_1741581_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	5.5e-29
WP_142002224.1|1741605_1742568_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_025302238.1|1742564_1743410_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_047024958.1|1743571_1744051_+	YbjO family protein	NA	NA	NA	NA	NA
WP_033650649.1|1744119_1745247_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.8	3.5e-28
WP_033633469.1|1745243_1745528_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	1.0e-24
WP_004928423.1|1745517_1745769_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_015377297.1|1745870_1746605_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1746385:1746404	attR	ATCAGGCTGTCGAACGCCTG	NA	NA	NA	NA
WP_033650651.1|1746804_1747473_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_025159684.1|1747472_1748189_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_033642533.1|1748198_1748930_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_089192582.1|1748962_1749691_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	1.8e-28
WP_033642535.1|1749955_1750498_-	lipoprotein	NA	NA	NA	NA	NA
WP_004928400.1|1750657_1750981_+	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	43.3	2.9e-15
WP_089194500.1|1751034_1752600_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_142002226.1|1752787_1753624_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	30.2	1.3e-11
WP_004928393.1|1753624_1754635_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_101453222.1|1754793_1756233_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_033642539.1|1756383_1756731_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_033642540.1|1756760_1757777_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_033642541.1|1757852_1759574_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_033642542.1|1759772_1760774_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_033642543.1|1760829_1762479_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_033642544.1|1762660_1763557_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_033642546.1|1763744_1765403_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_033642547.1|1765417_1766371_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_033642548.1|1766565_1767681_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_142002228.1|1767680_1769627_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.3	3.6e-36
WP_004928349.1|1769714_1769936_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	1.1e-15
WP_004928347.1|1770299_1770620_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_025302261.1|1770647_1772927_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	8.7e-167
>prophage 4
NZ_CP041129	Serratia marcescens strain WVU-006 chromosome, complete genome	5233072	2145321	2172361	5233072	protease,coat	Moraxella_phage(50.0%)	25	NA	NA
WP_033642833.1|2145321_2146740_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_033642834.1|2146886_2147096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033638276.1|2147875_2148268_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_069100100.1|2148272_2148872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033642836.1|2148927_2149167_-	YebV family protein	NA	NA	NA	NA	NA
WP_033644260.1|2149301_2150234_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_142003267.1|2150253_2152596_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_046686936.1|2152747_2153515_-	molecular chaperone	NA	NA	NA	NA	NA
WP_033642838.1|2153535_2154078_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033642839.1|2154071_2154575_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033642840.1|2154577_2155114_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_033652487.1|2155387_2155924_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_142002340.1|2156189_2157626_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_142002342.1|2157728_2160359_-	MCE family protein	NA	NA	NA	NA	NA
WP_047026336.1|2160327_2161575_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_033642843.1|2161830_2162328_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004931497.1|2162424_2163135_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033642845.1|2163154_2165203_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	1.5e-85
WP_033652485.1|2165270_2166116_-	DMT family transporter	NA	NA	NA	NA	NA
WP_142002344.1|2166112_2167420_-	opine metallophore biosynthesis dehydrogenase	NA	NA	NA	NA	NA
WP_033642848.1|2167412_2168210_-	nicotianamine synthase	NA	NA	NA	NA	NA
WP_142002346.1|2168197_2168983_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	6.7e-10
WP_033652483.1|2168979_2170020_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_142002348.1|2170022_2171114_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033652481.1|2171482_2172361_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 5
NZ_CP041129	Serratia marcescens strain WVU-006 chromosome, complete genome	5233072	3781561	3788655	5233072		Salmonella_phage(33.33%)	10	NA	NA
WP_089197314.1|3781561_3781915_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	47.0	1.6e-19
WP_033644019.1|3782115_3782346_+	hypothetical protein	NA	J9Q735	Salmonella_phage	50.7	4.2e-13
WP_033644020.1|3782359_3782899_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	56.6	4.0e-46
WP_142002781.1|3782912_3783614_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_016926729.1|3783886_3784402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016926728.1|3784435_3784684_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_033651534.1|3784731_3786021_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.2	6.0e-64
WP_004941642.1|3786097_3786724_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_122004470.1|3786979_3788017_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.9	5.0e-69
WP_122004471.1|3788016_3788655_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.2	2.4e-26
>prophage 6
NZ_CP041129	Serratia marcescens strain WVU-006 chromosome, complete genome	5233072	3971499	3981397	5233072	integrase	Enterobacteria_phage(42.86%)	11	3963492:3963511	3979831:3979850
3963492:3963511	attL	CGGCCGCCAGCAGCAGCCGC	NA	NA	NA	NA
WP_016929804.1|3971499_3971982_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	44.9	3.2e-26
WP_142003300.1|3972578_3973793_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.6	1.4e-107
WP_142002833.1|3973811_3975779_+	hypothetical protein	NA	X5JAK5	Clostridium_phage	32.7	5.7e-66
WP_142002835.1|3975853_3976057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142002837.1|3976053_3976269_-	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	50.0	4.7e-06
WP_142002839.1|3977388_3977652_+	AlpA family phage regulatory protein	NA	Q7M299	Enterobacteria_phage	55.0	1.1e-17
WP_142002841.1|3977648_3977894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142002843.1|3977899_3978445_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	50.9	3.0e-17
WP_033635645.1|3978441_3978705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142002845.1|3978701_3979037_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_142002847.1|3979048_3981397_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.8	1.1e-265
3979831:3979850	attR	GCGGCTGCTGCTGGCGGCCG	NA	NA	NA	NA
>prophage 7
NZ_CP041129	Serratia marcescens strain WVU-006 chromosome, complete genome	5233072	4864345	4873272	5233072		environmental_Halophage(16.67%)	7	NA	NA
WP_047026485.1|4864345_4866424_+	membrane protein	NA	H9YQA8	environmental_Halophage	71.9	1.3e-52
WP_033645260.1|4866464_4867682_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.1	1.6e-26
WP_033645386.1|4867813_4868389_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	63.2	6.1e-69
WP_033645261.1|4868461_4869985_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.6	1.9e-77
WP_142003184.1|4870136_4870862_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_142003186.1|4870861_4872547_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	72.8	1.5e-224
WP_033636286.1|4872702_4873272_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	31.7	1.3e-07
