The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041236	Pseudomonas azotoformans strain P45A chromosome, complete genome	6884339	317982	369147	6884339	portal,protease,lysis,integrase,terminase,holin	Pseudomonas_phage(18.18%)	58	328941:328990	371160:371209
WP_141605279.1|317982_320112_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_141605280.1|320316_320601_-	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
WP_141607633.1|320907_322521_-	sporadically distributed protein, TIGR04141 family	NA	NA	NA	NA	NA
WP_092489264.1|322680_323838_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_141605281.1|324190_326614_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_141605282.1|326712_327675_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_141605283.1|327671_328178_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
328941:328990	attL	ATGGTGCCGGCACCAGGAGTCGAACCCGGGACCTACTGATTACAAGTCAG	NA	NA	NA	NA
WP_141605284.1|329277_330258_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_141605285.1|330254_330908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605286.1|330888_332037_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	40.8	5.1e-75
WP_141605287.1|332033_332240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605288.1|332236_333223_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	49.7	8.0e-77
WP_141605289.1|333219_333714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605290.1|333730_333982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605291.1|333978_335970_-	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	73.0	6.6e-203
WP_141605292.1|335962_336247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605293.1|336243_336786_-	phosphohydrolase	NA	A0A2D1GNL9	Pseudomonas_phage	42.5	3.2e-27
WP_141605294.1|336782_337004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605295.1|337000_337399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605296.1|337494_337809_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_141605297.1|337805_338273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605298.1|338253_338436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605299.1|338435_338726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605300.1|338735_339296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605301.1|339539_340328_-	helix-turn-helix domain-containing protein	NA	A0A1B0Z078	Pseudomonas_phage	46.7	5.9e-54
WP_141605302.1|340436_340724_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	48.6	2.5e-10
WP_074844100.1|341063_341573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605303.1|341565_341784_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_141605304.1|341780_344003_+	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	45.5	4.6e-181
WP_083381336.1|344011_344359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074844108.1|344885_345185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605305.1|345426_345651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065927355.1|345714_346059_+|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	87.6	1.7e-45
WP_141605306.1|346078_346810_+	hypothetical protein	NA	A0A291AUT0	Sinorhizobium_phage	35.8	1.9e-27
WP_141605307.1|347288_349664_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	44.2	1.6e-142
WP_065899722.1|349667_349889_+	hypothetical protein	NA	A0A291AUT6	Sinorhizobium_phage	54.4	2.7e-09
WP_141605308.1|349885_351496_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	43.9	1.6e-106
WP_141605309.1|351498_352863_+	S49 family peptidase	NA	A0A219YA27	Aeromonas_phage	42.0	2.4e-47
WP_141605310.1|352922_353339_+	cytoplasmic protein	NA	G8DH46	Emiliania_huxleyi_virus	48.5	1.1e-24
WP_141605311.1|353403_354351_+	hypothetical protein	NA	G8DH47	Emiliania_huxleyi_virus	52.4	1.1e-86
WP_141605312.1|354386_354635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605313.1|354624_354834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605314.1|354826_355114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605315.1|355119_355572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605316.1|355582_356338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605317.1|356334_356682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605318.1|356747_356939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605319.1|356939_357143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605320.1|357426_360198_+	hypothetical protein	NA	A0A218MKN2	uncultured_virus	24.7	4.6e-21
WP_141605321.1|360207_360858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_092484726.1|360854_361715_+	DUF2163 domain-containing protein	NA	A0A0B4SJM9	Proteus_phage	26.5	1.5e-15
WP_141605322.1|361886_364664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605323.1|364676_366548_+	hypothetical protein	NA	A0A222ZJQ9	Arthrobacter_phage	29.6	3.8e-19
WP_141605324.1|366547_367387_+	hypothetical protein	NA	D4P7M2	Rhodococcus_phage	39.4	1.5e-31
WP_081610085.1|367424_367607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605325.1|367820_368330_+	glycoside hydrolase family protein	NA	A0A0F7LBS0	Escherichia_phage	66.5	6.4e-54
WP_141605326.1|368326_368641_+	ammonia monooxygenase	NA	G8GWD9	Rhodobacter_phage	57.0	4.1e-27
WP_141607634.1|368637_369147_+|lysis	lysis protein	lysis	A0A2H4IZW4	uncultured_Caudovirales_phage	64.3	2.6e-47
371160:371209	attR	ATGGTGCCGGCACCAGGAGTCGAACCCGGGACCTACTGATTACAAGTCAG	NA	NA	NA	NA
>prophage 2
NZ_CP041236	Pseudomonas azotoformans strain P45A chromosome, complete genome	6884339	1390555	1474578	6884339	tail,plate,portal,tRNA,lysis,terminase,holin	uncultured_Caudovirales_phage(19.51%)	91	NA	NA
WP_141605601.1|1390555_1392778_+	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	45.8	3.2e-182
WP_083381336.1|1392786_1393134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_092484772.1|1393650_1393950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065927355.1|1394008_1394353_+|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	87.6	1.7e-45
WP_141605602.1|1394372_1395104_+	hypothetical protein	NA	A0A291AUT0	Sinorhizobium_phage	35.8	2.5e-27
WP_065927356.1|1395313_1395808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605603.1|1395746_1397840_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	45.0	5.0e-145
WP_065899722.1|1397843_1398065_+	hypothetical protein	NA	A0A291AUT6	Sinorhizobium_phage	54.4	2.7e-09
WP_141605604.1|1398061_1399672_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	43.6	2.3e-105
WP_141605605.1|1399674_1401039_+	S49 family peptidase	NA	A0A219YA27	Aeromonas_phage	42.0	2.4e-47
WP_141605606.1|1401081_1401498_+	cytoplasmic protein	NA	G8DH46	Emiliania_huxleyi_virus	47.8	7.4e-24
WP_074844120.1|1401563_1402511_+	hypothetical protein	NA	G8DH47	Emiliania_huxleyi_virus	51.4	2.6e-85
WP_141605607.1|1402546_1402795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605313.1|1402784_1402994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_092484750.1|1402986_1403274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605608.1|1403279_1403729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605609.1|1403742_1404498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605610.1|1404494_1404842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605319.1|1405099_1405303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605611.1|1405588_1408360_+	hypothetical protein	NA	A0A218MKN2	uncultured_virus	24.7	2.7e-21
WP_141605612.1|1408369_1409020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605613.1|1409016_1409877_+	DUF2163 domain-containing protein	NA	A0A0B4SJM9	Proteus_phage	26.5	1.5e-15
WP_141605614.1|1410048_1412826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605615.1|1412838_1414710_+	hypothetical protein	NA	A0A222ZJQ9	Arthrobacter_phage	29.3	1.9e-18
WP_141605616.1|1414709_1415549_+	hypothetical protein	NA	D4P7M2	Rhodococcus_phage	39.0	2.5e-31
WP_081610085.1|1415586_1415769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605617.1|1415983_1416493_+	glycoside hydrolase family protein	NA	A0A0F7LBS0	Escherichia_phage	65.8	1.9e-53
WP_141605618.1|1416489_1416804_+	ammonia monooxygenase	NA	G8GWD9	Rhodobacter_phage	57.9	2.9e-28
WP_141607644.1|1416800_1417307_+|lysis	lysis protein	lysis	A0A2H4IZW4	uncultured_Caudovirales_phage	63.7	9.0e-48
WP_141605619.1|1417893_1418913_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_141605620.1|1419359_1419719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605621.1|1420141_1420354_-	hypothetical protein	NA	A0A2H4J177	uncultured_Caudovirales_phage	78.8	1.7e-21
WP_141605622.1|1420944_1421271_-	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_005785382.1|1421485_1422220_+	helix-turn-helix transcriptional regulator	NA	B5TK58	Pseudomonas_phage	88.1	1.7e-119
WP_139237739.1|1422315_1422525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_092487457.1|1422815_1423160_+|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	85.0	2.2e-45
WP_141605623.1|1423180_1423696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_092487463.1|1423699_1424311_+|plate	phage baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	53.3	1.5e-44
WP_092487466.1|1424320_1424653_+|plate	phage baseplate protein	plate	A0A2H4JI46	uncultured_Caudovirales_phage	68.2	5.1e-36
WP_092487469.1|1424649_1425645_+|plate	baseplate J protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	63.8	5.4e-113
WP_092487472.1|1425641_1426271_+|tail	phage tail protein I	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	53.4	3.4e-44
WP_092487474.1|1426271_1427726_+	hypothetical protein	NA	E5G6P0	Salmonella_phage	43.2	5.4e-29
WP_092356656.1|1427948_1428164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_092487477.1|1428250_1428442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_092487480.1|1428444_1429611_+|tail	phage tail protein	tail	B0ZSG8	Halomonas_phage	57.2	6.1e-124
WP_092487483.1|1429610_1430117_+|tail	phage tail protein	tail	Q6R4W3	Vibrio_virus	34.5	6.5e-22
WP_092487486.1|1430167_1430740_+|tail	phage tail assembly protein	tail	B0ZSH0	Halomonas_phage	40.3	3.6e-29
WP_092487489.1|1430867_1432331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065938716.1|1432330_1432714_+|tail	phage tail protein	tail	B0ZSH2	Halomonas_phage	57.5	1.9e-34
WP_027604555.1|1432706_1432919_+|tail	tail protein	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	65.7	1.6e-19
WP_092487492.1|1432928_1433939_+|tail	phage tail protein	tail	A0A2H4JH05	uncultured_Caudovirales_phage	56.5	3.1e-100
WP_092487495.1|1433961_1434519_+	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	71.6	5.7e-72
WP_092487498.1|1434506_1435007_+|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	73.6	1.5e-26
WP_092487501.1|1435088_1435589_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	84.3	9.7e-71
WP_065926514.1|1435672_1436731_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.4	2.4e-111
WP_012722522.1|1436739_1437207_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_065926513.1|1437452_1438565_-	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_027604548.1|1438929_1439370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_092487503.1|1439549_1440269_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_092487505.1|1440521_1441172_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065938722.1|1441247_1441610_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_092487508.1|1441613_1442600_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003172178.1|1442664_1443444_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_092487511.1|1443498_1444194_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_141605624.1|1444197_1444659_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.3e-37
WP_092356391.1|1444728_1445439_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_092487514.1|1445510_1445984_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005785474.1|1446084_1447425_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_074844204.1|1447873_1448164_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_137211491.1|1448331_1448532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_092487517.1|1448531_1450433_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	32.8	1.6e-73
WP_027604534.1|1450559_1451666_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_065926501.1|1451936_1452122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065926500.1|1452169_1453795_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_092487523.1|1454137_1455562_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_141605625.1|1455648_1456458_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_027604529.1|1456447_1457377_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_141605626.1|1457378_1458413_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.5	1.0e-26
WP_141605627.1|1458549_1459701_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_141605628.1|1459772_1461260_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_141605629.1|1461362_1462274_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065938734.1|1462442_1463150_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_092487541.1|1463310_1464933_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_141605630.1|1464932_1465445_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_092487547.1|1465441_1466695_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_092487550.1|1466691_1467393_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_092487553.1|1467389_1469672_+	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.4	9.8e-09
WP_092487556.1|1469668_1470679_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_065926488.1|1470730_1471732_+	PleD family two-component system response regulator	NA	A0A127AWB9	Bacillus_phage	34.7	8.0e-16
WP_098465888.1|1471888_1472983_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	2.0e-07
WP_027604516.1|1473075_1474578_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.6	3.2e-85
>prophage 3
NZ_CP041236	Pseudomonas azotoformans strain P45A chromosome, complete genome	6884339	1550206	1555171	6884339		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_065926446.1|1550206_1550956_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.4	2.4e-65
WP_003172303.1|1550955_1551633_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	1.4e-43
WP_092487660.1|1551840_1552677_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	33.3	8.2e-06
WP_025855149.1|1552782_1553787_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.3e-34
WP_002554837.1|1554005_1554215_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	2.2e-16
WP_003172320.1|1554604_1555171_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	73.3	6.2e-74
>prophage 4
NZ_CP041236	Pseudomonas azotoformans strain P45A chromosome, complete genome	6884339	1720098	1727538	6884339		Synechococcus_phage(16.67%)	9	NA	NA
WP_027604309.1|1720098_1720812_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	37.6	8.8e-41
WP_027604308.1|1721124_1721496_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	66.7	5.9e-41
WP_065928208.1|1721499_1721802_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	42.2	2.7e-15
WP_083244960.1|1721884_1722175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605700.1|1722370_1723996_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.6	4.7e-66
WP_027604305.1|1724009_1724222_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_027604304.1|1724289_1724502_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	9.9e-17
WP_141605701.1|1724750_1726685_-	response regulator	NA	NA	NA	NA	NA
WP_141605702.1|1726674_1727538_-	histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	28.5	2.5e-26
>prophage 5
NZ_CP041236	Pseudomonas azotoformans strain P45A chromosome, complete genome	6884339	1829117	1904646	6884339	tail,plate,tRNA,portal,protease,head,lysis,integrase,capsid,terminase,transposase,holin	uncultured_Caudovirales_phage(44.12%)	97	1831294:1831312	1913448:1913466
WP_141156846.1|1829117_1830266_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_141605733.1|1830370_1831390_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
1831294:1831312	attL	CGGTCCAATCCATCATCGG	NA	NA	NA	NA
WP_102619008.1|1831492_1832590_+|integrase	site-specific integrase	integrase	L7TP61	Pseudomonas_virus	73.2	2.4e-154
WP_102619009.1|1832610_1833228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102618984.1|1833267_1833537_-	Pyocin activator protein PrtN	NA	A0A2K8HN48	Pseudomonas_phage	59.1	1.9e-20
WP_141605734.1|1833533_1834085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605735.1|1834452_1834995_-	phosphohydrolase	NA	U5P0T3	Shigella_phage	45.1	1.9e-27
WP_141605736.1|1834991_1835210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605737.1|1835206_1835608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605738.1|1835657_1835984_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_141605739.1|1835934_1836114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605740.1|1836139_1836424_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_141605741.1|1836433_1837015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605742.1|1837348_1838722_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_141605743.1|1838722_1839661_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_141605744.1|1839687_1840335_-	XRE family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	43.8	2.4e-13
WP_141605745.1|1840433_1840661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141607646.1|1840896_1841511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122539654.1|1841503_1841731_+	TraR/DksA family transcriptional regulator	NA	A0A1Z1LZ52	Serratia_phage	50.9	2.6e-07
WP_141605746.1|1841720_1843940_+	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	47.9	6.2e-194
WP_141605747.1|1843932_1844298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043046669.1|1844825_1845170_+|holin	pyocin R2, holin	holin	A0A2H4J893	uncultured_Caudovirales_phage	79.6	2.2e-45
WP_141605748.1|1845375_1845978_+|terminase	terminase small subunit	terminase	A0A2H4JG15	uncultured_Caudovirales_phage	59.7	1.9e-52
WP_141605749.1|1845981_1848012_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	79.8	0.0e+00
WP_032889620.1|1848013_1848220_+	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	75.0	9.0e-23
WP_141605750.1|1848219_1849701_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	86.6	2.5e-247
WP_141605751.1|1849697_1850828_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	69.0	3.4e-140
WP_141605752.1|1850824_1851163_+|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	81.7	1.5e-43
WP_141605753.1|1851225_1852221_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	88.8	2.4e-169
WP_141605754.1|1852223_1852544_+	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	73.3	1.5e-40
WP_141605755.1|1852540_1853197_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	63.3	6.1e-73
WP_141605756.1|1853189_1853708_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	62.8	1.8e-56
WP_141605757.1|1853704_1854310_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	78.2	9.4e-52
WP_141607647.1|1854364_1854586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605758.1|1854591_1854918_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	62.3	5.8e-32
WP_141605759.1|1854914_1855817_+|plate	baseplate assembly protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	67.5	4.4e-106
WP_141605760.1|1855791_1856397_+|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	74.9	1.6e-72
WP_141605761.1|1856393_1858247_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	49.1	4.7e-78
WP_141605762.1|1858248_1858656_+	hypothetical protein	NA	A0A2H4J880	uncultured_Caudovirales_phage	54.5	5.8e-13
WP_141605763.1|1858705_1859332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605764.1|1859432_1860599_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	79.5	1.1e-173
WP_141605765.1|1860611_1861115_+|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	70.7	1.2e-65
WP_141605766.1|1861126_1861438_+|tail	phage tail assembly protein	tail	A0A2H4J873	uncultured_Caudovirales_phage	55.8	5.7e-21
WP_141605767.1|1861586_1864076_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	35.5	1.3e-83
WP_141605768.1|1864085_1864931_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	73.9	7.5e-116
WP_017848158.1|1864905_1865112_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	73.1	1.7e-21
WP_141605769.1|1865206_1866256_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	73.9	1.1e-148
WP_141605770.1|1866310_1866874_+	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	80.2	2.5e-83
WP_141605771.1|1866855_1867398_+|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	57.4	2.4e-46
WP_141605772.1|1867546_1868341_+	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	66.2	1.9e-100
WP_141605773.1|1868346_1869048_-	hypothetical protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	50.4	4.5e-58
WP_141605774.1|1869148_1869574_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	39.5	2.9e-15
WP_141605775.1|1869566_1870844_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	51.0	1.4e-110
WP_141605776.1|1870877_1871492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605777.1|1871809_1872367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605778.1|1872730_1872943_-	hypothetical protein	NA	A0A2H4J177	uncultured_Caudovirales_phage	76.8	1.9e-20
WP_141607648.1|1873263_1874415_+|integrase	tyrosine-type recombinase/integrase	integrase	L7TP61	Pseudomonas_virus	63.0	2.0e-135
WP_122680173.1|1874389_1874665_-	Pyocin activator protein PrtN	NA	A0A2K8HN48	Pseudomonas_phage	60.5	2.4e-23
WP_094064610.1|1874675_1874927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605779.1|1874930_1875191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094064608.1|1875249_1875561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605780.1|1875610_1878424_-	toprim domain-containing protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	62.1	0.0e+00
WP_141605781.1|1878420_1878666_-	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	55.1	3.9e-17
WP_141605782.1|1878737_1879112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605783.1|1879108_1879402_-	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	47.9	1.2e-15
WP_141605784.1|1879401_1879872_-	hypothetical protein	NA	A0A2H4JG61	uncultured_Caudovirales_phage	53.6	1.4e-39
WP_141607649.1|1879912_1880161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141607650.1|1880298_1880679_+	bacteriophage CI repressor	NA	NA	NA	NA	NA
WP_141605785.1|1880947_1882108_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_141605786.1|1882233_1883316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141605787.1|1883312_1884581_-	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	80.3	9.7e-192
WP_141605788.1|1884577_1885018_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	72.6	2.4e-57
WP_141605789.1|1885023_1887699_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	40.1	2.4e-163
WP_083207100.1|1887688_1887808_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	76.9	3.8e-10
WP_141605790.1|1887816_1888152_-|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	57.9	1.5e-22
WP_141605791.1|1888202_1888718_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	76.0	3.4e-71
WP_141605792.1|1888775_1889951_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	75.4	1.3e-171
WP_141605793.1|1890042_1890438_-	hypothetical protein	NA	A0A067ZI91	Vibrio_phage	36.5	1.5e-05
WP_141605794.1|1890439_1892296_-|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	42.1	2.2e-99
WP_141605795.1|1892292_1892910_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	71.7	4.5e-78
WP_141605796.1|1892909_1893821_-|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	70.4	1.3e-113
WP_141605797.1|1893817_1894162_-|plate	baseplate assembly protein	plate	Q9ZXK9	Pseudomonas_virus	67.3	1.1e-36
WP_141605798.1|1894158_1894731_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	63.7	6.1e-61
WP_141605799.1|1894812_1895367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605800.1|1895418_1895877_-	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	63.3	1.6e-48
WP_141605801.1|1895866_1896349_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	68.4	1.6e-46
WP_141605802.1|1896445_1896889_-|lysis	LysB family phage lysis regulatory protein	lysis	Q9ZXL5	Pseudomonas_virus	33.6	3.2e-09
WP_141605803.1|1896885_1897089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141605804.1|1897085_1897928_-	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	70.1	1.8e-101
WP_141605805.1|1897924_1898239_-|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	57.7	2.4e-27
WP_141605806.1|1898293_1898506_-|tail	phage tail protein	tail	Q9ZXL9	Pseudomonas_virus	80.3	7.6e-25
WP_141605807.1|1898505_1898967_-|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	62.1	3.3e-49
WP_141605808.1|1899084_1899786_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	71.3	6.7e-86
WP_141605809.1|1899790_1900813_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	61.8	3.2e-121
WP_141605810.1|1900853_1901684_-|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	53.1	2.9e-72
WP_046035102.1|1901839_1903597_+|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	80.7	3.2e-286
WP_141605811.1|1903596_1904646_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	76.0	7.6e-142
1913448:1913466	attR	CGGTCCAATCCATCATCGG	NA	NA	NA	NA
>prophage 6
NZ_CP041236	Pseudomonas azotoformans strain P45A chromosome, complete genome	6884339	3144272	3184980	6884339	tail,plate,portal,head,lysis,integrase,capsid,terminase,holin	Pseudomonas_phage(42.11%)	52	3145832:3145876	3185249:3185293
WP_027607903.1|3144272_3145859_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	29.0	8.4e-60
3145832:3145876	attL	GCATGGTGATGTTAGCTGTGGAGATCAATTACTTTACCTATCAAT	NA	NA	NA	NA
WP_141606272.1|3145879_3147073_-|integrase	tyrosine-type recombinase/integrase	integrase	J7HXC4	Pseudomonas_phage	57.7	2.9e-121
WP_141606273.1|3147285_3147537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141606274.1|3147533_3148040_-	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	61.9	4.3e-58
WP_141606275.1|3148036_3150028_-	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	69.1	3.3e-202
WP_141606276.1|3150020_3150611_-	phosphohydrolase	NA	A0A2D1GNL9	Pseudomonas_phage	41.3	1.3e-26
WP_141606277.1|3150607_3150829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141606278.1|3150825_3151224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141606279.1|3151323_3151566_-	transcriptional regulator	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	70.0	9.6e-24
WP_141606280.1|3151562_3151937_-	hypothetical protein	NA	A0A2H4J897	uncultured_Caudovirales_phage	73.4	1.4e-42
WP_141606281.1|3151933_3152209_-	hypothetical protein	NA	A0A2H4JBX5	uncultured_Caudovirales_phage	66.3	2.3e-26
WP_141606282.1|3152220_3152802_-	deoxynucleotide monophosphate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	79.5	9.8e-83
WP_141606283.1|3152798_3153002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141607670.1|3153140_3153992_-	helix-turn-helix domain-containing protein	NA	A0A0A0YR73	Pseudomonas_phage	47.8	2.2e-59
WP_141606284.1|3154139_3154349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141606285.1|3154487_3154976_+	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	70.3	1.4e-45
WP_141606286.1|3154968_3155172_+	transcriptional regulator	NA	A0A2H4JDJ0	uncultured_Caudovirales_phage	69.1	1.0e-18
WP_141606287.1|3155168_3157892_+	DNA primase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	61.6	0.0e+00
WP_141606288.1|3158199_3158478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141606289.1|3159230_3159719_+	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	45.5	1.1e-26
WP_141606290.1|3159998_3160343_+|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	84.3	2.0e-46
WP_141607671.1|3160407_3160692_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	50.5	1.6e-22
WP_141606291.1|3160847_3161381_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_141606292.1|3161343_3163161_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	39.3	6.4e-112
WP_141606293.1|3163157_3163337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141606294.1|3163339_3164611_+|portal	phage portal protein	portal	Q8W6U7	Burkholderia_virus	59.6	1.4e-142
WP_141606295.1|3164607_3165552_+	S49 family peptidase	NA	A4JX00	Burkholderia_virus	56.4	4.1e-94
WP_141606296.1|3165614_3166934_+|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	55.5	6.7e-127
WP_141606297.1|3166983_3167340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141606298.1|3167343_3167895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141606299.1|3167897_3168260_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	43.4	1.9e-20
WP_126588610.1|3168252_3168774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141606300.1|3168817_3169411_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	52.9	4.3e-49
WP_141606301.1|3169422_3169641_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	61.5	5.4e-10
WP_141606302.1|3169640_3171137_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	64.6	3.0e-176
WP_141606303.1|3171191_3171539_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_141606304.1|3171535_3171832_+|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	71.0	7.1e-29
WP_141606305.1|3171777_3171963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141606306.1|3171962_3173882_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	48.1	1.6e-108
WP_141606307.1|3173878_3175138_+	hypothetical protein	NA	B5TK71	Pseudomonas_phage	38.7	2.1e-69
WP_141606308.1|3175140_3176253_+|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	55.8	9.6e-103
WP_141606309.1|3176249_3176759_+|plate	phage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	66.7	2.5e-58
WP_141606310.1|3176758_3177148_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	48.4	3.0e-27
WP_141606311.1|3177137_3178181_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	42.2	8.5e-69
WP_141606312.1|3178171_3178813_+	DUF2313 domain-containing protein	NA	A0A2H4J9D6	uncultured_Caudovirales_phage	34.5	8.8e-24
WP_141606313.1|3179787_3181386_+	hypothetical protein	NA	A0A2H4J9C6	uncultured_Caudovirales_phage	44.9	7.8e-21
WP_141606314.1|3181389_3182235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141606315.1|3182302_3182836_+	glycoside hydrolase family 19 protein	NA	A0A059VA40	Pseudomonas_phage	79.1	1.2e-74
WP_141606316.1|3182832_3183144_+	ammonia monooxygenase	NA	G8GWD9	Rhodobacter_phage	56.9	1.3e-28
WP_141606317.1|3183146_3183659_+|lysis	lysis protein	lysis	A0A2H4IZW4	uncultured_Caudovirales_phage	66.1	3.7e-49
WP_141606318.1|3183808_3184603_+	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	64.7	2.5e-97
WP_141606319.1|3184620_3184980_-	hypothetical protein	NA	A0A2D1GNN8	Pseudomonas_phage	64.4	7.5e-33
3185249:3185293	attR	GCATGGTGATGTTAGCTGTGGAGATCAATTACTTTACCTATCAAT	NA	NA	NA	NA
>prophage 7
NZ_CP041236	Pseudomonas azotoformans strain P45A chromosome, complete genome	6884339	4191127	4201033	6884339	tRNA,protease	uncultured_Caudovirales_phage(71.43%)	12	NA	NA
WP_141606713.1|4191127_4191952_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	72.0	5.8e-105
WP_092488788.1|4192216_4192819_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_092488872.1|4192948_4193443_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_092488789.1|4193538_4194714_-	CoA transferase	NA	NA	NA	NA	NA
WP_092488790.1|4194871_4195264_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	78.5	9.3e-53
WP_027606352.1|4195265_4195616_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	66.9	2.0e-38
WP_141606714.1|4195615_4195894_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	55.6	1.3e-24
WP_092488793.1|4195890_4196226_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	76.6	2.3e-44
WP_141606715.1|4196222_4197224_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	85.7	8.5e-167
WP_141606716.1|4197312_4198308_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_092488796.1|4198357_4199752_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_141606717.1|4199752_4201033_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.8	1.1e-97
>prophage 8
NZ_CP041236	Pseudomonas azotoformans strain P45A chromosome, complete genome	6884339	6344609	6404296	6884339	protease,holin	Tupanvirus(16.67%)	55	NA	NA
WP_027605972.1|6344609_6345110_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_141607480.1|6345283_6346171_+	acyltransferase	NA	NA	NA	NA	NA
WP_141607481.1|6346167_6346740_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_141607482.1|6347232_6348207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098480810.1|6348207_6348561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005792122.1|6348607_6349807_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.3	1.4e-11
WP_065925438.1|6349927_6350785_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_141607483.1|6350795_6351428_-	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_141607484.1|6351551_6354569_-	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_003194855.1|6354565_6354868_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_141607485.1|6354883_6356134_-	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_065947481.1|6356156_6357410_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.5	8.6e-100
WP_141607486.1|6357585_6358314_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_141607487.1|6358404_6359445_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_065925442.1|6359531_6360632_-	glycine-betaine demethylase subunit GbcB	NA	NA	NA	NA	NA
WP_141607488.1|6360913_6362209_+	glycine-betaine demethylase subunit GbcA	NA	NA	NA	NA	NA
WP_027605985.1|6363094_6363589_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_053130968.1|6363563_6363944_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_092490321.1|6363969_6364437_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_141607489.1|6364509_6366012_+	chitin-binding protein	NA	V9XTU4	Choristoneura_murinana_nucleopolyhedrovirus	34.0	1.4e-24
WP_074847788.1|6366224_6366656_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_141607490.1|6366657_6367122_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_141607491.1|6367118_6368303_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_141607492.1|6368307_6369945_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_141607493.1|6369925_6370651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141607708.1|6370659_6371205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141607494.1|6371211_6371748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_092490310.1|6371744_6372236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_092490309.1|6372254_6374180_+	general secretion pathway protein GspD	NA	NA	NA	NA	NA
WP_027605998.1|6374299_6375070_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_141607495.1|6375080_6376301_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_092490306.1|6376300_6378244_-	dimethylglycine demethylation protein DgcB	NA	NA	NA	NA	NA
WP_065925458.1|6378400_6380461_-	dimethylglycine demethylation protein DgcA	NA	NA	NA	NA	NA
WP_027606002.1|6380476_6381007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010207105.1|6381059_6382037_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_027606004.1|6382258_6382660_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_141607496.1|6382701_6383118_+	DUF3010 family protein	NA	NA	NA	NA	NA
WP_141607497.1|6383124_6383553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115485624.1|6383783_6384959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_092355615.1|6385027_6386005_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_065947495.1|6386165_6387110_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_027606009.1|6387184_6388072_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_092490302.1|6388141_6389107_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_027606011.1|6389120_6389597_+	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_092490300.1|6389606_6390767_+	gamma-butyrobetaine dioxygenase	NA	NA	NA	NA	NA
WP_027606014.1|6391013_6391277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065925468.1|6391381_6392485_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_065938175.1|6392941_6394318_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_027606017.1|6394733_6395681_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_065925470.1|6395750_6396596_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_141607498.1|6396592_6397771_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	37.6	5.9e-26
WP_027606019.1|6397945_6399937_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	28.7	1.4e-19
WP_053128113.1|6400270_6400864_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_141607499.1|6400974_6402447_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_092490297.1|6402592_6404296_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.3	1.2e-51
