The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041280	Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.1011 chromosome, complete genome	1887491	345775	386828	1887491	holin,terminase,portal,integrase	Lactobacillus_phage(66.67%)	47	346290:346304	386999:387013
WP_035175859.1|345775_347341_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.5	1.3e-28
346290:346304	attL	ATCATCTGGATCTTC	NA	NA	NA	NA
WP_003613569.1|347337_348063_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003623471.1|348815_349145_-	hypothetical protein	NA	Q37936	Lactococcus_phage	89.0	3.4e-48
WP_100215413.1|349158_350319_-	LysM peptidoglycan-binding domain-containing protein	NA	A9UJV4	Lactobacillus_phage	63.1	1.4e-133
WP_003623467.1|350353_350731_-|holin	phage holin	holin	A0A0A7DMV7	Lactobacillus_phage	41.9	4.8e-14
WP_035175857.1|350727_351021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035175855.1|351034_351460_-	hypothetical protein	NA	Q38356	Lactococcus_phage	47.8	2.2e-31
WP_003623463.1|351513_351693_-	XkdX family protein	NA	NA	NA	NA	NA
WP_003623461.1|351709_352216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141907517.1|352233_355584_-	hypothetical protein	NA	A0A0A7DN19	Lactobacillus_phage	66.4	3.3e-37
WP_050983084.1|355596_356142_-	DUF2313 domain-containing protein	NA	L0P8N4	Lactobacillus_phage	38.2	3.9e-25
WP_003622845.1|356138_357275_-	hypothetical protein	NA	X2CYG4	Lactobacillus_phage	52.5	3.1e-104
WP_003622843.1|357276_357732_-	DUF2634 domain-containing protein	NA	Q708L3	Streptococcus_phage	42.6	2.4e-12
WP_035175702.1|357724_358066_-	DUF2577 family protein	NA	Q20DC2	Lactobacillus_phage	56.7	1.5e-27
WP_003622839.1|358044_359571_-	hypothetical protein	NA	X2CXX6	Lactobacillus_phage	40.5	3.1e-43
WP_003622837.1|359575_360430_-	hypothetical protein	NA	L0P8M9	Lactobacillus_phage	37.1	6.0e-28
WP_003622835.1|360423_363864_-	tape measure protein	NA	L0P6G7	Lactobacillus_phage	46.6	3.9e-78
WP_003622832.1|364112_364529_-	hypothetical protein	NA	A9D9V7	Lactobacillus_prophage	52.9	4.8e-31
WP_003622830.1|364552_365011_-	hypothetical protein	NA	Q20DC7	Lactobacillus_phage	60.4	4.4e-46
WP_003622828.1|365028_366378_-	hypothetical protein	NA	A9D9V1	Lactobacillus_prophage	51.1	1.6e-112
WP_003622826.1|366378_366621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003622825.1|366604_367024_-	hypothetical protein	NA	L0P6G4	Lactobacillus_phage	41.9	1.5e-11
WP_035175701.1|367020_367419_-	HK97 gp10 family phage protein	NA	A0A0A7RVN8	Clostridium_phage	33.3	4.0e-11
WP_003622823.1|367421_367784_-	hypothetical protein	NA	A9D9T8	Lactobacillus_prophage	59.0	1.7e-32
WP_035175700.1|367780_368164_-	hypothetical protein	NA	X2CXX4	Lactobacillus_phage	41.3	6.4e-22
WP_003622821.1|368174_369113_-	hypothetical protein	NA	L0P8M2	Lactobacillus_phage	61.6	2.8e-103
WP_003622819.1|369126_369669_-	hypothetical protein	NA	L0P7B0	Lactobacillus_phage	48.9	1.2e-37
WP_003622818.1|369757_370792_-	hypothetical protein	NA	A9D9S7	Lactobacillus_prophage	47.6	5.1e-90
WP_003622815.1|370794_372273_-|portal	phage portal protein	portal	Q20DD7	Lactobacillus_phage	62.9	6.4e-171
WP_003622814.1|372263_373481_-|terminase	PBSX family phage terminase large subunit	terminase	A9D9R9	Lactobacillus_prophage	62.7	9.7e-157
WP_035175720.1|373467_374010_-|terminase	terminase small subunit	terminase	Q20DD9	Lactobacillus_phage	51.4	1.3e-25
WP_003622810.1|374664_375159_-	hypothetical protein	NA	U3PIU0	Lactobacillus_phage	90.2	4.2e-82
WP_003622807.1|375460_375700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035175696.1|376098_376353_-	hypothetical protein	NA	A0A075KK51	Lactobacillus_phage	39.5	3.7e-10
WP_035175695.1|376342_376708_-	VRR-NUC domain-containing protein	NA	A0A0A1ENT6	Lactobacillus_phage	52.2	2.5e-31
WP_003622798.1|377005_379348_-	primase	NA	Q9T1H6	Lactobacillus_phage	58.9	1.3e-266
WP_003622797.1|379373_379901_-	DUF669 domain-containing protein	NA	Q9T1H8	Lactobacillus_phage	35.2	1.5e-26
WP_035175692.1|379930_381268_-	DEAD/DEAH box helicase family protein	NA	Q9T0Y3	Lactobacillus_phage	52.9	2.6e-126
WP_003622794.1|381194_381914_-	AAA family ATPase	NA	F8J1E7	Lactobacillus_phage	59.5	1.1e-80
WP_035175690.1|381900_382167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080585123.1|382401_382578_-	helix-turn-helix domain-containing protein	NA	Q14T69	Lactococcus_phage	71.4	1.7e-17
WP_003622790.1|382671_382878_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035175688.1|383045_383396_+	helix-turn-helix transcriptional regulator	NA	F8J1E0	Lactobacillus_phage	46.9	5.8e-22
WP_035175686.1|383379_383748_+	ImmA/IrrE family metallo-endopeptidase	NA	F8J1D9	Lactobacillus_phage	47.1	7.0e-26
WP_050983080.1|383935_384550_+	DUF3862 domain-containing protein	NA	A9D9J1	Lactobacillus_prophage	34.4	2.4e-10
WP_080585122.1|384555_385713_+|integrase	site-specific integrase	integrase	U3PCM7	Lactobacillus_phage	87.7	3.7e-190
WP_003622781.1|385832_386828_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	45.7	2.1e-77
386999:387013	attR	GAAGATCCAGATGAT	NA	NA	NA	NA
>prophage 2
NZ_CP041280	Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.1011 chromosome, complete genome	1887491	736274	745077	1887491		Phaeocystis_globosa_virus(33.33%)	9	NA	NA
WP_003622309.1|736274_737267_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	68.4	1.8e-132
WP_003622306.1|737452_738742_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	38.2	1.6e-72
WP_011677979.1|738825_739287_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003619462.1|739514_739940_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003622304.1|740035_741349_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.5	8.8e-63
WP_003622302.1|741400_742714_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.7	3.3e-62
WP_003622300.1|742846_742984_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_003619469.1|743065_744019_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	4.6e-21
WP_003619471.1|744033_745077_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	4.7e-19
>prophage 3
NZ_CP041280	Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.1011 chromosome, complete genome	1887491	1005054	1013134	1887491		Lactobacillus_phage(66.67%)	8	NA	NA
WP_003621701.1|1005054_1006599_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	2.6e-13
WP_003623370.1|1006686_1007772_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	48.6	9.5e-79
WP_003623368.1|1008052_1009150_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	45.7	1.7e-80
WP_003619985.1|1009335_1009932_-	DUF4352 domain-containing protein	NA	A0A0P0IXE0	Lactobacillus_phage	70.0	1.4e-44
WP_003623366.1|1010026_1011067_-	protein kinase	NA	A0A2I2L4J2	Orpheovirus	32.8	1.3e-08
WP_035175833.1|1011109_1011517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035175832.1|1011559_1012123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003623363.1|1012042_1013134_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	47.1	3.0e-80
>prophage 4
NZ_CP041280	Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.1011 chromosome, complete genome	1887491	1145153	1150944	1887491		Streptomyces_phage(42.86%)	7	NA	NA
WP_003621164.1|1145153_1145696_+	AAA family ATPase	NA	U5J9X2	Bacillus_phage	35.9	2.2e-12
WP_003621166.1|1145820_1146306_+	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	41.1	2.3e-16
WP_003621168.1|1146591_1147638_+	lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.7	1.2e-27
WP_003624366.1|1147807_1148281_+	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	42.7	3.2e-15
WP_003624364.1|1148468_1149251_+	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	42.7	1.0e-13
WP_003624362.1|1149405_1150113_+	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	39.7	4.8e-15
WP_035176041.1|1150158_1150944_+	hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	36.1	5.3e-07
>prophage 5
NZ_CP041280	Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.1011 chromosome, complete genome	1887491	1592077	1600649	1887491		Prochlorococcus_phage(33.33%)	8	NA	NA
WP_011544054.1|1592077_1593373_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	1.4e-20
WP_003615550.1|1593696_1594419_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	36.8	1.3e-36
WP_003615547.1|1594423_1594672_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003618413.1|1594671_1595346_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_004560840.1|1595345_1597568_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	1.1e-142
WP_004560839.1|1597543_1599022_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.2	3.9e-51
WP_035169900.1|1599024_1600068_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.3	8.3e-64
WP_004560838.1|1600067_1600649_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.4	1.9e-25
>prophage 6
NZ_CP041280	Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.1011 chromosome, complete genome	1887491	1746471	1815747	1887491	tRNA,protease,transposase,integrase	Streptococcus_phage(22.22%)	48	1789617:1789670	1805931:1805984
WP_003618684.1|1746471_1747371_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.8	1.8e-51
WP_003618685.1|1747451_1748642_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	47.8	2.4e-43
WP_003623898.1|1748667_1749330_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_011543974.1|1749464_1750310_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.0	1.0e-19
WP_002880201.1|1750313_1750544_+	YozE family protein	NA	NA	NA	NA	NA
WP_003623895.1|1750618_1751476_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003618690.1|1751465_1752236_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	37.2	5.6e-25
WP_003618691.1|1752333_1753173_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	37.4	1.4e-29
WP_003623892.1|1753299_1755483_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	34.8	2.1e-93
WP_003623890.1|1755614_1756934_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_003618694.1|1756933_1757821_+	tyrosine recombinase XerC	NA	S5W9T9	Leptospira_phage	30.2	1.4e-24
WP_003618695.1|1757930_1758464_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003623888.1|1758466_1759861_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	26.2	8.5e-32
WP_003623885.1|1759942_1760839_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003623878.1|1761725_1763036_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_141907542.1|1763216_1764401_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014565027.1|1764962_1765163_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_141907543.1|1766308_1767193_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_003618706.1|1767259_1767529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003618707.1|1767588_1768446_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002880182.1|1768614_1768791_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_035175763.1|1768944_1769892_+	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	48.4	8.9e-49
WP_003623009.1|1769891_1770416_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_003618710.1|1770417_1770837_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_011543965.1|1770820_1771726_+	GTPase Era	NA	NA	NA	NA	NA
WP_003613030.1|1771725_1772475_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003623007.1|1772739_1773651_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_003623006.1|1773643_1775710_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003623005.1|1775741_1777580_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.7	4.1e-58
WP_035176111.1|1777551_1778670_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.5	8.3e-38
WP_107645606.1|1778711_1779833_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.6	2.9e-38
WP_003623022.1|1779868_1781005_+	sigma-70 family RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	35.9	1.6e-36
WP_035175915.1|1783039_1785277_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.4	2.4e-60
WP_141907544.1|1788104_1789337_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	7.4e-96
1789617:1789670	attL	GAACGATTTCTTACGCAGACTATTCTGGCATCAATCTGGGCACCATCTTTGGCA	NA	NA	NA	NA
WP_035175751.1|1790088_1792602_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_003622961.1|1792706_1794491_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003622968.1|1797398_1798226_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002878612.1|1798225_1798666_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_011678334.1|1798809_1799502_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_035175753.1|1799494_1800292_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_011543946.1|1801978_1802164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003618238.1|1802233_1802800_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003622978.1|1802842_1803679_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003618241.1|1803858_1804170_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_141907508.1|1806418_1807642_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.5	2.3e-97
1805931:1805984	attR	TGCCAAAGATGGTGCCCAGATTGATGCCAGAATAGTCTGCGTAAGAAATCGTTC	NA	NA	NA	NA
WP_003624233.1|1808257_1810141_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003619632.1|1810144_1813171_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.9	1.3e-141
WP_081381927.1|1814442_1815747_+|transposase	ISL3-like element ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.0	1.4e-57
