The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019738	Alistipes onderdonkii subsp. vulgaris strain 5NYCFAH2	3312682	406289	414945	3312682	tRNA	Clostridioides_phage(16.67%)	7	NA	NA
WP_022333401.1|406289_406490_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	41.7	1.7e-05
WP_022333400.1|406623_407589_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.6	3.6e-45
WP_022333399.1|407588_408335_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	45.5	3.8e-47
WP_022333398.1|408340_409105_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_022333397.1|409185_411618_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	39.7	4.9e-152
WP_141404841.1|411741_414369_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	39.8	1.0e-147
WP_055204612.1|414489_414945_+	ribonuclease HI	NA	A0A223LIW7	Erwinia_phage	42.3	2.4e-23
>prophage 2
NZ_AP019738	Alistipes onderdonkii subsp. vulgaris strain 5NYCFAH2	3312682	828544	873494	3312682	integrase,protease,transposase	Mycobacterium_phage(28.57%)	50	840717:840776	844190:844277
WP_141404906.1|828544_829762_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	36.2	9.4e-27
WP_055203986.1|829867_830167_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_055203988.1|830178_830508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039939501.1|830790_830991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141404907.1|830987_831641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055203994.1|831647_831860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015546439.1|831872_832172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015546438.1|832220_832544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015546437.1|832549_832987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141404908.1|833230_833653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055203996.1|833693_834002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141404909.1|834358_835150_+	ATP-binding domain-containing protein	NA	A0A218KCE8	Bacillus_phage	31.0	3.7e-16
WP_009597166.1|835257_835434_-	histone H1	NA	NA	NA	NA	NA
WP_015545962.1|835625_835967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022332386.1|836597_836993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141404910.1|837031_837376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141404911.1|837475_839530_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_009596289.1|839596_840028_+	hypothetical protein	NA	NA	NA	NA	NA
840717:840776	attL	GTCACTTATCCTAACTTTTATATTATTCCAACTAATCGTGCAATCGCCTGATATATAGAC	NA	NA	NA	NA
WP_141404912.1|840821_841874_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_162505887.1|841860_843135_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_141404856.1|843134_844100_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_141404914.1|844657_845488_+	DUF4121 family protein	NA	NA	NA	NA	NA
844190:844277	attR	GTCTATATATCAGGCGATTGCACGATTAGTTGGAATAATATAAAAGTTAGGATAAGTGACTTTATCCGAAATTTCGGATAAAATGGCG	NA	NA	NA	NA
WP_014775546.1|845774_846188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014774758.1|846184_847075_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	32.6	1.5e-26
WP_082430824.1|847493_848129_+	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_055204913.1|848315_849197_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_018696764.1|849341_850067_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_022332434.1|850218_850596_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_055204907.1|850601_851183_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	28.2	1.1e-09
WP_055204905.1|851189_851585_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_055204904.1|851581_852535_-	DMT family transporter	NA	NA	NA	NA	NA
WP_055204902.1|852584_853544_+	DMT family transporter	NA	NA	NA	NA	NA
WP_055204900.1|853613_855335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055204899.1|855409_856819_-	HD domain-containing protein	NA	A0A249XS88	Mycobacterium_phage	32.1	1.5e-31
WP_055204897.1|856823_857477_-	GDSL family lipase	NA	NA	NA	NA	NA
WP_055204895.1|857494_858211_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_055204893.1|858393_859272_+	NADH kinase	NA	NA	NA	NA	NA
WP_055204891.1|859353_860067_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	37.0	8.8e-17
WP_055204889.1|860093_862667_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_055204887.1|862839_863346_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_055204884.1|863373_863934_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_055211604.1|864126_865035_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_141404915.1|865147_867553_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_022332420.1|867560_868307_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_022332419.1|868443_869250_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_022332418.1|869269_869473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055204880.1|869483_870281_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	28.3	4.7e-11
WP_022332416.1|870315_872139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022332415.1|872285_872567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141404916.1|872684_873494_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
