The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	0	14752	5207802		Bacillus_phage(40.0%)	18	NA	NA
WP_053475346.1|494_1889_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_056683637.1|2155_3736_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	28.8	3.5e-13
WP_053475344.1|3953_4823_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_053475343.1|4846_5269_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_053475341.1|5474_6074_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	39.5	1.6e-32
WP_053475340.1|6501_7491_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053475339.1|7504_7798_+	thiamine-binding protein	NA	NA	NA	NA	NA
WP_053475338.1|7794_8562_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_056683634.1|8558_9302_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	7.8e-32
WP_053475336.1|9298_10072_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_082620647.1|10130_10262_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_075209117.1|10307_10424_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_056683629.1|10649_12185_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.4	1.1e-08
WP_053475334.1|12200_12725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053475333.1|12864_13179_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_056683626.1|13305_14049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053475331.1|14226_14463_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053475330.1|14554_14752_+	alpha/beta-type small acid-soluble spore protein	NA	A0A217EQS5	Bacillus_phage	66.7	2.1e-13
>prophage 2
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	23376	24702	5207802		Turkeypox_virus(100.0%)	1	NA	NA
WP_142107850.1|23376_24702_-	sulfatase-like hydrolase/transferase	NA	A0A0M3PB47	Turkeypox_virus	22.6	1.8e-07
>prophage 3
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	28206	29022	5207802		Planktothrix_phage(100.0%)	1	NA	NA
WP_053475317.1|28206_29022_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	4.0e-13
>prophage 4
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	32153	37365	5207802		Planktothrix_phage(50.0%)	5	NA	NA
WP_053475312.1|32153_32909_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	5.8e-35
WP_053477490.1|32932_33634_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_053475311.1|33658_34366_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_053477489.1|34402_35221_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_056683601.1|35700_37365_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	39.2	3.8e-26
>prophage 5
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	46365	55312	5207802		Tupanvirus(25.0%)	7	NA	NA
WP_142107852.1|46365_47961_+	catalase	NA	A0A2K9L572	Tupanvirus	45.4	2.1e-98
WP_053475298.1|48272_48821_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_053475297.1|48858_49314_-	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	47.3	3.3e-33
WP_053475296.1|50497_51805_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.5	3.3e-46
WP_053475295.1|51836_53321_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_053475294.1|53340_54204_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_053475292.1|54769_55312_+	helix-turn-helix domain-containing protein	NA	Q786F1	Bacillus_phage	45.6	1.5e-05
>prophage 6
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	62130	64437	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053475284.1|62130_64437_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.2	4.1e-79
>prophage 7
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	74001	74739	5207802		Acinetobacter_phage(100.0%)	1	NA	NA
WP_053475272.1|74001_74739_+	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A172Q076	Acinetobacter_phage	25.3	1.2e-08
>prophage 8
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	78773	83476	5207802		Geobacillus_virus(50.0%)	5	NA	NA
WP_053475266.1|78773_79412_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	58.7	4.0e-37
WP_053475265.1|79725_80133_+	globin	NA	NA	NA	NA	NA
WP_082446820.1|80210_81017_+	DsbA family protein	NA	NA	NA	NA	NA
WP_053475263.1|81313_81493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142107854.1|81658_83476_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	27.2	1.3e-61
>prophage 9
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	89441	91447	5207802		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_053475255.1|89441_90377_-	ABC transporter ATP-binding protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	26.0	2.9e-07
WP_053475254.1|90379_91447_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	1.2e-14
>prophage 10
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	97248	97995	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053475249.1|97248_97995_-	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	1.4e-44
>prophage 11
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	102043	104043	5207802		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_053475245.1|102043_103066_-	dipeptide ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	24.9	5.3e-07
WP_053475244.1|103062_104043_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	1.1e-20
>prophage 12
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	111766	116681	5207802		Escherichia_phage(50.0%)	4	NA	NA
WP_053475235.1|111766_114373_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	36.0	1.8e-120
WP_053475234.1|114513_114693_-	YjzC family protein	NA	NA	NA	NA	NA
WP_053475233.1|114870_115683_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_056683514.1|115724_116681_-	ornithine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	31.9	1.1e-22
>prophage 13
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	119786	122101	5207802		Halovirus(50.0%)	2	NA	NA
WP_053475231.1|119786_120869_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.1	1.3e-56
WP_053475230.1|120943_122101_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.4	1.1e-27
>prophage 14
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	132450	133740	5207802		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_053475219.1|132450_133740_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.8	5.9e-19
>prophage 15
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	151468	155233	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_142107862.1|151468_155233_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	22.0	5.7e-14
>prophage 16
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	163802	164189	5207802		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_053475193.1|163802_164189_+	hypothetical protein	NA	A0A2H4J238	uncultured_Caudovirales_phage	34.5	7.1e-13
>prophage 17
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	168618	169413	5207802		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_053475186.1|168618_169413_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.5	1.4e-15
>prophage 18
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	172517	176810	5207802		Staphylococcus_phage(50.0%)	4	NA	NA
WP_056683449.1|172517_174068_-	fatty acid--CoA ligase family protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.3	1.6e-47
WP_056683446.1|174275_175163_-	anti-sigma-V factor rsiV	NA	NA	NA	NA	NA
WP_053475180.1|175164_175680_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_053475179.1|175820_176810_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	26.6	1.0e-15
>prophage 19
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	183109	184546	5207802		Tupanvirus(100.0%)	1	NA	NA
WP_142107864.1|183109_184546_-	protoporphyrinogen oxidase	NA	A0A2K9L5D8	Tupanvirus	26.3	2.2e-06
>prophage 20
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	194062	195855	5207802		Staphylococcus_phage(50.0%)	2	NA	NA
WP_053475165.1|194062_194803_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.9	1.5e-27
WP_053475164.1|195435_195855_+	HIT family protein	NA	B5LJ12	Mycobacterium_phage	31.8	5.4e-06
>prophage 21
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	198885	199965	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_142107867.1|198885_199965_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.6	7.2e-87
>prophage 22
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	212319	216171	5207802		Staphylococcus_phage(50.0%)	4	NA	NA
WP_053475146.1|212319_213219_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	5.3e-27
WP_053475145.1|213378_213564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053475144.1|213623_214412_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_053475143.1|214548_216171_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	21.5	1.1e-11
>prophage 23
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	219634	222802	5207802		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_142108973.1|219634_221440_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	71.4	1.4e-13
WP_053475139.1|221529_222444_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_053475138.1|222601_222802_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	71.4	3.8e-18
>prophage 24
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	230909	231125	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053475130.1|230909_231125_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	75.4	7.4e-20
>prophage 25
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	237887	239015	5207802		Hokovirus(100.0%)	1	NA	NA
WP_053475119.1|237887_239015_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.0	6.5e-14
>prophage 26
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	243400	250490	5207802		Bacillus_phage(50.0%)	7	NA	NA
WP_053475115.1|243400_244810_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.2	6.6e-32
WP_053475114.1|244799_245501_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	6.2e-39
WP_053475113.1|245677_246304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053475112.1|246388_247684_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.8	1.0e-47
WP_053475111.1|248036_248963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053475110.1|248955_249351_-	response regulator	NA	NA	NA	NA	NA
WP_053475109.1|249593_250490_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	31.1	6.9e-35
>prophage 27
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	277973	289352	5207802		Feldmannia_irregularis_virus(33.33%)	12	NA	NA
WP_142107888.1|277973_278945_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	40.2	1.7e-58
WP_142107889.1|279024_280131_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.7	9.8e-23
WP_142107890.1|280238_281156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142107891.1|281246_281792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142107892.1|281892_282459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142107893.1|282522_283875_-	HAMP domain-containing protein	NA	Q8QNA2	Ectocarpus_siliculosus_virus	35.5	4.4e-09
WP_053477477.1|283871_284594_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	2.4e-06
WP_142107894.1|284677_284998_-	DUF3889 domain-containing protein	NA	NA	NA	NA	NA
WP_053475079.1|285185_285437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053475078.1|285517_286159_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	30.8	5.7e-07
WP_053475077.1|286171_287287_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_053475076.1|287606_289352_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	48.0	2.9e-154
>prophage 28
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	295818	306235	5207802		Moraxella_phage(25.0%)	9	NA	NA
WP_142107899.1|295818_297120_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.3	2.6e-51
WP_053475066.1|297693_299067_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.4	9.5e-60
WP_056683364.1|299110_300499_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_053475064.1|300813_300999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053475063.1|301060_301879_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	38.1	2.5e-39
WP_053477476.1|301917_302529_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_142107900.1|302633_303584_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_142107901.1|303868_304501_-	arylformamidase	NA	NA	NA	NA	NA
WP_142107902.1|304618_306235_-	phosphotransferase	NA	G8DDN0	Micromonas_pusilla_virus	31.4	2.1e-45
>prophage 29
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	310694	314770	5207802		Bacillus_phage(50.0%)	2	NA	NA
WP_053475053.1|310694_311864_-	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	46.7	6.5e-25
WP_142107906.1|312874_314770_-	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	35.8	2.9e-99
>prophage 30
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	329175	329976	5207802		Klosneuvirus(100.0%)	1	NA	NA
WP_142107914.1|329175_329976_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	29.4	8.7e-13
>prophage 31
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	333611	339396	5207802		Streptococcus_phage(66.67%)	6	NA	NA
WP_142107918.1|333611_334382_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	6.0e-11
WP_056683347.1|334378_335176_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_142107919.1|335172_335976_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_142107920.1|336043_337432_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X9I5H2	Streptococcus_phage	25.0	2.9e-16
WP_056683340.1|337561_338488_+	EamA family transporter	NA	NA	NA	NA	NA
WP_142107921.1|338535_339396_-	DUF2179 domain-containing protein	NA	M1Q1P6	Streptococcus_phage	34.3	7.1e-37
>prophage 32
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	343344	354782	5207802		Moumouvirus(14.29%)	11	NA	NA
WP_142107925.1|343344_344106_+	glucose 1-dehydrogenase	NA	A0A2P1ELN2	Moumouvirus	23.9	6.8e-07
WP_053475030.1|345937_346333_-	glyoxalase	NA	NA	NA	NA	NA
WP_056683327.1|346461_346917_-	polyketide cyclase / dehydrase and lipid transport	NA	NA	NA	NA	NA
WP_056683324.1|347078_348251_-	glucosyltransferase	NA	Q6QXI9	Agrotis_segetum_granulosis_virus	29.3	2.1e-07
WP_056683321.1|348253_348688_-	helix-turn-helix transcriptional regulator	NA	S5MUA5	Brevibacillus_phage	35.5	8.0e-05
WP_056683316.1|348911_349508_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_142107926.1|349532_350939_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.1	3.4e-12
WP_142107927.1|350941_351652_-	response regulator	NA	W8CYM9	Bacillus_phage	36.0	8.5e-36
WP_056683309.1|351721_352087_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	36.7	2.8e-11
WP_053475022.1|352100_354026_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_053475021.1|354026_354782_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.9	7.1e-33
>prophage 33
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	361140	362469	5207802		Pseudomonas_phage(100.0%)	1	NA	NA
WP_142107928.1|361140_362469_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	2.2e-29
>prophage 34
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	370391	377245	5207802		Pseudomonas_phage(33.33%)	5	NA	NA
WP_056683281.1|370391_371720_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.2	1.1e-25
WP_142107931.1|372306_372909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053475009.1|373344_374916_-	DNA cytosine methyltransferase	NA	Q83VT0	Escherichia_phage	27.8	7.9e-18
WP_053475007.1|375468_376212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053475006.1|376423_377245_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	56.2	5.9e-81
>prophage 35
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	387008	391080	5207802		Bacillus_phage(50.0%)	4	NA	NA
WP_053474993.1|387008_387767_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	37.8	1.6e-24
WP_053474992.1|387942_388314_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_053474991.1|388515_389574_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_053474990.1|389580_391080_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	8.9e-19
>prophage 36
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	396305	397295	5207802		Enterobacteria_phage(100.0%)	1	NA	NA
WP_053474984.1|396305_397295_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.6	4.2e-25
>prophage 37
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	412079	413211	5207802	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_142107943.1|412079_413211_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	61.9	5.4e-93
>prophage 38
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	425801	427313	5207802		Moumouvirus(100.0%)	1	NA	NA
WP_142107952.1|425801_427313_-	protein kinase	NA	A0A2P1EMI9	Moumouvirus	29.7	3.1e-11
>prophage 39
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	433644	434777	5207802	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_142107959.1|433644_434777_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	61.5	2.1e-92
>prophage 40
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	438908	446868	5207802		Synechococcus_phage(50.0%)	5	NA	NA
WP_142107963.1|438908_440819_-	carbamoyltransferase	NA	E3SL39	Synechococcus_phage	32.2	5.4e-37
WP_142107964.1|440895_441654_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_142107965.1|441728_443342_-	hypothetical protein	NA	E3SK81	Synechococcus_phage	26.0	9.2e-38
WP_142107966.1|443371_445132_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.0	2.5e-12
WP_053474934.1|445128_446868_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.9	1.5e-17
>prophage 41
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	451026	452019	5207802		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_142107971.1|451026_452019_-	Gfo/Idh/MocA family oxidoreductase	NA	A0A1B1IVD1	uncultured_Mediterranean_phage	26.8	9.4e-09
>prophage 42
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	463032	464328	5207802		Klosneuvirus(100.0%)	1	NA	NA
WP_053477468.1|463032_464328_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.1	9.1e-20
>prophage 43
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	467973	472341	5207802		Tupanvirus(50.0%)	4	NA	NA
WP_053474911.1|467973_469449_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	35.3	4.1e-69
WP_053474910.1|469472_470690_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_053474909.1|470741_471845_-	aminopeptidase	NA	NA	NA	NA	NA
WP_053474908.1|471861_472341_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	39.3	1.2e-20
>prophage 44
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	478637	480206	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_142107984.1|478637_480206_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	27.6	3.9e-25
>prophage 45
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	485136	486546	5207802		Tupanvirus(100.0%)	1	NA	NA
WP_142107990.1|485136_486546_-	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	26.4	2.0e-20
>prophage 46
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	491719	493739	5207802		Synechococcus_phage(66.67%)	3	NA	NA
WP_053474882.1|491719_492433_-	NTP transferase domain-containing protein	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	35.2	9.1e-38
WP_053474881.1|492429_492783_-	HAD hydrolase family protein	NA	M4QRS4	Synechococcus_phage	52.2	6.3e-32
WP_053474880.1|492788_493739_-	hypothetical protein	NA	M4QT73	Synechococcus_phage	32.1	3.1e-33
>prophage 47
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	517211	517733	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_053474858.1|517211_517733_-	streptothricin N-acetyltransferase SatA	NA	A0A1B0RXL7	Streptococcus_phage	46.1	2.6e-42
>prophage 48
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	527400	527961	5207802		Clostridium_phage(100.0%)	1	NA	NA
WP_142107996.1|527400_527961_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	41.5	1.4e-30
>prophage 49
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	535742	537525	5207802		Bacillus_phage(66.67%)	3	NA	NA
WP_053474849.1|535742_536318_-	hypothetical protein	NA	A7KV55	Bacillus_phage	21.9	1.9e-06
WP_053474848.1|536833_537193_-	hypothetical protein	NA	A0A2H4J238	uncultured_Caudovirales_phage	45.2	2.1e-22
WP_053474847.1|537195_537525_-	YolD-like family protein	NA	O64030	Bacillus_phage	37.0	6.3e-10
>prophage 50
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	542822	547294	5207802		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_053474842.1|542822_543653_-	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	43.2	4.7e-54
WP_053478868.1|544587_545232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142108004.1|545722_547294_-	DNA (cytosine-5-)-methyltransferase	NA	Q83VT0	Escherichia_phage	27.6	1.0e-17
>prophage 51
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	551194	553800	5207802		Staphylococcus_phage(50.0%)	3	NA	NA
WP_142108006.1|551194_552070_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.7	4.5e-55
WP_053474836.1|552066_552441_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053474835.1|553203_553800_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	36.0	3.5e-19
>prophage 52
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	564981	565836	5207802		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_142108008.1|564981_565836_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.6	1.7e-11
>prophage 53
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	572274	573072	5207802	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_142108010.1|572274_573072_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.9	7.3e-44
>prophage 54
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	576896	577199	5207802	transposase,integrase	Paenibacillus_phage(100.0%)	1	565462:565477	581266:581281
565462:565477	attL	TTGGTTTAATTTCAAA	NA	NA	NA	NA
WP_142108980.1|576896_577199_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I7SC85	Paenibacillus_phage	64.5	1.4e-27
WP_142108980.1|576896_577199_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I7SC85	Paenibacillus_phage	64.5	1.4e-27
581266:581281	attR	TTGGTTTAATTTCAAA	NA	NA	NA	NA
>prophage 55
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	581705	583916	5207802		uncultured_virus(100.0%)	1	NA	NA
WP_142108013.1|581705_583916_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.1	2.5e-110
>prophage 56
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	587664	590077	5207802		Bacillus_phage(100.0%)	3	NA	NA
WP_056683027.1|587664_588894_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	39.1	7.7e-77
WP_056683024.1|588913_589243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053474803.1|589258_590077_-	hypothetical protein	NA	U5Q085	Bacillus_phage	38.4	3.9e-16
>prophage 57
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	607382	613300	5207802		Escherichia_phage(75.0%)	4	NA	NA
WP_053474786.1|607382_608723_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	38.6	1.3e-69
WP_053474785.1|609621_610311_+	hypothetical protein	NA	A0A077SLS7	Escherichia_phage	28.4	7.2e-08
WP_053474784.1|610303_612706_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	40.6	1.9e-159
WP_053474783.1|612721_613300_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.6	5.1e-63
>prophage 58
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	623657	628174	5207802		Geobacillus_phage(33.33%)	5	NA	NA
WP_053474771.1|623657_624419_-	glycoside hydrolase family 25 protein	NA	A0A1U9WQS3	Geobacillus_phage	27.7	3.6e-16
WP_053474770.1|624784_625276_+	DinB family protein	NA	NA	NA	NA	NA
WP_053474769.1|626396_626672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142108023.1|627137_627542_-	NUDIX domain-containing protein	NA	D0R7I2	Paenibacillus_phage	32.2	1.0e-06
WP_053474767.1|627589_628174_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.8	5.5e-17
>prophage 59
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	640635	641268	5207802	integrase	uncultured_Mediterranean_phage(100.0%)	1	630093:630107	641874:641888
630093:630107	attL	GGAAGGTTATTTGGC	NA	NA	NA	NA
WP_142108028.1|640635_641268_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	30.2	3.0e-08
WP_142108028.1|640635_641268_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	30.2	3.0e-08
641874:641888	attR	GGAAGGTTATTTGGC	NA	NA	NA	NA
>prophage 60
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	657901	659357	5207802		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_056682946.1|657901_658606_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	1.3e-12
WP_053474744.1|658583_659357_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.0	1.7e-13
>prophage 61
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	663905	665387	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_142108033.1|663905_665387_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	2.0e-47
>prophage 62
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	680454	682922	5207802		Streptococcus_phage(50.0%)	2	NA	NA
WP_053474722.1|680454_681285_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	50.0	4.4e-76
WP_056682926.1|681905_682922_-	serine hydrolase	NA	G1BSP8	Mycobacterium_virus	24.3	5.1e-10
>prophage 63
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	692611	693940	5207802		Pseudomonas_phage(100.0%)	1	NA	NA
WP_142108041.1|692611_693940_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	1.0e-26
>prophage 64
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	700342	701821	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_053474708.1|700342_701821_-	Lsa family ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	25.8	1.0e-30
>prophage 65
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	712090	713383	5207802	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_142108987.1|712090_713383_+|tRNA	aspartate--tRNA(Asn) ligase	tRNA	A0A2K9L0E9	Tupanvirus	33.9	1.2e-64
>prophage 66
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	722496	723411	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_142108045.1|722496_723411_+	WYL domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	27.1	6.7e-09
>prophage 67
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	734603	735251	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_053474678.1|734603_735251_-	type A chloramphenicol O-acetyltransferase	NA	A0A1X9I6V6	Streptococcus_phage	57.7	2.4e-74
>prophage 68
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	755222	755639	5207802	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_142108060.1|755222_755639_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.3	3.6e-26
>prophage 69
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	768084	769472	5207802		Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_053474651.1|768084_768618_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.7	3.4e-21
WP_142108064.1|768653_769472_+	radical SAM protein	NA	A0A1C9EG49	Acidianus_two-tailed_virus	32.3	1.4e-13
>prophage 70
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	773676	774438	5207802		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_142108065.1|773676_774438_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.3	4.2e-25
>prophage 71
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	781018	783521	5207802		Streptococcus_phage(100.0%)	2	NA	NA
WP_053474638.1|781018_783145_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	67.4	2.5e-261
WP_056682815.1|783122_783521_-	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	54.0	9.6e-29
>prophage 72
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	786870	787383	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_142108067.1|786870_787383_+	DUF2691 family protein	NA	G3MBG1	Bacillus_virus	36.3	1.0e-06
>prophage 73
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	791660	797953	5207802		Streptococcus_phage(33.33%)	5	NA	NA
WP_053474628.1|791660_792542_-	helix-turn-helix transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	37.0	2.0e-10
WP_053477436.1|792781_795103_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_053474627.1|795125_795887_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.6	3.8e-10
WP_053474626.1|796001_797267_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_053474625.1|797263_797953_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.6	3.1e-27
>prophage 74
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	814990	818989	5207802		Planktothrix_phage(66.67%)	3	NA	NA
WP_053478879.1|814990_815965_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	2.1e-21
WP_053478880.1|815957_816956_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-15
WP_053478881.1|817240_818989_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.6	1.4e-55
>prophage 75
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	825973	826648	5207802		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_053478891.1|825973_826648_+	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	32.4	1.6e-12
>prophage 76
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	830197	837189	5207802		Bacillus_phage(40.0%)	7	NA	NA
WP_142108075.1|830197_830866_+	VWA domain-containing protein	NA	A0A2D1GNA9	Pseudoalteromonas_phage	30.6	2.8e-17
WP_142108076.1|831250_833077_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.4	5.9e-57
WP_142108077.1|833069_834800_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.1	1.7e-53
WP_053478899.1|834997_835390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142108078.1|835382_835598_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142108079.1|835712_836423_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.8e-14
WP_053478901.1|836415_837189_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	2.4e-15
>prophage 77
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	851324	853936	5207802		Aureococcus_anophage(50.0%)	2	NA	NA
WP_053478914.1|851324_852302_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	A0A076FFT9	Aureococcus_anophage	27.3	1.1e-17
WP_053478915.1|852598_853936_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.9	1.2e-22
>prophage 78
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	866214	868694	5207802		Bacillus_phage(100.0%)	2	NA	NA
WP_056682752.1|866214_867978_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	5.6e-20
WP_053478928.1|867974_868694_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	1.8e-33
>prophage 79
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	874955	876625	5207802		Bacillus_phage(50.0%)	2	NA	NA
WP_053479307.1|874955_875678_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	65.9	4.6e-37
WP_053478935.1|875881_876625_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	2.6e-19
>prophage 80
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	895084	912389	5207802	plate,portal,tail	Brevibacillus_phage(36.84%)	23	NA	NA
WP_142108092.1|895084_895774_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N6W8I1	Bacillus_phage	43.0	3.2e-56
WP_056682730.1|895859_896099_-	hypothetical protein	NA	A0A0S2SXN3	Bacillus_phage	60.3	1.7e-17
WP_056682727.1|896113_896368_-	hypothetical protein	NA	A0A1B1P887	Bacillus_phage	34.3	6.1e-05
WP_053478951.1|896928_897213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053478952.1|897226_898111_-	hypothetical protein	NA	A0A0P0ZGL7	Escherichia_phage	69.6	2.3e-06
WP_142108093.1|898361_898676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142108094.1|898689_900420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053478955.1|900420_900705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053478956.1|900701_901289_-	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	43.5	1.2e-35
WP_142108095.1|901281_902361_-|plate	baseplate J/gp47 family protein	plate	S5MUH6	Brevibacillus_phage	46.3	3.7e-91
WP_142108096.1|902362_902761_-	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	48.1	6.0e-23
WP_142108097.1|902763_903093_-	DUF2577 family protein	NA	S5M5M4	Brevibacillus_phage	50.0	3.9e-20
WP_142108098.1|903094_904060_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	54.3	1.7e-103
WP_142108099.1|904069_904729_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2CNM3	Brevibacillus_phage	48.4	4.9e-54
WP_142108100.1|904728_906858_-	tape measure protein	NA	S6AVU8	Thermus_phage	34.9	1.2e-74
WP_082631672.1|906939_907128_-	hypothetical protein	NA	Q708L8	Streptococcus_phage	48.9	5.9e-05
WP_142108101.1|907127_907523_-|portal	phage portal protein	portal	A0A0A8WJT4	Clostridium_phage	42.5	7.3e-21
WP_053478964.1|907536_907998_-|tail	phage tail tube protein	tail	S5M5L5	Brevibacillus_phage	70.9	6.2e-56
WP_142108102.1|907999_909316_-|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	54.6	7.8e-128
WP_053478966.1|909478_909904_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	45.5	1.7e-23
WP_056682704.1|910781_911240_-	helix-turn-helix domain-containing protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	55.3	5.6e-41
WP_142108103.1|911495_911936_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	44.5	3.1e-28
WP_053478969.1|911954_912389_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	56.1	1.4e-41
>prophage 81
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	923163	928253	5207802		Lactobacillus_phage(50.0%)	4	NA	NA
WP_056682691.1|923163_924846_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.8	2.1e-29
WP_142108107.1|925073_925685_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142108108.1|925716_926550_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_056682686.1|926540_928253_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.5	3.5e-11
>prophage 82
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	933132	935055	5207802		Tupanvirus(100.0%)	1	NA	NA
WP_142108112.1|933132_935055_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	1.0e-51
>prophage 83
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	943408	944371	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_053478996.1|943408_944371_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	3.1e-25
>prophage 84
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	951820	956896	5207802		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_142108119.1|951820_954877_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	32.1	1.5e-145
WP_142108120.1|955294_956896_-	aminotransferase class V-fold PLP-dependent enzyme	NA	E3SN07	Prochlorococcus_phage	30.0	2.8e-47
>prophage 85
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	965557	967237	5207802		Enterobacteria_phage(100.0%)	1	NA	NA
WP_142108124.1|965557_967237_-	HAMP domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	27.4	1.4e-17
>prophage 86
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	974456	975836	5207802		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_056682606.1|974456_975836_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	36.1	1.4e-74
>prophage 87
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	980840	981968	5207802		Oenococcus_phage(100.0%)	1	NA	NA
WP_142108126.1|980840_981968_-	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.7	3.1e-16
>prophage 88
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	990295	992221	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_053479030.1|990295_992221_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.9	1.6e-124
>prophage 89
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	999956	1000865	5207802		Escherichia_phage(100.0%)	1	NA	NA
WP_053479037.1|999956_1000865_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	31.2	1.9e-19
>prophage 90
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1007129	1007453	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053479043.1|1007129_1007453_+	helix-turn-helix domain-containing protein	NA	Q786F1	Bacillus_phage	36.5	2.4e-06
>prophage 91
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1012319	1016376	5207802		Cronobacter_phage(50.0%)	3	NA	NA
WP_053479050.1|1012319_1013873_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A060AMH2	Cronobacter_phage	36.5	9.9e-05
WP_142108128.1|1014103_1015099_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_056687053.1|1015119_1016376_-	diaminopimelate decarboxylase	NA	M1H5Z4	Paramecium_bursaria_Chlorella_virus	22.9	4.7e-13
>prophage 92
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1020867	1023433	5207802		Escherichia_phage(50.0%)	3	NA	NA
WP_053479057.1|1020867_1021902_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.0	7.1e-76
WP_053479058.1|1021986_1022490_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053479059.1|1022521_1023433_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.9	7.1e-104
>prophage 93
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1032071	1039738	5207802		Streptococcus_phage(33.33%)	7	NA	NA
WP_075209083.1|1032071_1032818_-	hypothetical protein	NA	A0A1X9I5E1	Streptococcus_phage	28.4	1.5e-11
WP_142108995.1|1032852_1033971_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_053479069.1|1034183_1036010_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	29.7	2.6e-20
WP_053479070.1|1036364_1037357_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_056682570.1|1037541_1037883_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053479072.1|1038065_1038662_-	sugar transferase	NA	NA	NA	NA	NA
WP_053479073.1|1038703_1039738_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.1	4.8e-96
>prophage 94
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1047313	1051263	5207802		Catovirus(50.0%)	2	NA	NA
WP_142108132.1|1047313_1048807_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	41.1	1.1e-96
WP_142108133.1|1049073_1051263_-	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	25.4	5.8e-27
>prophage 95
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1059410	1060049	5207802		Moumouvirus(100.0%)	1	NA	NA
WP_053479088.1|1059410_1060049_+	Bax inhibitor-1/YccA family protein	NA	H2EF23	Moumouvirus	31.0	1.7e-06
>prophage 96
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1071941	1073825	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_056682537.1|1071941_1073825_-	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	32.2	1.5e-55
>prophage 97
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1082443	1083583	5207802		Klosneuvirus(100.0%)	1	NA	NA
WP_053479107.1|1082443_1083583_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	35.3	4.6e-52
>prophage 98
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1090173	1090716	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_053479115.1|1090173_1090716_+	GNAT family N-acetyltransferase	NA	A0A0N9SKF6	Staphylococcus_phage	44.4	1.1e-38
>prophage 99
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1094333	1101297	5207802	protease	Synechococcus_phage(33.33%)	6	NA	NA
WP_053479119.1|1094333_1095338_-	zinc-binding dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.8	6.6e-10
WP_053479120.1|1095528_1096701_+	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
WP_142108997.1|1096700_1098035_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_053479122.1|1098100_1098301_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	53.8	1.1e-12
WP_142108136.1|1098616_1099414_+	sporulation protein YunB	NA	NA	NA	NA	NA
WP_056682513.1|1099455_1101297_-|protease	M6 family metalloprotease domain-containing protein	protease	A0A1L2BY89	Clostridium_phage	24.0	9.3e-10
>prophage 100
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1119207	1127792	5207802		Streptococcus_phage(20.0%)	7	NA	NA
WP_053479315.1|1119207_1120404_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	43.3	3.1e-75
WP_056682506.1|1120815_1122297_+	sodium/proline symporter PutP	NA	A0A219Y9P9	Aeromonas_phage	27.7	4.4e-10
WP_142108138.1|1122363_1123230_-	foldase	NA	NA	NA	NA	NA
WP_056682500.1|1123250_1124465_-	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	31.1	5.9e-13
WP_056682497.1|1124635_1125400_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142108139.1|1125706_1127170_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	25.4	5.5e-13
WP_053479148.1|1127108_1127792_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	8.4e-41
>prophage 101
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1131576	1133313	5207802		Planktothrix_phage(100.0%)	1	NA	NA
WP_142108140.1|1131576_1133313_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	7.9e-19
>prophage 102
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1138417	1139401	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_053479157.1|1138417_1139401_-	GMP reductase	NA	G3MBI2	Bacillus_virus	85.3	4.4e-160
>prophage 103
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1145413	1146376	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_142108144.1|1145413_1146376_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.8	8.8e-20
>prophage 104
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1156180	1165555	5207802		Bacillus_phage(80.0%)	8	NA	NA
WP_056687045.1|1156180_1157998_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.7	4.1e-58
WP_142108149.1|1157984_1159730_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	26.6	1.8e-42
WP_142108150.1|1159857_1160631_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	43.9	4.4e-30
WP_142109000.1|1161011_1161140_-	FbpB family small basic protein	NA	NA	NA	NA	NA
WP_053479176.1|1161653_1162139_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_053479177.1|1162655_1163330_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	3.2e-32
WP_053479178.1|1163317_1164517_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_142108151.1|1164655_1165555_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	36.4	1.3e-28
>prophage 105
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1169307	1170444	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_142108155.1|1169307_1170444_+	SpoIIE family protein phosphatase	NA	W8CYM9	Bacillus_phage	30.9	4.4e-10
>prophage 106
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1177193	1181549	5207802	integrase	Streptococcus_phage(50.0%)	3	1169470:1169489	1178959:1178978
1169470:1169489	attL	TTAATGGATATTATGATGCC	NA	NA	NA	NA
WP_053479192.1|1177193_1177757_-|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	41.9	5.3e-33
WP_082620753.1|1177876_1178707_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_142108157.1|1178762_1181549_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	31.0	1.3e-42
1178959:1178978	attR	GGCATCATAATATCCATTAA	NA	NA	NA	NA
>prophage 107
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1184792	1190090	5207802	tRNA	Escherichia_phage(33.33%)	5	NA	NA
WP_142108159.1|1184792_1186451_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.2	4.4e-176
WP_053479197.1|1186490_1186841_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_053479198.1|1186840_1187281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142108160.1|1187457_1188993_+	tellurium resistance protein TerD	NA	A0A0S4KZ16	Pseudomonas_phage	31.4	9.8e-13
WP_142108161.1|1189127_1190090_+	D-2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	27.2	2.7e-21
>prophage 108
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1193914	1199599	5207802		Lactobacillus_phage(50.0%)	6	NA	NA
WP_053479205.1|1193914_1195087_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.0	9.4e-32
WP_053479322.1|1195083_1195740_-	protein xpaC	NA	NA	NA	NA	NA
WP_053479206.1|1196007_1196223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142108164.1|1196290_1197436_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_056682392.1|1197644_1198025_+	SET domain-containing protein	NA	NA	NA	NA	NA
WP_053479209.1|1198072_1199599_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	29.5	2.5e-24
>prophage 109
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1204246	1205224	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_142108166.1|1204246_1205224_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	56.4	3.1e-89
>prophage 110
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1230606	1231524	5207802		Bordetella_phage(100.0%)	1	NA	NA
WP_075209077.1|1230606_1231524_-	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	35.4	1.8e-06
>prophage 111
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1239430	1239931	5207802		Enterobacteria_phage(100.0%)	1	NA	NA
WP_053479242.1|1239430_1239931_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	38.4	2.4e-21
>prophage 112
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1245586	1260218	5207802		Bacillus_phage(33.33%)	10	NA	NA
WP_082446481.1|1245586_1246423_-	heme ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.9	6.3e-14
WP_053479249.1|1246426_1247467_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.2	4.0e-18
WP_053479250.1|1247463_1248468_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_082446480.1|1249123_1249459_+	hypothetical protein	NA	A0A1P8CWK6	Bacillus_phage	83.8	3.4e-11
WP_142108171.1|1249545_1250919_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_053479254.1|1251389_1251911_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_142108172.1|1252154_1256102_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	34.5	3.3e-20
WP_053479256.1|1256837_1257431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142108173.1|1257637_1259017_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.2	5.0e-117
WP_053479258.1|1259273_1260218_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.4	2.6e-24
>prophage 113
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1270331	1271180	5207802		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_053479271.1|1270331_1271180_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	2.9e-14
>prophage 114
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1281447	1285704	5207802		Ralstonia_phage(50.0%)	2	NA	NA
WP_142108178.1|1281447_1283454_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	41.7	1.2e-135
WP_053479281.1|1283478_1285704_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.4	2.4e-137
>prophage 115
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1292038	1303880	5207802		Prochlorococcus_phage(25.0%)	11	NA	NA
WP_053479288.1|1292038_1293574_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	2.9e-73
WP_053479289.1|1293570_1294155_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	34.6	2.0e-22
WP_053479290.1|1294151_1295189_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	43.9	1.8e-66
WP_056682314.1|1295437_1296853_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	6.0e-49
WP_142108179.1|1296837_1299054_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	6.7e-164
WP_053479293.1|1299037_1299724_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_053479294.1|1299720_1299975_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_053479295.1|1299962_1300688_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	46.5	1.4e-49
WP_142108180.1|1300954_1302247_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	24.9	1.3e-18
WP_053479328.1|1302250_1303399_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_053479297.1|1303391_1303880_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.7	1.4e-21
>prophage 116
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1310773	1316419	5207802		Vibrio_phage(33.33%)	3	NA	NA
WP_053478143.1|1310773_1312837_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	47.9	1.0e-09
WP_053478142.1|1313036_1314365_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.3	2.1e-48
WP_053478141.1|1314865_1316419_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.9	1.4e-19
>prophage 117
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1333761	1336479	5207802		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_053478121.1|1333761_1335297_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	25.3	1.7e-41
WP_053478120.1|1335720_1336479_-	glucose 1-dehydrogenase	NA	A0A2P1ELN2	Moumouvirus	27.7	3.1e-12
>prophage 118
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1343986	1345123	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_142108186.1|1343986_1345123_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	2.1e-28
>prophage 119
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1357733	1360638	5207802		Bacillus_phage(66.67%)	3	NA	NA
WP_142108191.1|1357733_1358831_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	9.7e-23
WP_142109003.1|1358827_1359550_-	response regulator	NA	W8CYM9	Bacillus_phage	31.4	4.1e-30
WP_053478104.1|1359702_1360638_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	49.8	3.7e-47
>prophage 120
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1368124	1376012	5207802	tRNA,protease	uncultured_virus(50.0%)	8	NA	NA
WP_053478085.1|1368124_1369759_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.7	7.6e-157
WP_053478084.1|1369822_1370107_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	2.2e-19
WP_053478083.1|1370405_1371137_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_053478082.1|1371133_1371340_+	YdiK family protein	NA	NA	NA	NA	NA
WP_053478081.1|1371375_1372032_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_053478080.1|1372058_1372547_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_053478079.1|1372693_1374616_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.2	4.0e-56
WP_053478078.1|1374986_1376012_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.6	3.8e-69
>prophage 121
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1384578	1390122	5207802		Bacillus_phage(66.67%)	7	NA	NA
WP_053477854.1|1384578_1385049_-	SprT family protein	NA	U5J9G1	Bacillus_phage	25.3	6.7e-05
WP_142108194.1|1385137_1385251_+	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_142108195.1|1385640_1387818_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_142108196.1|1387955_1388741_-	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	32.3	1.5e-22
WP_142108197.1|1388718_1389192_-	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_056682040.1|1389188_1389521_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_009336311.1|1389771_1390122_-	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	2.6e-14
>prophage 122
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1394486	1403416	5207802		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_053477864.1|1394486_1395485_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.5	6.4e-13
WP_056682038.1|1395714_1397136_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_053477866.1|1397128_1397608_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_053477867.1|1397725_1399213_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	2.2e-62
WP_142108199.1|1399574_1400270_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_142108200.1|1400388_1401603_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_056682022.1|1401595_1402528_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	1.3e-20
WP_053477948.1|1402552_1403416_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	1.2e-15
>prophage 123
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1407802	1414600	5207802		Streptococcus_phage(40.0%)	6	NA	NA
WP_053477874.1|1407802_1409755_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.2	9.5e-130
WP_053477875.1|1410009_1411467_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	59.4	5.2e-149
WP_082446782.1|1411687_1412086_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	33.6	2.9e-09
WP_053477877.1|1412215_1412629_-	VOC family protein	NA	NA	NA	NA	NA
WP_053477878.1|1412741_1413605_-	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	27.8	5.1e-27
WP_082446474.1|1413682_1414600_-	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	60.0	8.9e-38
>prophage 124
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1424349	1425819	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_056687027.1|1424349_1425819_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.3	4.5e-15
>prophage 125
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1433191	1441678	5207802		Clostridium_phage(40.0%)	9	NA	NA
WP_053477897.1|1433191_1433629_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	50.7	5.2e-36
WP_053477898.1|1433781_1434408_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_053477899.1|1434644_1435688_-	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053477900.1|1435951_1436719_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.1	3.3e-17
WP_053477901.1|1436715_1437672_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_053477902.1|1437658_1438615_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	48.7	4.3e-83
WP_053477953.1|1438916_1439702_-	serine hydrolase	NA	NA	NA	NA	NA
WP_053477903.1|1439707_1440718_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	34.1	8.7e-10
WP_053477904.1|1440736_1441678_-	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	34.7	3.2e-14
>prophage 126
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1445548	1446547	5207802		Planktothrix_phage(100.0%)	1	NA	NA
WP_053477908.1|1445548_1446547_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	6.6e-18
>prophage 127
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1460481	1461756	5207802		Microcystis_phage(100.0%)	1	NA	NA
WP_053477920.1|1460481_1461756_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A075BS18	Microcystis_phage	44.6	8.9e-20
>prophage 128
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1468799	1470650	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_053477927.1|1468799_1470650_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	26.7	5.4e-34
>prophage 129
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1473999	1474902	5207802		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_053477933.1|1473999_1474902_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	1.5e-13
>prophage 130
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1480644	1481415	5207802		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_053477939.1|1480644_1481415_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	35.9	3.3e-17
>prophage 131
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1486029	1489610	5207802		Bacillus_phage(100.0%)	2	NA	NA
WP_053477944.1|1486029_1487889_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.9	1.8e-53
WP_053477945.1|1487885_1489610_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	9.5e-49
>prophage 132
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1501992	1502910	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_053478165.1|1501992_1502910_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.2	1.1e-22
>prophage 133
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1511185	1513777	5207802		Ectocarpus_siliculosus_virus(50.0%)	3	NA	NA
WP_053478219.1|1511185_1512085_-	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.7	2.2e-09
WP_142108207.1|1512105_1512861_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_053478175.1|1512853_1513777_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	46.7	1.3e-44
>prophage 134
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1518513	1519401	5207802		Lactobacillus_phage(100.0%)	1	NA	NA
WP_053478179.1|1518513_1519401_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	1.8e-11
>prophage 135
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1527162	1528059	5207802		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_056681985.1|1527162_1528059_+	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.0	4.6e-55
>prophage 136
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1534389	1535955	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_053478194.1|1534389_1535955_+	Vga family ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	38.7	3.5e-66
>prophage 137
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1545124	1545826	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053478223.1|1545124_1545826_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.7	1.6e-23
>prophage 138
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1594134	1598079	5207802		Bacillus_phage(66.67%)	4	NA	NA
WP_056681922.1|1594134_1594716_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.3	2.0e-11
WP_053478054.1|1594844_1595924_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_053478053.1|1595929_1597381_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.5	2.7e-20
WP_053478052.1|1597377_1598079_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	1.3e-25
>prophage 139
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1613785	1615555	5207802		Enterobacteria_phage(100.0%)	1	NA	NA
WP_142108222.1|1613785_1615555_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.7	3.7e-72
>prophage 140
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1623424	1633870	5207802		Bacillus_phage(50.0%)	7	NA	NA
WP_056681881.1|1623424_1625161_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	6.0e-51
WP_056681878.1|1625157_1626900_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	1.5e-49
WP_056681875.1|1627413_1628304_-	DUF2167 domain-containing protein	NA	NA	NA	NA	NA
WP_053478027.1|1628763_1628982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082446470.1|1629266_1630472_+	erythromycin esterase family protein	NA	A0A1B1ISB2	uncultured_Mediterranean_phage	30.4	2.3e-09
WP_056681870.1|1631324_1632605_+	DUF5068 domain-containing protein	NA	NA	NA	NA	NA
WP_056681866.1|1632661_1633870_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	26.1	2.0e-13
>prophage 141
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1637605	1639722	5207802	tRNA	Bacillus_virus(50.0%)	2	NA	NA
WP_053478022.1|1637605_1638409_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	26.3	1.5e-20
WP_053478021.1|1638510_1639722_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	45.4	6.8e-102
>prophage 142
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1644032	1645767	5207802		Staphylococcus_phage(100.0%)	2	NA	NA
WP_053478015.1|1644032_1645331_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	67.5	9.4e-158
WP_142108224.1|1645353_1645767_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	63.6	9.2e-43
>prophage 143
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1649930	1650740	5207802		Indivirus(100.0%)	1	NA	NA
WP_082446467.1|1649930_1650740_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.1	9.4e-15
>prophage 144
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1658934	1664495	5207802	tRNA	Achromobacter_phage(50.0%)	4	NA	NA
WP_053478000.1|1658934_1659249_-	thioredoxin family protein	NA	A0A0K2FIM3	Achromobacter_phage	33.3	3.3e-08
WP_053477999.1|1659454_1660333_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053477998.1|1660329_1661352_+	serine hydrolase	NA	NA	NA	NA	NA
WP_142109005.1|1661432_1664495_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	32.0	1.3e-162
>prophage 145
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1688307	1698154	5207802		Pseudomonas_phage(20.0%)	8	NA	NA
WP_142108229.1|1688307_1689636_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	3.8e-29
WP_053477980.1|1691414_1692140_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.9	1.9e-35
WP_053477979.1|1692213_1693041_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053477978.1|1693055_1693838_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_142108230.1|1694010_1694688_+	response regulator	NA	W8CYM9	Bacillus_phage	36.9	1.4e-32
WP_056681791.1|1694675_1696148_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	23.1	3.6e-12
WP_053477975.1|1696483_1697116_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_142108231.1|1697191_1698154_-	WYL domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	28.2	1.4e-12
>prophage 146
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1706525	1707701	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_142108235.1|1706525_1707701_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	35.3	1.8e-46
>prophage 147
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1716433	1718236	5207802		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_142108241.1|1716433_1718236_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	39.6	1.8e-103
>prophage 148
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1723849	1724746	5207802		Klosneuvirus(100.0%)	1	NA	NA
WP_053477962.1|1723849_1724746_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.9	1.9e-24
>prophage 149
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1740033	1741721	5207802		Bacillus_phage(50.0%)	2	NA	NA
WP_053478239.1|1740033_1740903_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	3.8e-14
WP_053478240.1|1740878_1741721_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.9	2.2e-22
>prophage 150
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1757440	1769639	5207802		Catovirus(25.0%)	7	NA	NA
WP_053478266.1|1757440_1758628_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	29.4	5.1e-09
WP_053478267.1|1758749_1760828_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	29.2	4.6e-66
WP_009336565.1|1760879_1761350_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_053478268.1|1761396_1761819_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_053478269.1|1761921_1762170_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_053478270.1|1762326_1765926_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.1	1.2e-64
WP_053478271.1|1766078_1769639_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.6	6.3e-47
>prophage 151
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1773402	1773936	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_053478276.1|1773402_1773936_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	32.1	5.8e-13
>prophage 152
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1776982	1778386	5207802	tRNA	Catovirus(100.0%)	1	NA	NA
WP_053478282.1|1776982_1778386_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.6	7.7e-57
>prophage 153
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1786323	1788774	5207802		Enterobacteria_phage(100.0%)	1	NA	NA
WP_142108242.1|1786323_1788774_-	AAA domain-containing protein	NA	H6X3M6	Enterobacteria_phage	36.0	5.5e-135
>prophage 154
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1802653	1818434	5207802	tRNA	Tupanvirus(28.57%)	15	NA	NA
WP_075209060.1|1802653_1804144_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.3	1.7e-94
WP_053479385.1|1804356_1805358_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_053479384.1|1805490_1805709_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053479383.1|1805660_1806188_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_053479382.1|1806187_1806550_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_053479381.1|1806542_1807376_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.4	3.3e-23
WP_056681705.1|1807392_1808250_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_053479379.1|1808253_1808847_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.8	1.0e-66
WP_056681702.1|1810457_1811387_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	64.5	1.0e-105
WP_053479376.1|1811578_1812475_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_056681699.1|1812502_1813381_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_053479374.1|1813416_1814247_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_056681695.1|1814338_1816330_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	42.4	2.1e-116
WP_053479372.1|1816476_1817022_-	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	26.7	3.4e-08
WP_056681692.1|1817045_1818434_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	23.9	3.1e-10
>prophage 155
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1828815	1829352	5207802		Paenibacillus_phage(100.0%)	1	NA	NA
WP_053479360.1|1828815_1829352_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 156
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1835402	1837750	5207802		Hokovirus(50.0%)	2	NA	NA
WP_053479355.1|1835402_1836359_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.0	6.0e-45
WP_053479354.1|1836376_1837750_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A1S5V090	Saudi_moumouvirus	30.9	3.0e-29
>prophage 157
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1844802	1856501	5207802	tRNA	Streptococcus_phage(42.86%)	13	NA	NA
WP_142108247.1|1844802_1845984_-	DUF348 domain-containing protein	NA	A0A217ER34	Bacillus_phage	66.7	1.2e-29
WP_053479343.1|1846313_1847081_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_053479342.1|1847569_1849525_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.5	1.3e-102
WP_053479341.1|1850146_1850428_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	71.4	2.9e-16
WP_053479340.1|1850460_1851339_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	46.5	5.3e-64
WP_053479339.1|1851316_1851604_-	GIY-YIG nuclease family protein	NA	A0A1S5YDY6	Mythimna_unipuncta_granulovirus	38.0	8.2e-06
WP_053479338.1|1851593_1852334_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_053479337.1|1852502_1852877_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_053479336.1|1852890_1853718_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_053479335.1|1853710_1854718_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	31.8	3.4e-30
WP_053479334.1|1854730_1855171_-	YaaR family protein	NA	NA	NA	NA	NA
WP_053479333.1|1855197_1855527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053479332.1|1855844_1856501_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	53.4	1.6e-57
>prophage 158
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1865680	1867375	5207802		Clostridium_phage(100.0%)	1	NA	NA
WP_053478151.1|1865680_1867375_-	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	32.8	5.7e-54
>prophage 159
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1870640	1878169	5207802	tRNA	Lactobacillus_virus(25.0%)	6	NA	NA
WP_053478155.1|1870640_1871309_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.3	2.4e-24
WP_056681954.1|1871613_1872894_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.7	1.5e-94
WP_142108250.1|1873279_1873858_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_142108251.1|1873872_1874754_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_142108252.1|1874915_1876277_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.4	1.4e-18
WP_142108253.1|1876705_1878169_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	2.7e-97
>prophage 160
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1886036	1893808	5207802		Bacillus_virus(66.67%)	6	NA	NA
WP_053478297.1|1886036_1888556_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	38.1	1.3e-118
WP_053478819.1|1888838_1890761_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	47.5	9.0e-149
WP_053478298.1|1890869_1891118_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_053478299.1|1891127_1892246_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_053478300.1|1892330_1892543_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_053478301.1|1892671_1893808_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	30.3	3.2e-13
>prophage 161
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1903094	1907413	5207802	protease	Bifidobacterium_phage(25.0%)	5	NA	NA
WP_057768011.1|1903094_1903973_+	nucleoid occlusion protein	NA	I3NLC2	Bifidobacterium_phage	30.9	5.6e-13
WP_053478311.1|1904266_1905028_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.1	8.0e-24
WP_053478312.1|1905020_1905863_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	29.5	1.2e-09
WP_053478313.1|1906017_1906731_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_053478314.1|1906771_1907413_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	35.8	2.6e-20
>prophage 162
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1911580	1914625	5207802		Caldibacillus_phage(50.0%)	3	NA	NA
WP_053478319.1|1911580_1912087_+	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	62.7	5.6e-50
WP_053478822.1|1912137_1912374_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_142108257.1|1912633_1914625_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.2	3.5e-10
>prophage 163
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1918632	1930996	5207802		Bacillus_phage(28.57%)	9	NA	NA
WP_056687003.1|1918632_1919997_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	53.0	1.8e-122
WP_053478325.1|1920263_1921556_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	34.8	3.1e-68
WP_142108258.1|1922383_1923856_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	43.5	4.6e-20
WP_142108259.1|1924065_1924776_+	response regulator	NA	W8CYM9	Bacillus_phage	43.2	1.8e-46
WP_142108260.1|1924785_1926612_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.5	2.6e-36
WP_142108261.1|1926608_1927946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142108262.1|1927932_1928730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142108263.1|1928736_1929531_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	34.5	6.3e-40
WP_142108264.1|1929766_1930996_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	36.5	7.8e-13
>prophage 164
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1935511	1936681	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053478336.1|1935511_1936681_+	ParM/StbA family protein	NA	A0A1B1P792	Bacillus_phage	34.5	1.3e-54
>prophage 165
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1947837	1952980	5207802		Bacillus_phage(66.67%)	4	NA	NA
WP_053478348.1|1947837_1949286_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	36.0	7.0e-61
WP_142108267.1|1949621_1950182_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_053478350.1|1950237_1950924_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	2.1e-36
WP_142108268.1|1950898_1952980_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	1.6e-13
>prophage 166
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1963003	1965004	5207802		Tupanvirus(100.0%)	1	NA	NA
WP_142108271.1|1963003_1965004_-	catalase	NA	A0A2K9L572	Tupanvirus	50.8	3.2e-149
>prophage 167
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1972444	1986008	5207802		Enterobacteria_phage(25.0%)	9	NA	NA
WP_053478365.1|1972444_1973461_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.4	4.8e-24
WP_142108272.1|1973535_1974465_+	ROK family protein	NA	NA	NA	NA	NA
WP_056687342.1|1974480_1975923_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.2	1.3e-46
WP_142108273.1|1975964_1976954_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_053478367.1|1977289_1978519_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_142108274.1|1978807_1980337_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	31.4	7.9e-39
WP_053478369.1|1980350_1980914_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_142108275.1|1981258_1982185_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_142108276.1|1982552_1986008_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	33.5	1.5e-37
>prophage 168
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	1989842	1993894	5207802	transposase	Trichoplusia_ni_ascovirus(33.33%)	4	NA	NA
WP_053478374.1|1989842_1990589_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	2.3e-20
WP_142108277.1|1990703_1992077_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	31.9	8.7e-45
WP_056686949.1|1992196_1992811_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056686945.1|1993144_1993894_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.8	1.0e-31
>prophage 169
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2007698	2008451	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_053478392.1|2007698_2008451_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	5.3e-28
>prophage 170
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2013264	2014412	5207802		Pneumococcus_phage(50.0%)	2	NA	NA
WP_053478397.1|2013264_2013765_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	65.9	2.8e-46
WP_142108280.1|2013779_2014412_+	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	29.3	1.1e-15
>prophage 171
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2030007	2031680	5207802		Streptococcus_phage(50.0%)	2	NA	NA
WP_053478834.1|2030007_2030514_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.0	2.6e-23
WP_142108282.1|2030783_2031680_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.9	3.8e-17
>prophage 172
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2037832	2039338	5207802		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_053478415.1|2037832_2039338_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.0	5.1e-14
>prophage 173
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2047164	2047872	5207802		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_142108285.1|2047164_2047872_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.8	7.9e-10
>prophage 174
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2055963	2058589	5207802		Planktothrix_phage(50.0%)	2	NA	NA
WP_053478431.1|2055963_2056704_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.8	7.2e-30
WP_142109007.1|2056936_2058589_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.9	9.2e-17
>prophage 175
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2063849	2071256	5207802		Acanthocystis_turfacea_Chlorella_virus(20.0%)	8	NA	NA
WP_142108286.1|2063849_2064695_-	ATP-binding cassette domain-containing protein	NA	M1HHI6	Acanthocystis_turfacea_Chlorella_virus	23.2	5.4e-05
WP_053478438.1|2064886_2065939_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.0	3.4e-17
WP_053478439.1|2066029_2066218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053478836.1|2066441_2067251_+	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	48.7	6.8e-74
WP_053478440.1|2067290_2067938_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142108287.1|2068016_2069123_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_056686883.1|2069119_2069842_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.9	5.8e-32
WP_142108288.1|2070089_2071256_-	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	21.4	2.1e-07
>prophage 176
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2076235	2077657	5207802		Hokovirus(100.0%)	1	NA	NA
WP_142108292.1|2076235_2077657_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	26.2	6.7e-16
>prophage 177
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2083723	2086556	5207802		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_056686865.1|2083723_2084731_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.4	1.7e-18
WP_053478454.1|2084795_2086556_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	53.9	1.6e-152
>prophage 178
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2092319	2092991	5207802		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_053478462.1|2092319_2092991_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.2	8.3e-17
>prophage 179
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2102194	2107357	5207802		Bacillus_phage(66.67%)	9	NA	NA
WP_075209261.1|2102194_2102866_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	9.5e-29
WP_142108296.1|2102862_2104215_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	28.8	1.1e-12
WP_056686848.1|2104385_2104814_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_056686845.1|2104836_2105040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056686842.1|2105045_2105426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053478477.1|2105406_2105691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056686838.1|2105687_2105945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053478479.1|2105954_2106200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053478480.1|2106442_2107357_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.3	4.4e-45
>prophage 180
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2127063	2129853	5207802		Bacillus_phage(50.0%)	3	NA	NA
WP_053478499.1|2127063_2127804_-	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	44.6	7.3e-06
WP_053478500.1|2128127_2128352_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_056686823.1|2128551_2129853_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.3	4.0e-23
>prophage 181
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2153418	2158353	5207802		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_053478521.1|2153418_2155023_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.3	3.6e-143
WP_053478522.1|2155186_2155717_-	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_053478523.1|2155930_2156305_+	response regulator	NA	W8CYM9	Bacillus_phage	37.4	4.5e-12
WP_053478524.1|2156528_2157386_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_053478525.1|2157708_2158353_+	fructose-6-phosphate aldolase	NA	A0A0E3FNR2	Synechococcus_phage	47.9	3.2e-50
>prophage 182
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2163790	2164411	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_053478530.1|2163790_2164411_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	44.3	9.6e-36
>prophage 183
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2171871	2181607	5207802		Pandoravirus(25.0%)	9	NA	NA
WP_142108311.1|2171871_2172915_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	43.8	6.8e-66
WP_056686797.1|2173089_2173641_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_056686794.1|2173872_2174325_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_142108312.1|2174339_2175635_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.1	4.7e-08
WP_053478540.1|2175786_2176227_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_056686789.1|2176258_2176834_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_056686786.1|2177004_2178246_+	serine hydroxymethyltransferase	NA	A0A240F2Y9	Aeromonas_phage	53.7	4.8e-103
WP_053478543.1|2178596_2179226_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_056686782.1|2179357_2181607_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	39.9	2.6e-22
>prophage 184
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2207067	2212457	5207802		Pseudomonas_phage(33.33%)	5	NA	NA
WP_142108320.1|2207067_2208105_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	38.1	2.2e-40
WP_142108321.1|2208170_2208590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142108322.1|2208730_2209669_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_142108323.1|2209886_2211590_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.7	2.0e-06
WP_053478845.1|2212184_2212457_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	48.0	4.1e-15
>prophage 185
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2217924	2225167	5207802		Caldibacillus_phage(33.33%)	5	NA	NA
WP_053478582.1|2217924_2218284_+	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	63.2	2.2e-32
WP_142108324.1|2218289_2218469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053478846.1|2219180_2222000_-	DEAD/DEAH box helicase	NA	E7DNC5	Pneumococcus_phage	24.7	8.3e-34
WP_142108325.1|2221992_2223609_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_142108326.1|2224252_2225167_+	WYL domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	27.0	1.2e-10
>prophage 186
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2233186	2233756	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_142108333.1|2233186_2233756_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	66.7	7.5e-51
>prophage 187
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2249771	2251056	5207802		Lactococcus_phage(50.0%)	2	NA	NA
WP_142108341.1|2249771_2250530_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	41.5	1.4e-49
WP_142108342.1|2250786_2251056_-	hypothetical protein	NA	A0A0N7GFG6	Staphylococcus_phage	41.4	7.2e-12
>prophage 188
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2265783	2266809	5207802		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_053478631.1|2265783_2266809_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.7	6.7e-18
>prophage 189
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2277388	2279789	5207802		Bacillus_virus(50.0%)	3	NA	NA
WP_082446748.1|2277388_2277940_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	42.9	3.0e-33
WP_056686667.1|2278020_2278446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053478646.1|2278733_2279789_-	peptidoglycan endopeptidase	NA	A0A0A7NU10	Lactobacillus_phage	37.7	1.8e-18
>prophage 190
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2294308	2301136	5207802		Planktothrix_phage(100.0%)	6	NA	NA
WP_142108365.1|2294308_2295334_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.2	9.1e-15
WP_142108366.1|2295308_2296295_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.5e-17
WP_142108367.1|2296368_2297520_+	amidohydrolase	NA	NA	NA	NA	NA
WP_142108368.1|2297558_2298668_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_056686651.1|2299127_2300120_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	7.5e-14
WP_053478664.1|2300116_2301136_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	2.9e-21
>prophage 191
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2319731	2321240	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_142108372.1|2319731_2321240_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.0	1.3e-12
>prophage 192
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2326568	2327918	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_142108377.1|2326568_2327918_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	36.2	2.0e-22
>prophage 193
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2333375	2334446	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_142108380.1|2333375_2334446_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.5	5.9e-25
>prophage 194
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2342977	2343691	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_142108382.1|2342977_2343691_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	3.7e-31
>prophage 195
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2361865	2370929	5207802		Cedratvirus(33.33%)	5	NA	NA
WP_056686588.1|2361865_2363728_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A285PXS3	Cedratvirus	24.9	1.7e-22
WP_082620733.1|2364070_2365210_+	glucosaminidase domain-containing protein	NA	H7BVK7	unidentified_phage	47.0	2.6e-39
WP_053478706.1|2365414_2366077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056686585.1|2366092_2367304_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_142108386.1|2367473_2370929_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	37.6	4.9e-44
>prophage 196
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2375753	2376461	5207802		Clostridium_phage(100.0%)	1	NA	NA
WP_053478710.1|2375753_2376461_+	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	39.0	1.2e-13
>prophage 197
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2381442	2385729	5207802		Bathycoccus_sp._RCC1105_virus(50.0%)	4	NA	NA
WP_142108388.1|2381442_2382555_+	aminotransferase class V-fold PLP-dependent enzyme	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.8	1.2e-39
WP_053478715.1|2382654_2383398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053478716.1|2383390_2384401_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_053478717.1|2384415_2385729_+	nucleotide sugar dehydrogenase	NA	M1HKZ1	Paramecium_bursaria_Chlorella_virus	33.2	2.3e-42
>prophage 198
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2389719	2390778	5207802		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_053478721.1|2389719_2390778_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	38.5	7.8e-62
>prophage 199
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2394444	2403494	5207802		Bacillus_phage(25.0%)	7	NA	NA
WP_053478725.1|2394444_2395308_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.1	5.2e-80
WP_142108393.1|2395321_2396563_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_142108394.1|2397141_2398464_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	26.3	3.4e-14
WP_053478728.1|2398465_2399161_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_082446869.1|2399337_2401329_-	SH3 domain-containing protein	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	46.0	3.0e-30
WP_053478729.1|2401653_2402691_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_053478730.1|2402855_2403494_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	42.3	1.1e-34
>prophage 200
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2407211	2409802	5207802		Staphylococcus_phage(50.0%)	2	NA	NA
WP_142109015.1|2407211_2408054_+	DegV family EDD domain-containing protein	NA	A0A0N9SI50	Staphylococcus_phage	35.9	1.2e-17
WP_142108396.1|2408305_2409802_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	38.6	2.6e-71
>prophage 201
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2425971	2430490	5207802		Enterobacteria_phage(75.0%)	5	NA	NA
WP_142108399.1|2425971_2426718_+	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	44.2	1.9e-54
WP_142108400.1|2426729_2427275_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.8	2.6e-37
WP_142108401.1|2427287_2428301_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.8	5.4e-76
WP_142108402.1|2428297_2429170_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_142108403.1|2429428_2430490_+	glycosyltransferase	NA	S5WBE2	Pseudomonas_phage	25.8	6.8e-05
>prophage 202
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2445412	2454019	5207802		Bacillus_virus(50.0%)	9	NA	NA
WP_056686518.1|2445412_2446279_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	36.3	2.6e-39
WP_056686515.1|2446330_2446684_+	cytochrome c	NA	NA	NA	NA	NA
WP_053478769.1|2447167_2447854_+	cell division ATP-binding protein FtsE	NA	G3M9Y6	Bacillus_virus	28.3	9.1e-19
WP_053478770.1|2447843_2448737_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_142108410.1|2449062_2450514_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	27.7	7.3e-18
WP_082620737.1|2450816_2451587_+	DUF364 domain-containing protein	NA	NA	NA	NA	NA
WP_053478773.1|2451606_2452179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142108411.1|2452199_2453231_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_053478775.1|2453227_2454019_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	3.3e-12
>prophage 203
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2467742	2468573	5207802		Rhizobium_phage(100.0%)	1	NA	NA
WP_142108418.1|2467742_2468573_+	HNH endonuclease	NA	B4UTX2	Rhizobium_phage	52.5	3.1e-05
>prophage 204
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2483664	2486432	5207802		Bacillus_phage(66.67%)	3	NA	NA
WP_142109019.1|2483664_2484366_+	response regulator	NA	W8CYM9	Bacillus_phage	35.4	6.6e-33
WP_142108428.1|2484367_2485303_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.6	3.1e-22
WP_142108429.1|2485508_2486432_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.7	2.0e-45
>prophage 205
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2489457	2494877	5207802		uncultured_virus(50.0%)	3	NA	NA
WP_142108430.1|2489457_2491872_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	39.3	6.1e-118
WP_142108431.1|2492302_2493226_+	EamA family transporter	NA	NA	NA	NA	NA
WP_142108432.1|2493845_2494877_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	4.4e-33
>prophage 206
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2501128	2504008	5207802		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_142108434.1|2501128_2504008_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	0.0e+00
>prophage 207
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2520795	2534377	5207802	integrase	Streptococcus_phage(25.0%)	11	2524984:2525001	2533475:2533492
WP_053478809.1|2520795_2521746_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	54.9	5.7e-88
WP_053478810.1|2522258_2522717_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_142108440.1|2522822_2523716_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.4	2.6e-05
WP_053478812.1|2523712_2524693_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	39.4	9.5e-62
WP_053478813.1|2524863_2525805_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	1.7e-52
2524984:2525001	attL	AAATTAATCGTTGATATT	NA	NA	NA	NA
WP_053478867.1|2525840_2526098_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_053478814.1|2526279_2526885_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.2e-54
WP_142108441.1|2527317_2527875_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	34.3	3.4e-16
WP_142108442.1|2529502_2529766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053477617.1|2530585_2532409_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	37.0	3.7e-27
WP_053478818.1|2533465_2534377_+	hypothetical protein	NA	A0A172JIA8	Bacillus_phage	59.6	1.0e-65
2533475:2533492	attR	AAATTAATCGTTGATATT	NA	NA	NA	NA
>prophage 208
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2541293	2543300	5207802		Aeribacillus_phage(33.33%)	3	NA	NA
WP_053477622.1|2541293_2541512_+	hypothetical protein	NA	A0A1L2JZ89	Aeribacillus_phage	45.1	8.6e-08
WP_053477623.1|2541514_2541754_+	hypothetical protein	NA	A0A0C5ABD9	Paenibacillus_phage	55.7	6.8e-14
WP_053477624.1|2542322_2543300_-	exonuclease	NA	A0A2I6PEZ7	Staphylococcus_phage	30.5	1.2e-29
>prophage 209
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2551356	2558320	5207802		Streptococcus_phage(33.33%)	6	NA	NA
WP_053477632.1|2551356_2552652_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	73.3	1.2e-176
WP_056686402.1|2552807_2553767_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_053477634.1|2553917_2554151_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_053477635.1|2554262_2555009_+	carboxylesterase	NA	NA	NA	NA	NA
WP_142108446.1|2555030_2557379_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.2	2.4e-87
WP_053477637.1|2557852_2558320_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	66.0	3.4e-49
>prophage 210
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2566874	2568524	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_142108453.1|2566874_2568524_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.3	3.7e-26
>prophage 211
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2587720	2590498	5207802		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_053477657.1|2587720_2588446_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.9	1.4e-22
WP_082446718.1|2588446_2588956_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_053477659.1|2588921_2589356_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053477660.1|2590177_2590498_+	hypothetical protein	NA	A0A2H4JA12	uncultured_Caudovirales_phage	66.4	9.7e-32
>prophage 212
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2640771	2645399	5207802		Bacillus_phage(66.67%)	5	NA	NA
WP_056686239.1|2640771_2641479_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	2.9e-28
WP_142108484.1|2641480_2642542_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_142108485.1|2642468_2643287_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_142108486.1|2643342_2644026_-	response regulator	NA	W8CYM9	Bacillus_phage	33.9	2.6e-34
WP_142108487.1|2644022_2645399_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.3	7.1e-39
>prophage 213
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2652603	2653392	5207802		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_142108491.1|2652603_2653392_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	25.0	4.7e-11
>prophage 214
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2656760	2657780	5207802		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_142108492.1|2656760_2657780_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	23.5	7.9e-11
>prophage 215
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2662873	2666281	5207802		Hokovirus(100.0%)	1	NA	NA
WP_142108497.1|2662873_2666281_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	29.4	4.8e-36
>prophage 216
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2677935	2679711	5207802		Planktothrix_phage(50.0%)	3	NA	NA
WP_053477739.1|2677935_2678670_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.7	6.1e-37
WP_142108501.1|2678716_2678917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056686184.1|2678976_2679711_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	26.1	5.0e-15
>prophage 217
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2692628	2693459	5207802		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_053477752.1|2692628_2693459_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.4e-10
>prophage 218
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2700954	2701314	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_053477757.1|2700954_2701314_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	53.0	8.9e-26
>prophage 219
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2706989	2708015	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_142109032.1|2706989_2708015_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.7	8.5e-29
>prophage 220
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2712521	2716773	5207802		environmental_halophage(33.33%)	4	NA	NA
WP_053477770.1|2712521_2713751_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.4	1.4e-115
WP_053477771.1|2713740_2714172_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2P1CJL8	Mycobacterium_phage	37.3	6.5e-15
WP_053477772.1|2714267_2715665_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_053477773.1|2715933_2716773_+	DUF72 domain-containing protein	NA	A0A1S5XY79	Kurlavirus	26.3	1.7e-14
>prophage 221
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2723171	2724660	5207802		Staphylococcus_phage(50.0%)	2	NA	NA
WP_056686142.1|2723171_2723960_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	1.4e-15
WP_053477780.1|2723952_2724660_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.1	9.1e-14
>prophage 222
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2732041	2732542	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_053477789.1|2732041_2732542_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.2	4.4e-39
>prophage 223
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2737226	2737466	5207802		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_053477794.1|2737226_2737466_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	44.4	8.6e-09
>prophage 224
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2741074	2750102	5207802	transposase	Streptococcus_phage(40.0%)	9	NA	NA
WP_053477799.1|2741074_2741437_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	45.5	2.0e-17
WP_053477800.1|2741562_2742558_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	51.6	8.0e-32
WP_056686124.1|2742933_2744151_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053477803.1|2744616_2744940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142108277.1|2745051_2746425_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	31.9	8.7e-45
WP_053477804.1|2746695_2747412_+	3D domain-containing protein	NA	A0A127AW72	Bacillus_phage	40.0	1.4e-14
WP_053477805.1|2747498_2747975_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_053477806.1|2748155_2748533_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_056686121.1|2748593_2750102_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.0	3.7e-57
>prophage 225
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2756669	2758100	5207802	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_075209219.1|2756669_2758100_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	42.2	1.9e-103
>prophage 226
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2771553	2772102	5207802		Adoxophyes_honmai_entomopoxvirus(100.0%)	1	NA	NA
WP_053477830.1|2771553_2772102_+	superoxide dismutase family protein	NA	R4ZEQ5	Adoxophyes_honmai_entomopoxvirus	31.9	8.9e-09
>prophage 227
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2782759	2783758	5207802		Lactobacillus_phage(100.0%)	1	NA	NA
WP_142108513.1|2782759_2783758_-	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	47.2	8.3e-05
>prophage 228
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2802259	2856127	5207802	bacteriocin,integrase,transposase	Streptococcus_phage(27.27%)	37	2810178:2810195	2869376:2869393
WP_053474535.1|2802259_2806678_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	35.7	2.1e-23
WP_053474536.1|2807530_2807926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053474537.1|2808322_2810056_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.2	1.1e-09
2810178:2810195	attL	TAAAAATCTTACTAACAT	NA	NA	NA	NA
WP_075209216.1|2810648_2810948_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_142108521.1|2811104_2813060_+|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
WP_142108522.1|2813056_2815003_+	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_142108523.1|2815024_2816602_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_142109036.1|2817238_2817586_+|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	52.1	1.7e-26
WP_082446685.1|2817966_2818347_+	hypothetical protein	NA	J7KJ21	Streptococcus_phage	40.8	8.9e-08
WP_075209214.1|2818403_2818577_-	putative motility protein	NA	NA	NA	NA	NA
WP_142108524.1|2819201_2821025_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	37.0	3.7e-27
WP_053474544.1|2821267_2821837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053474545.1|2822020_2822419_-	RidA family protein	NA	NA	NA	NA	NA
WP_082446683.1|2822605_2823073_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N9SIX5	Staphylococcus_phage	59.8	1.1e-23
WP_142109038.1|2826686_2826773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142109040.1|2827093_2827969_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_142108525.1|2828082_2828457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053474550.1|2829095_2829926_+	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	36.0	3.6e-38
WP_142108526.1|2830608_2831937_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	1.9e-25
WP_142108527.1|2832168_2832399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053478227.1|2832739_2833660_+	phosphotransferase	NA	NA	NA	NA	NA
WP_142108528.1|2833814_2834720_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.6e-45
WP_142108529.1|2834695_2834986_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053474552.1|2835815_2837261_+	carboxylic ester hydrolase	NA	NA	NA	NA	NA
WP_053474553.1|2837999_2838857_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053474554.1|2838977_2840414_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_053474555.1|2840906_2841101_+	DUF4017 family protein	NA	NA	NA	NA	NA
WP_053474556.1|2841214_2841457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053474557.1|2841685_2842528_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_053474558.1|2844796_2844997_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	5.3e-20
WP_142108530.1|2845559_2846156_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142108531.1|2846169_2847246_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_053474560.1|2847643_2847985_-	DoxX family protein	NA	NA	NA	NA	NA
WP_053474561.1|2848102_2848816_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_053474562.1|2852226_2852664_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053474563.1|2853035_2854223_+	MFS transporter	NA	NA	NA	NA	NA
WP_142108532.1|2854753_2856127_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	31.8	3.0e-45
2869376:2869393	attR	TAAAAATCTTACTAACAT	NA	NA	NA	NA
>prophage 229
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2862664	2862949	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053474568.1|2862664_2862949_+	hypothetical protein	NA	L0L8J8	Bacillus_phage	60.9	9.2e-26
>prophage 230
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2869890	2871062	5207802	integrase	uncultured_Caudovirales_phage(50.0%)	2	2866451:2866469	2878310:2878328
2866451:2866469	attL	GTGCTTTTTCTTTTGCCCA	NA	NA	NA	NA
WP_142109041.1|2869890_2870283_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	66.7	5.7e-34
WP_142108537.1|2870519_2871062_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6D2	Bacillus_phage	54.1	2.8e-47
2878310:2878328	attR	GTGCTTTTTCTTTTGCCCA	NA	NA	NA	NA
>prophage 231
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2875851	2882298	5207802	integrase	Bacillus_phage(42.86%)	10	2872908:2872923	2886757:2886772
2872908:2872923	attL	TAGATGAAAATTGTAA	NA	NA	NA	NA
WP_053474582.1|2875851_2876037_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	58.1	1.3e-12
WP_142108539.1|2876682_2876862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142108540.1|2877118_2877598_+	DUF2321 domain-containing protein	NA	U3PDZ3	Staphylococcus_phage	41.1	1.0e-29
WP_142108541.1|2877912_2878305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082446675.1|2878366_2878786_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	59.1	1.2e-29
WP_082446673.1|2878881_2879220_-	YolD-like family protein	NA	O64030	Bacillus_phage	44.3	2.8e-21
WP_053474588.1|2879315_2879534_+	hypothetical protein	NA	A0A1L2JZ89	Aeribacillus_phage	45.1	6.0e-09
WP_142108542.1|2879536_2879776_+	YolD-like family protein	NA	A0A0C5ABD9	Paenibacillus_phage	55.7	8.9e-14
WP_053474590.1|2880328_2880616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142108543.1|2881143_2882298_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	34.1	1.1e-43
2886757:2886772	attR	TAGATGAAAATTGTAA	NA	NA	NA	NA
>prophage 232
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2887149	2889173	5207802		Bacillus_phage(50.0%)	3	NA	NA
WP_142108551.1|2887149_2887902_+	serine/threonine protein phosphatase	NA	A0A127AVW0	Bacillus_phage	42.2	1.7e-42
WP_142108552.1|2888171_2888357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142108553.1|2888567_2889173_+	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	32.8	4.5e-14
>prophage 233
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2895067	2895262	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_142108562.1|2895067_2895262_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	40.4	1.1e-06
>prophage 234
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2901784	2903209	5207802		Mycobacterium_phage(100.0%)	1	NA	NA
WP_142108569.1|2901784_2903209_+	serine hydrolase	NA	A0A1J0GRK9	Mycobacterium_phage	25.9	2.2e-14
>prophage 235
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2916414	2918403	5207802		Planktothrix_phage(100.0%)	1	NA	NA
WP_075209211.1|2916414_2918403_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	2.2e-17
>prophage 236
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2921719	2922415	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_053474615.1|2921719_2922415_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	34.0	9.8e-13
>prophage 237
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2938495	2940895	5207802		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_142108579.1|2938495_2940895_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.7e-11
>prophage 238
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2948097	2955774	5207802		Staphylococcus_phage(75.0%)	12	NA	NA
WP_056686059.1|2948097_2949597_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.6	2.2e-70
WP_075209209.1|2949643_2949802_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_053477424.1|2949938_2950883_-	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_053477423.1|2951101_2951665_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_053477422.1|2951661_2951901_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	59.5	7.5e-21
WP_053477421.1|2952054_2952528_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_075209207.1|2952565_2952736_-	YtzI protein	NA	NA	NA	NA	NA
WP_053477420.1|2952864_2953302_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	60.7	4.2e-46
WP_053477419.1|2953380_2953638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056686056.1|2953841_2954168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053477417.1|2954213_2955086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053477416.1|2955312_2955774_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	35.8	1.7e-16
>prophage 239
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2962520	2973478	5207802		Staphylococcus_phage(40.0%)	9	NA	NA
WP_142108585.1|2962520_2963858_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	24.1	2.4e-07
WP_142108586.1|2963891_2965742_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	25.6	2.8e-22
WP_053477408.1|2965777_2966587_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_053477407.1|2966564_2967344_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	1.6e-35
WP_053477406.1|2967459_2968455_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053477405.1|2968691_2969462_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_053477404.1|2969547_2971134_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.0	1.4e-195
WP_053477403.1|2971363_2971738_+	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_053477402.1|2972278_2973478_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	76.6	1.2e-162
>prophage 240
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2976661	2978199	5207802		Staphylococcus_phage(100.0%)	2	NA	NA
WP_053477398.1|2976661_2977234_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	58.2	1.5e-51
WP_053477397.1|2977230_2978199_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	76.3	1.8e-57
>prophage 241
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2984014	2984719	5207802		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_053477388.1|2984014_2984719_+	heme ABC exporter ATP-binding protein CcmA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	1.8e-14
>prophage 242
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2989138	2990320	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_142108588.1|2989138_2990320_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	52.3	7.1e-112
>prophage 243
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	2995190	3001114	5207802	tRNA	Staphylococcus_phage(100.0%)	5	NA	NA
WP_053477379.1|2995190_2997608_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	75.4	0.0e+00
WP_053477378.1|2997703_2998021_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_053477377.1|2998077_2998974_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053477376.1|2999259_2999442_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_053477375.1|2999842_3001114_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	66.3	1.7e-31
>prophage 244
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3007838	3008552	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_053477367.1|3007838_3008552_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	8.5e-20
>prophage 245
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3025917	3027498	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_053477351.1|3025917_3027498_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	1.5e-32
>prophage 246
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3035573	3039380	5207802		Aeromonas_phage(33.33%)	3	NA	NA
WP_053477343.1|3035573_3035891_+	thioredoxin family protein	NA	I6ZI43	Aeromonas_phage	33.3	1.5e-05
WP_053477342.1|3036106_3036907_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	60.3	4.1e-39
WP_053477341.1|3037058_3039380_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.7	3.3e-89
>prophage 247
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3047575	3048649	5207802		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_053477333.1|3047575_3048649_+	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	30.1	9.5e-15
>prophage 248
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3054430	3056149	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_053477327.1|3054430_3056149_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	73.2	3.8e-207
>prophage 249
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3059650	3064504	5207802	tRNA	Cronobacter_phage(50.0%)	4	NA	NA
WP_053477325.1|3059650_3060907_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.8	2.1e-85
WP_056686020.1|3060988_3061591_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_053477323.1|3061938_3062532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142108593.1|3062647_3064504_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.7	1.3e-14
>prophage 250
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3076227	3078191	5207802		Bacillus_phage(50.0%)	2	NA	NA
WP_053477312.1|3076227_3076434_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	76.2	8.7e-18
WP_053477311.1|3076604_3078191_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.7	1.7e-76
>prophage 251
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3099864	3105334	5207802		Bacillus_virus(50.0%)	4	NA	NA
WP_056685988.1|3099864_3100800_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	G3MA01	Bacillus_virus	24.9	2.0e-16
WP_056685985.1|3100949_3101450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056685982.1|3101446_3101782_-	sporulation protein	NA	NA	NA	NA	NA
WP_142108598.1|3101971_3105334_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	34.9	4.0e-176
>prophage 252
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3110798	3112559	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_053477284.1|3110798_3112559_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	45.6	6.6e-13
>prophage 253
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3116322	3142711	5207802	tRNA,protease	Bacillus_phage(27.27%)	27	NA	NA
WP_056685969.1|3116322_3117591_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	68.5	1.2e-13
WP_056685966.1|3117670_3118609_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_053477278.1|3118792_3119269_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_053477277.1|3119441_3120158_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.4	2.7e-42
WP_056685963.1|3120154_3121927_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	38.0	1.8e-39
WP_053477275.1|3122157_3123123_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_053477274.1|3123115_3124054_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_053477273.1|3124151_3126782_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	29.7	1.7e-44
WP_053477272.1|3126828_3127656_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	28.6	8.7e-24
WP_053477271.1|3127761_3128397_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_053477270.1|3128418_3129018_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_053477269.1|3129181_3130216_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_053477268.1|3130536_3130911_+	S-adenosylmethionine decarboxylase proenzyme	NA	A0A1D7SGA8	Cyanophage	42.1	2.1e-17
WP_053477267.1|3131052_3131511_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_056685960.1|3131588_3133010_+	Replication initiation and membrane attachment protein	NA	NA	NA	NA	NA
WP_142109045.1|3133009_3133939_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	34.8	1.4e-43
WP_142108600.1|3134330_3135203_+	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_142108601.1|3135705_3137637_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.1	3.5e-116
WP_056685954.1|3138144_3138651_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.6	2.6e-15
WP_009333215.1|3138666_3138867_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_053477261.1|3138893_3139253_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_056685951.1|3139336_3139630_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_053477260.1|3139674_3140244_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_053477259.1|3140276_3140693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053477258.1|3140832_3141324_+	dUTPase	NA	A0A2H4J260	uncultured_Caudovirales_phage	41.6	1.5e-23
WP_053477257.1|3141452_3141830_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053477256.1|3141829_3142711_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	1.4e-08
>prophage 254
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3152036	3153074	5207802	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_056685942.1|3152036_3153074_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	31.3	9.8e-25
>prophage 255
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3157643	3160774	5207802		Escherichia_phage(100.0%)	2	NA	NA
WP_056685936.1|3157643_3158177_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	56.3	3.3e-61
WP_142108603.1|3158197_3160774_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	30.2	4.0e-83
>prophage 256
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3169188	3175688	5207802		Cafeteria_roenbergensis_virus(33.33%)	4	NA	NA
WP_142109047.1|3169188_3170904_+	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	26.1	1.6e-16
WP_053477233.1|3170927_3173282_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	46.9	3.4e-17
WP_053477232.1|3173300_3173708_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_053477231.1|3173984_3175688_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.6	9.4e-41
>prophage 257
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3179679	3179994	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_142108604.1|3179679_3179994_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	43.7	3.4e-21
>prophage 258
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3188772	3192653	5207802		Caldibacillus_phage(50.0%)	4	NA	NA
WP_009333184.1|3188772_3188997_+	response regulator transcription factor	NA	A0A290GJH9	Caldibacillus_phage	82.0	5.6e-18
WP_053477218.1|3189171_3189630_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053477217.1|3189640_3190435_+	glutamate racemase	NA	NA	NA	NA	NA
WP_053477216.1|3190511_3192653_+	DNA helicase RecQ	NA	K7YHB4	Megavirus	37.1	9.0e-81
>prophage 259
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3196758	3201572	5207802		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_053477211.1|3196758_3198474_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.4	1.8e-63
WP_053477210.1|3198470_3198989_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_053477209.1|3199015_3200038_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_053477208.1|3200024_3201572_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.0	7.8e-10
>prophage 260
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3208245	3216894	5207802	protease	Bacillus_virus(33.33%)	7	NA	NA
WP_053477202.1|3208245_3209511_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.2	4.1e-150
WP_053477201.1|3209727_3211395_+|protease	ATP-dependent protease LonB	protease	NA	NA	NA	NA
WP_053477200.1|3211598_3213926_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.5	8.0e-176
WP_053477199.1|3213922_3214504_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_142109049.1|3214722_3215412_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_053477197.1|3215492_3216140_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_053477196.1|3216156_3216894_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-32
>prophage 261
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3227381	3233219	5207802	tRNA	Catovirus(50.0%)	3	NA	NA
WP_053477185.1|3227381_3230027_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.3	3.4e-162
WP_053477184.1|3230096_3231404_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_082620694.1|3231503_3233219_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.6	1.7e-18
>prophage 262
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3268090	3271686	5207802	tRNA	uncultured_Mediterranean_phage(66.67%)	4	NA	NA
WP_053477148.1|3268090_3269095_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.3	2.0e-06
WP_142108608.1|3269113_3270142_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_053477146.1|3270177_3271317_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.3	1.3e-83
WP_053477145.1|3271395_3271686_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	51.7	1.7e-06
>prophage 263
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3275565	3290808	5207802	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_142108610.1|3275565_3277827_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.7	1.2e-30
WP_142108611.1|3277951_3278851_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_142108612.1|3279126_3281493_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.5	2.8e-91
WP_053477137.1|3281483_3281996_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.5	1.9e-29
WP_053477136.1|3282228_3284427_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1X9SH80	Bradyrhizobium_phage	41.2	1.0e-07
WP_142108613.1|3284439_3284880_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_142108614.1|3285010_3286780_-	SH3 domain-containing protein	NA	A9QTG2	Bacillus_phage	25.4	8.6e-05
WP_056685867.1|3287599_3288868_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_056685864.1|3289038_3290808_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	32.2	3.8e-08
>prophage 264
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3294376	3298257	5207802		Indivirus(33.33%)	4	NA	NA
WP_056685857.1|3294376_3295069_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.9	1.5e-13
WP_142108616.1|3295083_3296010_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.7	6.5e-36
WP_056685854.1|3296002_3296962_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_142108617.1|3296991_3298257_-	AAA family ATPase	NA	A0A127AWE7	Bacillus_phage	53.5	2.0e-112
>prophage 265
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3303042	3310729	5207802	tRNA	Virus_Rctr197k(50.0%)	6	NA	NA
WP_053477118.1|3303042_3305451_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	27.7	3.2e-50
WP_142108619.1|3305764_3306238_+	photosystem reaction center subunit H	NA	NA	NA	NA	NA
WP_053477116.1|3306250_3306442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075209195.1|3306467_3306602_+	YrzQ family protein	NA	NA	NA	NA	NA
WP_053477115.1|3306687_3307770_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_142108620.1|3308095_3310729_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.9	1.4e-67
>prophage 266
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3315244	3317154	5207802		Phage_TP(50.0%)	2	NA	NA
WP_142108622.1|3315244_3316513_+	U32 family peptidase	NA	Q6DW11	Phage_TP	33.0	1.8e-36
WP_053477106.1|3316518_3317154_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.3	9.2e-34
>prophage 267
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3324441	3328773	5207802		Streptococcus_phage(33.33%)	4	NA	NA
WP_142108627.1|3324441_3325365_+	cysteine synthase	NA	A0A1X9I5F1	Streptococcus_phage	45.4	1.2e-69
WP_142108628.1|3325365_3326502_+	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	29.7	3.8e-22
WP_142108629.1|3326887_3327028_+	YrzI family small protein	NA	NA	NA	NA	NA
WP_053477095.1|3328056_3328773_+	RNA polymerase sporulation sigma factor SigK	NA	S6ANS0	Bacillus_phage	28.3	1.2e-13
>prophage 268
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3338126	3338696	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_142108634.1|3338126_3338696_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	31.4	2.3e-20
>prophage 269
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3342079	3344950	5207802		Bacillus_phage(50.0%)	2	NA	NA
WP_053477593.1|3342079_3342547_+	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	54.8	6.1e-35
WP_053477079.1|3342625_3344950_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	35.0	6.0e-38
>prophage 270
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3350472	3352308	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_142108638.1|3350472_3352308_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.6	5.2e-21
>prophage 271
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3355614	3358754	5207802		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_053477069.1|3355614_3357447_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	47.4	9.2e-135
WP_053477068.1|3357632_3358754_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	30.5	8.7e-27
>prophage 272
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3364166	3364610	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_053477063.1|3364166_3364610_+	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	42.3	1.0e-10
>prophage 273
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3369281	3370244	5207802		Pseudomonas_phage(100.0%)	1	NA	NA
WP_053477058.1|3369281_3370244_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.4	5.9e-48
>prophage 274
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3382030	3385076	5207802		Caulobacter_phage(50.0%)	2	NA	NA
WP_142108642.1|3382030_3383839_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.6	2.2e-48
WP_053477046.1|3383948_3385076_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.6	1.9e-37
>prophage 275
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3388371	3395035	5207802		Bandra_megavirus(25.0%)	7	NA	NA
WP_056685735.1|3388371_3389487_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A2K9V9Q5	Bandra_megavirus	49.0	3.3e-18
WP_056685732.1|3389594_3390533_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_142108644.1|3390750_3391299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053477038.1|3391508_3392819_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	35.5	2.0e-54
WP_053477037.1|3392841_3393744_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	31.5	1.1e-24
WP_053477036.1|3393795_3394050_-	DUF2624 domain-containing protein	NA	NA	NA	NA	NA
WP_053477590.1|3394234_3395035_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.5e-22
>prophage 276
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3399415	3401044	5207802		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_142109053.1|3399415_3401044_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.9	2.6e-11
>prophage 277
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3405410	3406019	5207802		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_056685721.1|3405410_3406019_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	61.6	2.9e-69
>prophage 278
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3412823	3413651	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_082446656.1|3412823_3413651_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.5	6.6e-16
>prophage 279
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3428225	3430127	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_053477007.1|3428225_3430127_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	36.2	1.0e-91
>prophage 280
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3434007	3434643	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_142108654.1|3434007_3434643_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	39.3	2.3e-32
>prophage 281
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3443324	3452319	5207802		Prochlorococcus_phage(50.0%)	7	NA	NA
WP_053476990.1|3443324_3445022_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	30.9	1.5e-54
WP_142108659.1|3445573_3446680_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_053476988.1|3446696_3448043_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	35.7	1.3e-61
WP_053476987.1|3448035_3449496_+	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	41.5	5.3e-85
WP_053476986.1|3449755_3450139_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_053476985.1|3450328_3451165_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_053476984.1|3451419_3452319_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.2	1.4e-22
>prophage 282
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3456582	3462667	5207802		Bacillus_virus(33.33%)	4	NA	NA
WP_053477586.1|3456582_3457851_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	1.5e-30
WP_142108660.1|3458191_3458734_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053476977.1|3459074_3461636_+	vitamin B12-dependent ribonucleotide reductase	NA	A0A0K2CP92	Brevibacillus_phage	43.9	1.8e-184
WP_053476976.1|3461782_3462667_+	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	30.4	6.6e-22
>prophage 283
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3473242	3474724	5207802		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_142108662.1|3473242_3474724_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.2	1.2e-07
>prophage 284
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3477997	3480448	5207802		Enterococcus_phage(50.0%)	2	NA	NA
WP_053476956.1|3477997_3478864_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.2	2.2e-38
WP_053476955.1|3479107_3480448_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	39.0	1.2e-43
>prophage 285
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3488857	3490632	5207802		Bacillus_phage(50.0%)	3	NA	NA
WP_053476947.1|3488857_3489646_+	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	33.6	7.8e-06
WP_075209181.1|3489738_3489882_-	YycC family protein	NA	NA	NA	NA	NA
WP_053476946.1|3489909_3490632_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	41.6	4.6e-13
>prophage 286
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3510051	3510774	5207802		Planktothrix_phage(100.0%)	1	NA	NA
WP_142108666.1|3510051_3510774_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.6	8.9e-33
>prophage 287
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3516929	3519713	5207802		Caldibacillus_phage(50.0%)	2	NA	NA
WP_142108672.1|3516929_3518216_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	26.9	1.9e-17
WP_053476922.1|3518303_3519713_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7SKG4	Cyanophage	31.7	5.8e-36
>prophage 288
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3534847	3536413	5207802		Cyanophage(100.0%)	1	NA	NA
WP_082446854.1|3534847_3536413_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	38.6	2.6e-85
>prophage 289
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3542676	3553011	5207802	holin	Bacillus_phage(40.0%)	11	NA	NA
WP_053476902.1|3542676_3543507_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	30.6	6.6e-24
WP_053476901.1|3543875_3544805_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056685484.1|3545100_3546060_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_053476899.1|3546086_3546881_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.1	9.2e-07
WP_053476896.1|3546909_3547110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142108676.1|3547272_3548532_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	62.4	1.3e-148
WP_053476894.1|3548551_3548884_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	31.8	2.8e-10
WP_053476892.1|3549149_3549362_-	CDGSH iron-sulfur domain-containing protein	NA	NA	NA	NA	NA
WP_053476891.1|3549489_3549822_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_053476890.1|3550068_3551799_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_142108677.1|3551802_3553011_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	37.4	2.0e-29
>prophage 290
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3560235	3572823	5207802		Klosneuvirus(16.67%)	15	NA	NA
WP_056685471.1|3560235_3561150_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	34.1	9.6e-08
WP_075209179.1|3561336_3561486_-	Z-ring formation inhibitor MciZ	NA	NA	NA	NA	NA
WP_053476881.1|3561563_3562115_+	NUDIX hydrolase	NA	A0A2K9VCP4	Lactobacillus_phage	33.1	2.0e-16
WP_142108679.1|3562115_3563279_+	TIGR00375 family protein	NA	NA	NA	NA	NA
WP_053476879.1|3563382_3564021_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_053476878.1|3564233_3564710_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_053477582.1|3564839_3565070_+	YqzK family protein	NA	NA	NA	NA	NA
WP_053476877.1|3565078_3565972_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.0	1.7e-41
WP_142108680.1|3566365_3567550_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_053476875.1|3567563_3568388_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	45.3	2.8e-67
WP_053476874.1|3568418_3569723_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	62.0	2.4e-137
WP_142108681.1|3569847_3571032_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_053476873.1|3571257_3571608_+	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_053476872.1|3571611_3572052_+	anti-sigma F factor	NA	NA	NA	NA	NA
WP_053476871.1|3572064_3572823_+	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	62.2	1.2e-72
>prophage 291
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3579605	3583781	5207802		uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_053476863.1|3579605_3580367_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	26.2	5.5e-09
WP_053477580.1|3580362_3580950_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.9	7.5e-14
WP_053476862.1|3581078_3581498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053476861.1|3581644_3582535_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_142109059.1|3582644_3583781_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.9	1.0e-22
>prophage 292
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3589755	3592250	5207802		Bacillus_phage(50.0%)	2	NA	NA
WP_053476853.1|3589755_3590472_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.6	4.1e-46
WP_053476852.1|3590468_3592250_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	25.8	3.5e-22
>prophage 293
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3595788	3654883	5207802	protease,coat	Bacillus_phage(30.77%)	65	NA	NA
WP_142108685.1|3595788_3597369_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	32.8	1.5e-37
WP_053476846.1|3597945_3598530_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_053476845.1|3598632_3598881_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	49.3	1.5e-16
WP_053477579.1|3599188_3600247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056685447.1|3600243_3601749_+	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.8	2.0e-58
WP_142108686.1|3601748_3602348_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_142108687.1|3602340_3603033_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_053476841.1|3603118_3603577_+	YpbF family protein	NA	NA	NA	NA	NA
WP_053476840.1|3603618_3604188_-|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
WP_053476839.1|3604268_3604529_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_053476838.1|3604525_3604753_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_053476837.1|3604890_3605523_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_053476836.1|3605646_3606420_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_053476835.1|3606530_3607103_+	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_053476834.1|3607481_3608756_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_142108688.1|3608981_3609947_+	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_142108689.1|3609999_3610977_-	asparaginase	NA	NA	NA	NA	NA
WP_053476831.1|3611177_3611849_+|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_053476830.1|3611981_3612839_+	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	42.9	8.4e-22
WP_142108690.1|3612853_3614203_+	germination protein YpeB	NA	NA	NA	NA	NA
WP_053477578.1|3614309_3614966_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_053476828.1|3615037_3615217_+	YpfB family protein	NA	NA	NA	NA	NA
WP_053476827.1|3615340_3616015_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_056685431.1|3616018_3616600_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_053476825.1|3616752_3617892_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_053476824.1|3617904_3618954_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_075209177.1|3619239_3619380_-	YpzI family protein	NA	NA	NA	NA	NA
WP_053476823.1|3619508_3620117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056685428.1|3620113_3621007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053476821.1|3621006_3621192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053476820.1|3621800_3623111_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_053476819.1|3623194_3624235_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_053476818.1|3624600_3624801_+	DUF2768 domain-containing protein	NA	NA	NA	NA	NA
WP_053476817.1|3624867_3625581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053476816.1|3625807_3627286_+	stage IV sporulation protein A	NA	NA	NA	NA	NA
WP_053476815.1|3627782_3628055_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	80.0	1.2e-30
WP_142108691.1|3628305_3628872_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.1	1.7e-47
WP_053476813.1|3629132_3629369_+	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_142108692.1|3629571_3630384_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_053476811.1|3630389_3631097_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_053476810.1|3631193_3632156_+	heptaprenyl diphosphate synthase component II	NA	NA	NA	NA	NA
WP_053476809.1|3632261_3632708_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.8	2.8e-29
WP_142108693.1|3632838_3633942_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_053476808.1|3633955_3634588_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.0	2.1e-06
WP_053476807.1|3634745_3635678_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.1	5.0e-28
WP_053476806.1|3635691_3636954_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053476805.1|3636950_3638048_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053476804.1|3638165_3638939_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_056685419.1|3639135_3640308_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	37.3	5.1e-46
WP_053476802.1|3640309_3641392_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_053476801.1|3641394_3641772_+	chorismate mutase	NA	NA	NA	NA	NA
WP_053476800.1|3641818_3642937_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	30.7	8.4e-30
WP_053476799.1|3643008_3644115_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_053476798.1|3644164_3645448_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_053476797.1|3645612_3646512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142108694.1|3646552_3647809_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_053476795.1|3647858_3648410_+	YpiB family protein	NA	G3MAV7	Bacillus_virus	52.2	1.0e-44
WP_053476794.1|3648554_3649019_+	YpiF family protein	NA	NA	NA	NA	NA
WP_053476793.1|3649168_3649675_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_053476792.1|3649678_3650353_+	cytochrome b6	NA	NA	NA	NA	NA
WP_053476791.1|3650404_3651172_+	cytochrome C oxidase Cbb3	NA	NA	NA	NA	NA
WP_053476789.1|3651706_3652300_+	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_142108695.1|3652408_3653197_+	sporulation protein YpjB	NA	NA	NA	NA	NA
WP_142108696.1|3653266_3653947_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
WP_053476786.1|3654010_3654883_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	43.5	3.0e-67
>prophage 294
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3658494	3670603	5207802	tRNA	Bacillus_phage(40.0%)	11	NA	NA
WP_056685414.1|3658494_3659694_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	47.0	3.6e-39
WP_082446637.1|3659678_3660662_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_142108698.1|3660935_3661772_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	39.9	3.5e-49
WP_053476778.1|3661768_3662623_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_053476777.1|3662634_3663018_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_142108699.1|3663180_3665982_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	28.6	8.4e-71
WP_075209175.1|3666175_3666346_+	YpmA family protein	NA	NA	NA	NA	NA
WP_053476775.1|3666360_3666834_+	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_053476774.1|3666847_3668038_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_142108700.1|3668444_3669740_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.4	5.3e-60
WP_053476772.1|3669892_3670603_+	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	48.2	1.5e-24
>prophage 295
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3674521	3675133	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053476768.1|3674521_3675133_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	4.7e-27
>prophage 296
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3683307	3685593	5207802		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_142108701.1|3683307_3685593_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	30.5	1.8e-10
>prophage 297
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3694924	3696850	5207802		Streptomyces_phage(100.0%)	1	NA	NA
WP_053476751.1|3694924_3696850_+	ATP-dependent DNA helicase	NA	A0A2P1N093	Streptomyces_phage	21.6	1.2e-07
>prophage 298
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3717066	3717954	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053477574.1|3717066_3717954_+	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	29.2	7.1e-24
>prophage 299
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3721588	3721789	5207802		Lactococcus_phage(100.0%)	1	NA	NA
WP_053476725.1|3721588_3721789_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	61.5	7.2e-17
>prophage 300
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3725095	3729946	5207802		Brazilian_cedratvirus(50.0%)	4	NA	NA
WP_053476721.1|3725095_3725845_+	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.4	4.2e-17
WP_053476720.1|3725855_3726797_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_142108706.1|3726786_3727665_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_142108707.1|3727792_3729946_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	35.0	3.7e-66
>prophage 301
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3742024	3744549	5207802		Pandoravirus(50.0%)	2	NA	NA
WP_053476707.1|3742024_3742672_+	HD domain-containing protein	NA	S4W232	Pandoravirus	29.9	8.3e-14
WP_053476706.1|3742668_3744549_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.7e-54
>prophage 302
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3750382	3754484	5207802		Caulobacter_phage(33.33%)	4	NA	NA
WP_053476700.1|3750382_3750964_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.2	1.3e-26
WP_053476699.1|3751048_3751822_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	61.4	1.1e-78
WP_056685334.1|3751978_3753190_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_075209172.1|3753116_3754484_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	1.2e-09
>prophage 303
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3759942	3762795	5207802		Caulobacter_phage(33.33%)	4	NA	NA
WP_053476692.1|3759942_3760557_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	31.8	3.1e-26
WP_142108712.1|3760745_3761447_+	toxin	NA	NA	NA	NA	NA
WP_053476690.1|3761518_3762313_+	thymidylate synthase	NA	E5DV96	Deep-sea_thermophilic_phage	66.3	4.3e-105
WP_053476689.1|3762309_3762795_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	42.6	6.0e-33
>prophage 304
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3768062	3769679	5207802		Hokovirus(100.0%)	1	NA	NA
WP_053476681.1|3768062_3769679_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	31.4	4.3e-19
>prophage 305
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3785112	3785901	5207802		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_142108717.1|3785112_3785901_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.2	2.9e-13
>prophage 306
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3810757	3812167	5207802		Moraxella_phage(100.0%)	1	NA	NA
WP_082446852.1|3810757_3812167_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.3	1.5e-28
>prophage 307
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3816329	3820150	5207802		Bacillus_phage(100.0%)	4	NA	NA
WP_053476637.1|3816329_3817013_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.4	1.5e-45
WP_053476636.1|3817009_3818407_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	31.9	8.5e-40
WP_053476635.1|3818484_3818949_+	FixH family protein	NA	NA	NA	NA	NA
WP_142108726.1|3819379_3820150_+	sporulation protein	NA	A0A0E3T7R5	Bacillus_phage	66.7	8.6e-42
>prophage 308
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3823758	3824322	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_053476629.1|3823758_3824322_-	GNAT family N-acetyltransferase	NA	G3MB37	Bacillus_virus	34.6	7.2e-14
>prophage 309
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3828289	3829198	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_142108729.1|3828289_3829198_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	2.2e-28
>prophage 310
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3834134	3845213	5207802		Staphylococcus_phage(50.0%)	10	NA	NA
WP_053476616.1|3834134_3835436_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	28.1	3.9e-39
WP_053476614.1|3835818_3836910_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.4	3.9e-56
WP_053476613.1|3836914_3837571_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.4	5.2e-40
WP_053476612.1|3837596_3838790_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.5	7.4e-117
WP_053476611.1|3838805_3839273_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	7.2e-44
WP_053476610.1|3839456_3840701_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_053476609.1|3840742_3842569_-	DNA ligase D	NA	A0A068CDF3	Rhizobium_phage	23.1	2.9e-11
WP_053476608.1|3842719_3843550_+	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	38.0	5.4e-42
WP_053476607.1|3843675_3844224_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_053476606.1|3844388_3845213_+	aquaporin family protein	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	36.7	4.0e-29
>prophage 311
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3848814	3854294	5207802		Lactococcus_phage(40.0%)	6	NA	NA
WP_053476603.1|3848814_3849609_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	40.5	9.8e-41
WP_082446628.1|3849705_3849972_-	DUF3006 family protein	NA	NA	NA	NA	NA
WP_053476601.1|3849968_3851174_-	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	36.5	7.3e-48
WP_053476600.1|3851987_3852188_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	5.9e-19
WP_142109064.1|3852572_3853970_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	38.4	3.4e-65
WP_053476597.1|3854093_3854294_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
>prophage 312
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3858566	3860614	5207802		Bacillus_phage(100.0%)	2	NA	NA
WP_053476590.1|3858566_3859241_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	51.1	4.2e-61
WP_142108734.1|3859237_3860614_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	37.2	1.5e-49
>prophage 313
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3866678	3868364	5207802		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_053476581.1|3866678_3868364_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.6	3.3e-22
>prophage 314
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3875022	3877951	5207802		Ostreococcus_tauri_virus(50.0%)	3	NA	NA
WP_053476579.1|3875022_3876324_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.6	1.9e-62
WP_053476578.1|3876338_3876974_-	LysE family transporter	NA	NA	NA	NA	NA
WP_053476577.1|3877126_3877951_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	50.5	2.1e-70
>prophage 315
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3889820	3896523	5207802		Bacillus_phage(75.0%)	5	NA	NA
WP_142108739.1|3889820_3890858_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	41.0	1.0e-50
WP_142109066.1|3890876_3892556_-	YfhO family protein	NA	NA	NA	NA	NA
WP_053476564.1|3892722_3893169_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	39.9	1.8e-23
WP_053476563.1|3893165_3894212_-	ribonucleotide-diphosphate reductase subunit beta	NA	A7KUZ8	Bacillus_phage	55.2	5.7e-105
WP_053476562.1|3894234_3896523_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A7KUZ9	Bacillus_phage	61.8	5.9e-280
>prophage 316
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3900325	3902646	5207802		Clostridium_phage(100.0%)	2	NA	NA
WP_056685239.1|3900325_3902200_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	46.6	6.3e-155
WP_053476558.1|3902196_3902646_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0A8WJI9	Clostridium_phage	49.7	4.5e-35
>prophage 317
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3911373	3914522	5207802		Bacillus_phage(50.0%)	3	NA	NA
WP_056685227.1|3911373_3912327_+	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	33.7	1.0e-36
WP_053476549.1|3912520_3913537_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_053476548.1|3913556_3914522_+	UV DNA damage repair endonuclease UvsE	NA	A0A223LDU8	Aeromonas_phage	27.2	1.7e-15
>prophage 318
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3924143	3924971	5207802		Orpheovirus(100.0%)	1	NA	NA
WP_053476537.1|3924143_3924971_+	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	39.0	2.3e-45
>prophage 319
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3929128	3931532	5207802		Acinetobacter_phage(100.0%)	3	NA	NA
WP_142108744.1|3929128_3929740_+	C26 family cysteine hydrolase domain-containing family	NA	A0A0P0IKJ1	Acinetobacter_phage	47.1	4.5e-46
WP_053476532.1|3929711_3930737_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	36.0	1.2e-54
WP_053476531.1|3930737_3931532_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	38.9	3.0e-34
>prophage 320
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3948128	3949844	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053476510.1|3948128_3949844_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.5	3.2e-65
>prophage 321
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3954558	3955254	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_056685195.1|3954558_3955254_-	VanR-ABDEGLN family DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.3	5.5e-40
>prophage 322
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3968778	3970853	5207802		Bacillus_phage(100.0%)	2	NA	NA
WP_056685182.1|3968778_3969294_-	hypothetical protein	NA	L0L915	Bacillus_phage	34.9	8.9e-19
WP_053476486.1|3969599_3970853_+	C40 family peptidase	NA	A0A0A0RPZ1	Bacillus_phage	49.6	3.8e-23
>prophage 323
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3974165	3976304	5207802		Staphylococcus_phage(50.0%)	2	NA	NA
WP_053476484.1|3974165_3975020_-	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	37.6	2.2e-38
WP_142108750.1|3975170_3976304_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	35.9	1.2e-28
>prophage 324
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3979623	3983273	5207802		Escherichia_phage(50.0%)	3	NA	NA
WP_082446615.1|3979623_3981687_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.7	5.0e-28
WP_053476478.1|3981985_3982381_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053476477.1|3982367_3983273_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	2.1e-23
>prophage 325
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3986543	3988318	5207802		Bacillus_phage(50.0%)	2	NA	NA
WP_053476474.1|3986543_3987548_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.5	5.4e-20
WP_142108753.1|3987634_3988318_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	1.5e-34
>prophage 326
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	3992715	3993297	5207802		Agrobacterium_phage(100.0%)	1	NA	NA
WP_053476469.1|3992715_3993297_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	49.0	1.0e-47
>prophage 327
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4013445	4018618	5207802		Staphylococcus_phage(50.0%)	5	NA	NA
WP_053476449.1|4013445_4015008_+	fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.7	2.8e-39
WP_142108760.1|4015032_4016136_+	CoA transferase	NA	NA	NA	NA	NA
WP_053476447.1|4016278_4016968_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_053476446.1|4017186_4017564_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
WP_142108761.1|4017847_4018618_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.0e-18
>prophage 328
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4023942	4024731	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_142108762.1|4023942_4024731_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.1	1.4e-10
>prophage 329
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4028490	4035758	5207802		Escherichia_phage(33.33%)	6	NA	NA
WP_053476438.1|4028490_4030530_-	molybdopterin oxidoreductase family protein	NA	A0A077SK27	Escherichia_phage	26.2	1.2e-47
WP_053476437.1|4030797_4032159_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_053476436.1|4032556_4033738_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	29.8	5.8e-13
WP_082620676.1|4033791_4034001_-	methionine aminopeptidase	NA	NA	NA	NA	NA
WP_056685102.1|4034190_4034733_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053476433.1|4034999_4035758_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	64.8	4.6e-80
>prophage 330
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4048724	4049513	5207802		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_053476421.1|4048724_4049513_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.9	2.1e-11
>prophage 331
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4052550	4054740	5207802		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_053476417.1|4052550_4054740_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4UUK0	Bodo_saltans_virus	33.1	2.9e-34
>prophage 332
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4068991	4075034	5207802		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_082620674.1|4068991_4070728_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.0	9.3e-20
WP_053476402.1|4070811_4071936_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053476401.1|4072308_4073421_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053476400.1|4073525_4075034_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.4	1.4e-08
>prophage 333
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4088812	4090288	5207802		Microcystis_phage(100.0%)	1	NA	NA
WP_142109074.1|4088812_4090288_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.1	1.0e-51
>prophage 334
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4096223	4101084	5207802		Bacillus_phage(40.0%)	6	NA	NA
WP_053476378.1|4096223_4097009_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	37.4	6.3e-32
WP_053476377.1|4097068_4097764_+	nicotinamide mononucleotide transporter	NA	U5J9C5	Bacillus_phage	47.6	1.9e-56
WP_142108783.1|4097764_4098793_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A218KBV7	Bacillus_phage	50.4	1.1e-100
WP_142108784.1|4098809_4099652_+	ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	36.0	5.9e-36
WP_053476374.1|4099844_4100036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142109076.1|4100163_4101084_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.2	2.5e-40
>prophage 335
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4105903	4106587	5207802		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_142108787.1|4105903_4106587_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.4	5.5e-24
>prophage 336
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4113026	4113809	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053476362.1|4113026_4113809_+	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	31.1	3.1e-23
>prophage 337
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4128931	4129693	5207802		Planktothrix_phage(100.0%)	1	NA	NA
WP_053476345.1|4128931_4129693_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.2e-32
>prophage 338
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4135909	4137790	5207802		Catovirus(100.0%)	1	NA	NA
WP_053476338.1|4135909_4137790_+	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	32.3	2.4e-90
>prophage 339
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4141656	4143564	5207802		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_142108796.1|4141656_4143564_-	endonuclease MutS2	NA	F2Y0V3	Organic_Lake_phycodnavirus	25.5	1.9e-18
>prophage 340
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4159140	4159839	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_053476316.1|4159140_4159839_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	7.3e-24
>prophage 341
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4172359	4173862	5207802		Escherichia_phage(100.0%)	1	NA	NA
WP_053476302.1|4172359_4173862_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.2	1.4e-19
>prophage 342
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4178050	4180452	5207802		Cafeteria_roenbergensis_virus(50.0%)	3	NA	NA
WP_053476296.1|4178050_4178806_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	44.0	4.4e-59
WP_142108800.1|4178866_4179577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053476294.1|4179573_4180452_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.2	2.7e-15
>prophage 343
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4199391	4200523	5207802	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_142108803.1|4199391_4200523_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	61.5	1.1e-93
>prophage 344
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4208942	4209641	5207802		Flavobacterium_phage(100.0%)	1	NA	NA
WP_053476275.1|4208942_4209641_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	3.1e-22
>prophage 345
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4215882	4220548	5207802		Klosneuvirus(33.33%)	4	NA	NA
WP_142108806.1|4215882_4217127_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	23.4	6.1e-05
WP_053476267.1|4217459_4218020_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_142108807.1|4218366_4218708_-	acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	43.1	1.3e-05
WP_056684902.1|4219798_4220548_+	alpha/beta hydrolase	NA	A0A2D1G8C7	Mycobacterium_phage	44.6	1.8e-07
>prophage 346
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4245103	4245946	5207802		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_053476240.1|4245103_4245946_+	DUF2935 domain-containing protein	NA	A0A0G2Y5W0	Acanthamoeba_polyphaga_mimivirus	23.7	3.4e-07
>prophage 347
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4256540	4257827	5207802	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_056684855.1|4256540_4257827_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	31.2	7.9e-40
>prophage 348
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4261697	4266032	5207802	tRNA	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_056684848.1|4261697_4263953_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	36.1	2.7e-144
WP_053476224.1|4264340_4266032_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.7	1.7e-74
>prophage 349
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4271258	4274471	5207802		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_056684838.1|4271258_4274471_+	DEAD/DEAH box helicase	NA	M1HIX2	Paramecium_bursaria_Chlorella_virus	29.8	4.8e-38
>prophage 350
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4286646	4289256	5207802		Hokovirus(100.0%)	1	NA	NA
WP_053476205.1|4286646_4289256_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.3	8.2e-44
>prophage 351
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4295269	4296148	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_053476201.1|4295269_4296148_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.4	3.9e-22
>prophage 352
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4302197	4303775	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_082446587.1|4302197_4303775_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.9	1.4e-14
>prophage 353
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4319661	4321347	5207802		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_056684784.1|4319661_4321347_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.1	2.4e-12
>prophage 354
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4332401	4333856	5207802		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_142108818.1|4332401_4333856_+	ABC-F type ribosomal protection protein	NA	A0A2I4R674	Erysipelothrix_phage	47.2	6.0e-105
>prophage 355
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4341629	4342736	5207802		Mycoplasma_phage(100.0%)	1	NA	NA
WP_053476158.1|4341629_4342736_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.0	2.4e-37
>prophage 356
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4347799	4350939	5207802		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_082446585.1|4347799_4349041_-	hypothetical protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.2	1.9e-06
WP_056684751.1|4349196_4350939_-	AAA family ATPase	NA	H8ZJI5	Ostreococcus_tauri_virus	38.3	1.8e-71
>prophage 357
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4361957	4365410	5207802		Dickeya_phage(100.0%)	1	NA	NA
WP_142108820.1|4361957_4365410_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	50.0	1.6e-10
>prophage 358
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4368433	4369555	5207802		Pandoravirus(100.0%)	1	NA	NA
WP_056684722.1|4368433_4369555_-	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	28.9	6.9e-16
>prophage 359
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4375775	4379785	5207802		Staphylococcus_phage(100.0%)	7	NA	NA
WP_142108823.1|4375775_4377428_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	30.6	1.5e-35
WP_053476132.1|4377522_4377759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053476131.1|4377807_4378011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142108824.1|4378079_4378280_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_142108825.1|4378323_4378887_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_053476129.1|4379029_4379413_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	37.9	1.0e-11
WP_142108826.1|4379413_4379785_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	37.4	2.9e-11
>prophage 360
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4382793	4390825	5207802	coat	Bacillus_virus(40.0%)	7	NA	NA
WP_053476123.1|4382793_4384269_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	48.5	4.5e-116
WP_056684711.1|4384280_4385105_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.2	2.0e-89
WP_142108828.1|4385387_4385609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142108829.1|4385631_4386711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053476119.1|4386806_4387535_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	30.9	5.4e-30
WP_142108830.1|4387618_4389844_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.8	5.1e-188
WP_075209153.1|4390198_4390825_+|coat	SafA/ExsA family spore coat assembly protein	coat	A0A0E3T7R5	Bacillus_phage	62.6	1.2e-65
>prophage 361
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4394533	4396153	5207802		Tupanvirus(100.0%)	1	NA	NA
WP_053476111.1|4394533_4396153_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.6	3.3e-51
>prophage 362
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4412182	4416735	5207802		Caulobacter_phage(66.67%)	4	NA	NA
WP_053476095.1|4412182_4414342_+	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	22.0	4.7e-21
WP_056684699.1|4414385_4415156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053476093.1|4415479_4416061_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.4	2.4e-28
WP_053476092.1|4416156_4416735_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	35.3	9.0e-28
>prophage 363
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4421374	4421812	5207802		Catovirus(100.0%)	1	NA	NA
WP_053476087.1|4421374_4421812_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	42.7	2.1e-16
>prophage 364
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4426002	4428570	5207802		Salicola_phage(100.0%)	1	NA	NA
WP_053476081.1|4426002_4428570_+	DEAD/DEAH box helicase	NA	A0A248SJQ0	Salicola_phage	35.3	4.3e-53
>prophage 365
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4438491	4439238	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_053476072.1|4438491_4439238_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	3.0e-31
>prophage 366
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4443925	4444798	5207802		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_142108832.1|4443925_4444798_+	2-oxoglutarate-dependent dioxygenase	NA	E3T5C0	Cafeteria_roenbergensis_virus	35.1	7.0e-24
>prophage 367
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4462217	4464170	5207802		Streptococcus_phage(100.0%)	1	NA	NA
WP_142108834.1|4462217_4464170_+	GTP-binding protein	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.1e-61
>prophage 368
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4469674	4471796	5207802		Streptococcus_phage(50.0%)	2	NA	NA
WP_142108836.1|4469674_4470808_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.6	6.5e-46
WP_142109082.1|4470830_4471796_+	NAD(P)-binding domain-containing protein	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.5	4.1e-25
>prophage 369
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4475107	4476610	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_056684669.1|4475107_4476610_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	5.8e-18
>prophage 370
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4495665	4496544	5207802		Klosneuvirus(100.0%)	1	NA	NA
WP_053476022.1|4495665_4496544_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	30.5	9.2e-08
>prophage 371
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4502575	4504081	5207802		Cyanophage(100.0%)	1	NA	NA
WP_056684640.1|4502575_4504081_+	adenosylmethionine decarboxylase	NA	A0A1D7SEZ2	Cyanophage	40.4	1.7e-14
>prophage 372
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4509659	4511527	5207802		Bacillus_phage(100.0%)	2	NA	NA
WP_053476011.1|4509659_4510373_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	9.7e-40
WP_142108846.1|4510369_4511527_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.7	4.9e-25
>prophage 373
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4517158	4518223	5207802		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_053476004.1|4517158_4518223_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	31.0	9.4e-31
>prophage 374
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4521561	4523301	5207802		Staphylococcus_phage(100.0%)	2	NA	NA
WP_142108848.1|4521561_4522860_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	67.8	5.0e-159
WP_056684610.1|4522881_4523301_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	64.2	1.3e-44
>prophage 375
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4541800	4542001	5207802		Lactococcus_phage(100.0%)	1	NA	NA
WP_053474558.1|4541800_4542001_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	5.3e-20
>prophage 376
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4554174	4558215	5207802		Bacillus_phage(100.0%)	4	NA	NA
WP_142108853.1|4554174_4554771_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XAL9	Bacillus_phage	49.1	5.2e-39
WP_056684585.1|4555202_4555688_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_142108854.1|4556074_4556758_-	response regulator	NA	W8CYM9	Bacillus_phage	36.0	9.0e-35
WP_142108855.1|4556754_4558215_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.9	4.2e-29
>prophage 377
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4563355	4564237	5207802		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_056684571.1|4563355_4564237_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.7	6.0e-07
>prophage 378
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4567561	4571985	5207802		Bacillus_virus(100.0%)	2	NA	NA
WP_053475965.1|4567561_4570009_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.1	2.8e-110
WP_053475964.1|4570008_4571985_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.6	1.8e-128
>prophage 379
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4586445	4587774	5207802		Enterobacteria_phage(100.0%)	1	NA	NA
WP_142108861.1|4586445_4587774_-	purine permease	NA	Q9KX94	Enterobacteria_phage	29.6	2.5e-33
>prophage 380
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4598721	4600783	5207802		Hokovirus(50.0%)	2	NA	NA
WP_053475938.1|4598721_4599489_+	GHKL domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.9	3.0e-18
WP_053475937.1|4599607_4600783_+	CapA family protein	NA	A0A2H4J5Z6	uncultured_Caudovirales_phage	34.5	7.6e-58
>prophage 381
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4619802	4622139	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_053475915.1|4619802_4622139_-	AAA family ATPase	NA	G3MAX6	Bacillus_virus	36.4	6.2e-43
>prophage 382
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4635115	4635373	5207802		Staphylococcus_phage(100.0%)	1	NA	NA
WP_053475901.1|4635115_4635373_-	hypothetical protein	NA	A0A0N7GFG6	Staphylococcus_phage	50.6	2.7e-16
>prophage 383
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4642822	4648193	5207802		Tupanvirus(66.67%)	3	NA	NA
WP_056684491.1|4642822_4644013_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	31.7	3.6e-47
WP_056684488.1|4644765_4646223_+	catalase	NA	A0A2K9L0T1	Tupanvirus	40.7	9.6e-111
WP_142108869.1|4646636_4648193_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	8.3e-52
>prophage 384
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4652041	4653136	5207802		Pacmanvirus(100.0%)	1	NA	NA
WP_056684480.1|4652041_4653136_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.2	2.0e-20
>prophage 385
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4661203	4661998	5207802		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_053475883.1|4661203_4661998_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	1.3e-13
>prophage 386
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4673664	4675891	5207802		Bacillus_phage(100.0%)	2	NA	NA
WP_142108878.1|4673664_4674984_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	41.0	3.8e-90
WP_056684468.1|4674985_4675891_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.7	1.5e-85
>prophage 387
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4681509	4682514	5207802		Escherichia_phage(100.0%)	1	NA	NA
WP_053475867.1|4681509_4682514_+	NAD-dependent epimerase	NA	K7QJG5	Escherichia_phage	23.5	3.7e-21
>prophage 388
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4689219	4692145	5207802		Catovirus(50.0%)	4	NA	NA
WP_142108881.1|4689219_4690398_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	59.3	8.3e-137
WP_053475857.1|4690681_4690915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053475856.1|4691298_4691481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082446559.1|4691635_4692145_-	M67 family metallopeptidase	NA	B3VM42	Mycobacterium_phage	34.0	1.5e-05
>prophage 389
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4700743	4713042	5207802		Synechococcus_phage(33.33%)	12	NA	NA
WP_142108884.1|4700743_4702327_-	DUF4214 domain-containing protein	NA	B6EFD8	Stygiolobus_rod-shaped_virus	22.3	3.5e-05
WP_082446836.1|4702356_4703385_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_053475847.1|4703800_4704403_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053475846.1|4704517_4705474_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	57.8	2.4e-102
WP_053475845.1|4705526_4706567_-	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	30.7	4.4e-33
WP_053475844.1|4706619_4707567_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_053475843.1|4707851_4708517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053475842.1|4708739_4709504_-	macrocin O-methyltransferase	NA	A0A2R8FFV8	Cedratvirus	54.2	8.2e-61
WP_053475841.1|4709554_4710241_-	class I SAM-dependent methyltransferase	NA	A0A0E3HGK7	Synechococcus_phage	29.7	1.2e-07
WP_082446555.1|4710290_4710983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082446552.1|4711359_4712262_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_053475838.1|4712388_4713042_+	hypothetical protein	NA	A0A0B4ZZS0	Mycobacterium_phage	27.6	3.1e-08
>prophage 390
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4716886	4734071	5207802	coat	Escherichia_phage(25.0%)	16	NA	NA
WP_053475834.1|4716886_4717930_-	hypothetical protein	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	33.5	7.8e-30
WP_053475833.1|4717934_4718612_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_053475832.1|4718639_4719836_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_053475831.1|4719852_4720581_-	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_053475830.1|4720774_4721935_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L470	Tupanvirus	34.5	3.2e-48
WP_053475829.1|4722005_4722971_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A2P1ELS8	Moumouvirus	36.7	1.4e-46
WP_053475828.1|4723442_4723706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142108887.1|4723905_4724640_-	bclB domain-containing protein	NA	A0A1M7XUW2	Cedratvirus	50.3	1.3e-36
WP_053475826.1|4724802_4725261_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_053475825.1|4725257_4726100_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_053475824.1|4726104_4727064_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.0e-68
WP_053475823.1|4727060_4727801_-	NTP transferase domain-containing protein	NA	A0A291LA53	Escherichia_phage	43.6	4.5e-48
WP_053475822.1|4728114_4730082_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	42.5	1.6e-132
WP_053475821.1|4730370_4730556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053475820.1|4730668_4731718_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_075209139.1|4732184_4734071_-	selenocysteine-specific translation elongation factor	NA	A0A1V0SLW6	Klosneuvirus	27.5	1.1e-13
>prophage 391
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4740257	4744558	5207802		Lactococcus_phage(25.0%)	8	NA	NA
WP_053475815.1|4740257_4740458_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	9.0e-20
WP_053475814.1|4740670_4740808_-	YvrJ family protein	NA	NA	NA	NA	NA
WP_053475813.1|4740874_4741093_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_142108888.1|4741143_4741362_-	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_053475812.1|4741522_4741792_+	hypothetical protein	NA	A0A0A7RUL4	Clostridium_phage	38.0	2.8e-08
WP_053475811.1|4741878_4742763_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.1e-16
WP_053475810.1|4743373_4743727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053475809.1|4744012_4744558_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	37.0	2.6e-29
>prophage 392
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4753105	4757024	5207802		Thermus_phage(50.0%)	4	NA	NA
WP_056684387.1|4753105_4753522_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	58.9	1.8e-33
WP_142108889.1|4753744_4754257_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_053475801.1|4754442_4754982_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053477617.1|4755200_4757024_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	37.0	3.7e-27
>prophage 393
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4760088	4761297	5207802		Brevibacillus_phage(50.0%)	3	NA	NA
WP_075209135.1|4760088_4760514_-	hypothetical protein	NA	S5MUL4	Brevibacillus_phage	48.2	9.9e-24
WP_053475797.1|4760833_4761022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056684378.1|4761018_4761297_-	hypothetical protein	NA	A0A0K2D0P0	Bacillus_phage	42.0	1.2e-14
>prophage 394
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4765857	4774924	5207802	integrase	Bacillus_phage(60.0%)	9	4774390:4774405	4779989:4780004
WP_056684364.1|4765857_4767651_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.6	1.4e-50
WP_142108890.1|4767655_4769404_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.2	1.3e-45
WP_053475787.1|4770035_4770350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053475786.1|4770526_4770718_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142108891.1|4770853_4771474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056684353.1|4771473_4771749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056684351.1|4772050_4773025_-	hypothetical protein	NA	U5J9B8	Bacillus_phage	27.8	3.7e-26
WP_142108892.1|4773036_4774374_-	hypothetical protein	NA	A0A0H3UZ06	Geobacillus_virus	37.4	6.0e-75
4774390:4774405	attL	ATAATTTATTTTATTA	NA	NA	NA	NA
WP_142108893.1|4774459_4774924_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H3V0V1	Geobacillus_virus	45.0	3.1e-31
WP_142108893.1|4774459_4774924_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H3V0V1	Geobacillus_virus	45.0	3.1e-31
4779989:4780004	attR	ATAATTTATTTTATTA	NA	NA	NA	NA
>prophage 395
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4777975	4779887	5207802		Bacillus_phage(100.0%)	4	NA	NA
WP_142108895.1|4777975_4778560_-	hypothetical protein	NA	A0A1P8CX45	Bacillus_phage	46.3	5.7e-38
WP_053475776.1|4778630_4778942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053475775.1|4779162_4779414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053475774.1|4779698_4779887_-	hypothetical protein	NA	F8WPL1	Bacillus_phage	64.3	2.2e-15
>prophage 396
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4788646	4790700	5207802		Phage_Wrath(50.0%)	2	NA	NA
WP_053475764.1|4788646_4789270_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	1.5e-15
WP_053475763.1|4789365_4790700_-	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	1.6e-06
>prophage 397
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4794783	4795731	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_053475758.1|4794783_4795731_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	43.6	4.3e-51
>prophage 398
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4804133	4807120	5207802	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_142108902.1|4804133_4805265_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	61.1	4.6e-92
WP_056684313.1|4806007_4807120_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.6	1.1e-42
>prophage 399
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4812565	4823583	5207802	integrase	Prochlorococcus_phage(40.0%)	9	4815667:4815681	4820715:4820729
WP_142108904.1|4812565_4814029_-	aminotransferase class V-fold PLP-dependent enzyme	NA	E3ST28	Prochlorococcus_phage	42.3	1.4e-85
WP_056684299.1|4814021_4815371_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	37.3	5.9e-54
WP_142109092.1|4815382_4815553_-	hypothetical protein	NA	NA	NA	NA	NA
4815667:4815681	attL	ATTTTAGAGATATCA	NA	NA	NA	NA
WP_082446540.1|4816554_4816944_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	38.1	8.5e-14
WP_082446832.1|4818386_4818599_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_056684283.1|4818996_4819893_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082446538.1|4819922_4820465_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	34.4	3.0e-17
WP_056684275.1|4821989_4822826_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
4820715:4820729	attR	TGATATCTCTAAAAT	NA	NA	NA	NA
WP_142108905.1|4822917_4823583_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	36.8	1.3e-09
>prophage 400
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4829674	4830898	5207802		environmental_halophage(100.0%)	1	NA	NA
WP_142108910.1|4829674_4830898_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.9	8.9e-110
>prophage 401
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4839653	4847442	5207802	tRNA,transposase	Catovirus(50.0%)	4	NA	NA
WP_142108914.1|4839653_4840785_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	61.1	4.6e-92
WP_142108915.1|4840966_4842427_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	34.2	2.7e-73
WP_142108916.1|4842936_4844811_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	2.7e-73
WP_142108917.1|4844838_4847442_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	25.7	1.1e-37
>prophage 402
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4857976	4858237	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_009791522.1|4857976_4858237_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	1.1e-09
>prophage 403
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4861445	4862486	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053475735.1|4861445_4862486_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	73.4	4.0e-135
>prophage 404
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4867698	4870256	5207802		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_053475728.1|4867698_4868982_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	26.0	1.3e-07
WP_142108923.1|4868981_4870256_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	29.7	4.3e-54
>prophage 405
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4874403	4880815	5207802		Amsacta_moorei_entomopoxvirus(33.33%)	4	NA	NA
WP_142108924.1|4874403_4875939_-	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	29.1	1.7e-12
WP_053475722.1|4876193_4877303_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	35.9	2.2e-51
WP_053475721.1|4877386_4878112_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142108925.1|4878472_4880815_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.7	4.9e-88
>prophage 406
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4889742	4890978	5207802		Bacillus_virus(100.0%)	1	NA	NA
WP_142108928.1|4889742_4890978_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	33.7	9.8e-56
>prophage 407
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4897581	4906654	5207802		Cafeteria_roenbergensis_virus(50.0%)	6	NA	NA
WP_142108934.1|4897581_4899807_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.0	1.4e-23
WP_053475703.1|4899826_4900129_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_142108935.1|4900134_4900410_-	DUF448 domain-containing protein	NA	NA	NA	NA	NA
WP_142108936.1|4900425_4901553_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_053475700.1|4901624_4902095_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_142108937.1|4902331_4906654_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	34.2	4.1e-24
>prophage 408
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4912106	4912883	5207802		Flavobacterium_phage(100.0%)	1	NA	NA
WP_053475694.1|4912106_4912883_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.7	6.2e-24
>prophage 409
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4947955	4955738	5207802	tRNA,protease	Erwinia_phage(25.0%)	6	NA	NA
WP_053475657.1|4947955_4949362_-	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	28.8	1.8e-45
WP_053475656.1|4949381_4949924_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_053475655.1|4949999_4950905_-	tyrosine recombinase XerC	NA	W8EHC2	Mycobacterium_phage	29.2	6.2e-15
WP_053475654.1|4950959_4952270_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_053475653.1|4952448_4954524_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.5	7.3e-104
WP_053475652.1|4954874_4955738_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.3	3.1e-32
>prophage 410
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4960413	4961187	5207802		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_053475647.1|4960413_4961187_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	42.9	7.3e-33
>prophage 411
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4972904	4974959	5207802		Megavirus(33.33%)	3	NA	NA
WP_053475634.1|4972904_4973645_-	ribonuclease III	NA	K7YH73	Megavirus	34.9	7.5e-27
WP_053475633.1|4973865_4974099_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	42.6	3.5e-07
WP_053475632.1|4974215_4974959_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	5.0e-23
>prophage 412
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4985159	4987139	5207802		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_053475620.1|4985159_4987139_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.8	3.8e-25
>prophage 413
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	4990335	5003491	5207802	tRNA	Prochlorococcus_phage(33.33%)	11	NA	NA
WP_056684069.1|4990335_4991286_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.5	4.3e-11
WP_056684067.1|4991282_4991768_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	44.1	1.2e-17
WP_142108943.1|4991844_4994253_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_053475613.1|4994249_4995458_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.0	2.8e-47
WP_053475612.1|4995585_4995807_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_053475611.1|4995807_4996422_-	guanylate kinase	NA	S4W1R9	Pandoravirus	31.1	6.9e-10
WP_003350261.1|4996431_4996695_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_142108944.1|4996755_4997628_-	YicC family protein	NA	NA	NA	NA	NA
WP_056684064.1|4997822_5000501_-	calcium-translocating P-type ATPase, SERCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.6	3.0e-86
WP_142108945.1|5001064_5002777_+	DUF814 domain-containing protein	NA	NA	NA	NA	NA
WP_053475607.1|5002858_5003491_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	43.9	2.8e-06
>prophage 414
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5009098	5019262	5207802	tRNA	Halovirus(25.0%)	9	NA	NA
WP_142108946.1|5009098_5010184_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.5	2.4e-58
WP_142108947.1|5010180_5011467_-	dihydroorotase	NA	NA	NA	NA	NA
WP_142108948.1|5011429_5012368_-	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	32.6	7.5e-32
WP_056684056.1|5012531_5013809_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.8	1.6e-64
WP_053475598.1|5013869_5014412_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_053475597.1|5014596_5015508_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_053475596.1|5015479_5015974_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_053475595.1|5016053_5016341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142108949.1|5016490_5019262_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	28.1	1.1e-94
>prophage 415
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5024327	5026008	5207802		Bacillus_phage(50.0%)	2	NA	NA
WP_053475586.1|5024327_5025107_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	46.7	2.3e-50
WP_053475585.1|5025288_5026008_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	43.6	3.0e-20
>prophage 416
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5062899	5063388	5207802		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_053475483.1|5062899_5063388_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	49.1	2.3e-32
>prophage 417
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5071200	5071833	5207802	coat	Bacillus_phage(100.0%)	1	NA	NA
WP_142108955.1|5071200_5071833_-|coat	SafA/ExsA family spore coat assembly protein	coat	U5Q0C0	Bacillus_phage	40.3	2.2e-35
>prophage 418
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5088122	5093744	5207802		Vibrio_phage(50.0%)	7	NA	NA
WP_053475457.1|5088122_5089448_-	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	34.3	1.1e-55
WP_053475456.1|5089609_5090200_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_053475455.1|5090310_5090766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053477498.1|5090898_5091099_+	YlaI family protein	NA	NA	NA	NA	NA
WP_056683994.1|5091261_5091549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056683993.1|5091564_5091882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053475452.1|5091905_5093744_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	25.2	1.2e-20
>prophage 419
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5102129	5103539	5207802		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_142108958.1|5102129_5103539_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.9	8.0e-46
>prophage 420
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5109244	5110615	5207802		Synechococcus_phage(50.0%)	2	NA	NA
WP_053475435.1|5109244_5109799_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.6	3.5e-13
WP_056683981.1|5109844_5110615_-	Cof-type HAD-IIB family hydrolase	NA	Q0GXW5	Lactococcus_phage	25.5	2.4e-07
>prophage 421
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5113920	5119934	5207802		Bacillus_phage(75.0%)	5	NA	NA
WP_082620648.1|5113920_5115741_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	2.0e-60
WP_053475429.1|5115749_5117504_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	1.2e-54
WP_053475428.1|5117673_5118129_-	redoxin domain-containing protein	NA	A0A127AW88	Bacillus_phage	47.6	1.1e-33
WP_053475427.1|5118223_5118766_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_053475426.1|5119046_5119934_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	34.3	7.4e-05
>prophage 422
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5125232	5125997	5207802		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_053475419.1|5125232_5125997_-	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	38.6	3.6e-40
>prophage 423
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5132129	5133035	5207802		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_053475414.1|5132129_5133035_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	36.8	7.9e-55
>prophage 424
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5145450	5151630	5207802	protease	Enterobacteria_phage(50.0%)	4	NA	NA
WP_056683952.1|5145450_5147607_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	41.4	3.3e-123
WP_053475398.1|5147653_5149348_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_053475397.1|5149484_5149928_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053475396.1|5150133_5151630_+	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.7	1.8e-19
>prophage 425
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5160847	5162653	5207802		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_142109102.1|5160847_5162653_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.2	5.3e-10
>prophage 426
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5191102	5191927	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053475360.1|5191102_5191927_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	57.6	4.7e-54
>prophage 427
NZ_CP041305	Bacillus ciccensis strain 5L6 chromosome, complete genome	5207802	5200610	5200817	5207802		Bacillus_phage(100.0%)	1	NA	NA
WP_053475352.1|5200610_5200817_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	65.6	1.3e-13
