The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041183	Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 chromosome, complete genome	4752859	1151477	1185605	4752859	capsid,head,holin,terminase,portal,tRNA,tail	Cronobacter_phage(73.33%)	40	NA	NA
WP_000469807.1|1151477_1152245_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1152284_1152632_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1152788_1154009_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212380.1|1154001_1154520_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1154959_1156030_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|1156039_1157161_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210990.1|1157218_1158127_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|1158087_1159248_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1159347_1159395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000185337.1|1160616_1160922_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
WP_000661531.1|1161019_1161358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645096.1|1161383_1161716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681787.1|1161725_1162295_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	2.6e-43
WP_000922120.1|1162297_1162516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000994501.1|1162554_1165212_+	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	47.5	1.2e-244
WP_000088096.1|1165239_1165563_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_000746494.1|1165562_1166582_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.3e-135
WP_001151938.1|1166578_1168363_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	69.7	1.8e-247
WP_000273112.1|1168420_1169410_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
WP_001176503.1|1169444_1170473_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1170484_1171183_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1171281_1171734_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000080871.1|1171730_1172213_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_000606933.1|1172209_1172914_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	4.0e-70
WP_000220184.1|1172910_1174038_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	8.1e-174
WP_000166745.1|1174034_1174490_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_001154426.1|1174502_1174799_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000175558.1|1174795_1175137_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376378.1|1175136_1175469_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
WP_001747519.1|1175395_1175629_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
WP_000411500.1|1175615_1175873_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811100.1|1176060_1178028_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
WP_001002797.1|1178024_1178354_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136927.1|1178350_1179535_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.6	5.1e-179
WP_001001824.1|1179527_1180115_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_000084303.1|1180124_1182137_+|tail	tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1182139_1182670_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|1182659_1183385_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|1183356_1183902_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_001747522.1|1183904_1185605_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
>prophage 2
NZ_CP041183	Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 chromosome, complete genome	4752859	1220052	1260597	4752859	plate,tail,holin,lysis,integrase,protease	Salmonella_phage(46.81%)	55	1211922:1211937	1243034:1243049
1211922:1211937	attL	CATGAACTGACGCGTG	NA	NA	NA	NA
WP_001007935.1|1220052_1221282_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	6.4e-233
WP_014344516.1|1221259_1221544_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	87.2	1.1e-42
WP_001237033.1|1221584_1221824_-	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	96.2	1.8e-35
WP_077906754.1|1221866_1223024_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	97.9	1.2e-212
WP_141168505.1|1222986_1225914_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	86.3	0.0e+00
WP_141168506.1|1226622_1226829_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	66.2	1.3e-16
WP_079963464.1|1226855_1227290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|1227291_1227717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1227759_1228155_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1228259_1228496_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_074421601.1|1228461_1228836_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	3.3e-63
WP_000024048.1|1228927_1229833_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
WP_000788827.1|1229829_1230522_+	Replication protein 14	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
WP_024155039.1|1230536_1230971_+	ead/Ea22-like family protein	NA	G9L663	Escherichia_phage	64.4	8.0e-13
WP_000704096.1|1230997_1231990_-	peptidase M85	NA	NA	NA	NA	NA
WP_001217669.1|1232258_1232492_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_031610564.1|1232608_1232857_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	98.8	1.8e-41
WP_000929788.1|1232891_1233494_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_079846525.1|1233493_1233700_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	98.5	1.0e-34
WP_023194651.1|1233702_1234314_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	97.0	2.7e-91
WP_000801757.1|1234310_1234451_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_117158559.1|1234447_1235125_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	1.9e-61
WP_072095218.1|1235121_1235307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079963540.1|1235397_1235961_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1236467_1236656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110787.1|1236869_1237556_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	3.6e-132
WP_001574216.1|1237831_1238161_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984584.1|1238144_1238597_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_000971525.1|1238593_1239064_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	73.9	2.7e-54
WP_016716096.1|1239507_1240134_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	97.6	2.0e-105
WP_016716095.1|1240136_1241756_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	81.2	7.3e-261
WP_141168507.1|1241755_1243276_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.5	1.4e-104
1243034:1243049	attR	CATGAACTGACGCGTG	NA	NA	NA	NA
WP_016716093.1|1243316_1244006_+	phage protein F	NA	H9C0V1	Aeromonas_phage	48.9	8.4e-57
WP_016716092.1|1244002_1245349_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.5	5.5e-68
WP_023260969.1|1245350_1245833_+	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	41.2	2.6e-20
WP_001031913.1|1245832_1246861_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_000829560.1|1246864_1247212_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
WP_000537614.1|1247218_1247665_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.6	2.3e-15
WP_000247613.1|1247658_1248243_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.3	2.1e-16
WP_001048637.1|1248239_1248605_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
WP_000094504.1|1248589_1249135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016716087.1|1249115_1250600_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	3.1e-96
WP_000016414.1|1250600_1251047_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|1251046_1251451_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228831.1|1251492_1251675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141168508.1|1251658_1252177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077915164.1|1252830_1253829_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	6.5e-50
WP_000890115.1|1254534_1254837_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|1254833_1255703_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_016716086.1|1255683_1256361_+|plate	phage baseplate assembly protein V	plate	A0A077KAY0	Edwardsiella_phage	36.4	1.9e-32
WP_001191865.1|1256373_1256730_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_001293657.1|1256726_1257968_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_001181747.1|1257969_1258572_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
WP_000772810.1|1258561_1260013_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	72.8	1.7e-46
WP_060634012.1|1260012_1260597_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.3	6.6e-87
>prophage 3
NZ_CP041183	Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 chromosome, complete genome	4752859	1794742	1801039	4752859		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1794742_1796146_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1796323_1797217_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1797593_1798679_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1798678_1799578_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1799625_1800504_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1800508_1801039_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 4
NZ_CP041183	Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 chromosome, complete genome	4752859	1907187	1918572	4752859	integrase	Stenotrophomonas_phage(25.0%)	12	1906605:1906618	1910189:1910202
1906605:1906618	attL	GCCAGCTTTGCCCC	NA	NA	NA	NA
WP_023244267.1|1907187_1908450_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.3	1.5e-75
WP_023243861.1|1909095_1909386_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	1.8e-08
WP_000598920.1|1909757_1910555_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1910189:1910202	attR	GCCAGCTTTGCCCC	NA	NA	NA	NA
WP_000500830.1|1911035_1911197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243860.1|1911323_1911743_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1911745_1913014_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1913468_1913681_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1913691_1913880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1914139_1915333_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1915981_1916293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|1916372_1917068_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1917141_1918572_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP041183	Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 chromosome, complete genome	4752859	2021820	2028434	4752859	integrase	Pectobacterium_phage(16.67%)	11	2024030:2024052	2036152:2036174
WP_000856224.1|2021820_2022051_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2022188_2022563_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|2022563_2023439_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2023455_2023809_+	YebY family protein	NA	NA	NA	NA	NA
2024030:2024052	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|2024180_2025260_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|2025256_2026363_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|2026393_2026624_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|2026677_2027211_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2027467_2027635_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2027699_2027888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|2027942_2028434_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
2036152:2036174	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP041183	Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 chromosome, complete genome	4752859	2635558	2722869	4752859	capsid,head,holin,terminase,portal,tRNA,integrase,lysis,tail,protease	Salmonella_phage(41.18%)	105	2656205:2656221	2722388:2722404
WP_000829543.1|2635558_2636086_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|2636082_2636190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2636395_2636842_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2636821_2637616_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2637716_2638901_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2639019_2639367_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|2639352_2639664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2639732_2639984_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2640179_2640278_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2640416_2640665_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532450.1|2640672_2640858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001532438.1|2640978_2641620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2641849_2642032_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2642034_2642397_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2642569_2643208_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|2643403_2643949_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|2644031_2644187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|2644265_2644514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2644768_2645617_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|2645685_2646279_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|2646423_2647212_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_000234684.1|2647319_2647970_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2648163_2648490_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|2648683_2649817_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|2649898_2650489_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|2650482_2651280_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
WP_000966637.1|2651273_2652086_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|2652075_2653050_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946091.1|2653049_2654684_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2655365_2655680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|2655828_2656359_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2656205:2656221	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_021000256.1|2656441_2657485_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001525268.1|2657823_2658294_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|2658443_2658716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|2658915_2659041_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977725.1|2659418_2659763_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2660984_2661542_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|2662353_2662617_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2662748_2662961_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2663375_2663897_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|2664087_2664327_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_000787625.1|2665925_2666132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|2666599_2667724_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|2668170_2668383_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334551.1|2668636_2669308_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.1e-80
WP_000457876.1|2673271_2673397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520426.1|2673659_2673776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031609383.1|2673966_2674167_+	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000143179.1|2674263_2674848_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
WP_001521136.1|2674847_2677289_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	61.8	9.5e-87
WP_000178851.1|2677342_2677585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514901.1|2677623_2680986_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.6	0.0e+00
WP_000662740.1|2681592_2682330_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
WP_000447370.1|2683043_2683373_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_000372079.1|2683375_2686417_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	65.0	8.0e-293
WP_010989052.1|2686388_2686727_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2686723_2687119_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971845.1|2687169_2687916_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	5.7e-99
WP_000033885.1|2687923_2688325_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000677089.1|2688321_2688900_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000201486.1|2689273_2689633_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2689690_2690719_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2690773_2691121_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189495.1|2691133_2692630_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.9	3.3e-98
WP_000831820.1|2692619_2694200_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	1.2e-188
WP_000201416.1|2694196_2694400_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	70.8	2.1e-16
WP_000623090.1|2694383_2696315_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	2.4e-258
WP_001102153.1|2696286_2696832_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669693.1|2697117_2697519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031607976.1|2697755_2698202_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	9.3e-65
WP_001574216.1|2698654_2698984_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110785.1|2699259_2699946_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	3.6e-132
WP_000798706.1|2700306_2700756_+	lipoprotein	NA	NA	NA	NA	NA
WP_001534733.1|2700891_2701017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047630.1|2701415_2702213_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_001617856.1|2702202_2702349_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096558.1|2702345_2702957_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_001241019.1|2702959_2703166_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929790.1|2703165_2703768_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|2703802_2704051_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2704167_2704401_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000802853.1|2704648_2704975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107251218.1|2705068_2705137_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_000132543.1|2705117_2706335_-	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
WP_000974174.1|2706645_2706891_-	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
WP_000065089.1|2706890_2707211_-	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
WP_000113626.1|2707207_2707555_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
WP_000800015.1|2707565_2708315_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	99.6	2.5e-139
WP_001520662.1|2708317_2709301_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	5.6e-163
WP_010835408.1|2709385_2709760_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_001274939.1|2709719_2709962_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	67.9	5.6e-24
WP_024133227.1|2710034_2710448_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	78.0	8.9e-46
WP_000106861.1|2710590_2711700_+	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	58.4	1.6e-118
WP_022742800.1|2712372_2712723_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_068938196.1|2712849_2715288_+	exonuclease VIII	NA	H6WRX1	Salmonella_phage	68.3	6.7e-258
WP_001126032.1|2715280_2716111_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033922.1|2716146_2716467_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
WP_023221268.1|2716787_2717291_+	hypothetical protein	NA	A0A075B8H2	Enterobacteria_phage	92.3	6.0e-36
WP_000089141.1|2717340_2717577_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|2717566_2718709_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444509.1|2718822_2720073_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|2720244_2720910_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|2720906_2721236_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|2721247_2721709_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2721762_2722869_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2722388:2722404	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 7
NZ_CP041183	Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 chromosome, complete genome	4752859	2992216	3001227	4752859	integrase,protease	Ralstonia_phage(16.67%)	9	2990611:2990623	3009789:3009801
2990611:2990623	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|2992216_2993458_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_071604632.1|2993424_2993613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243338.1|2993984_2994362_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|2994523_2994721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2994933_2997210_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2997240_2997561_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2997883_2998105_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|2998234_3000181_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_115200409.1|3000177_3001227_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.3e-08
3009789:3009801	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 8
NZ_CP041183	Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 chromosome, complete genome	4752859	4345481	4390259	4752859	tail,tRNA,plate	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4345481_4346480_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|4346567_4347878_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4348124_4348640_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4348739_4348949_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4348970_4349084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4349080_4350406_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4350584_4351193_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4351301_4351670_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4351840_4354261_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4354359_4355232_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4355245_4355743_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|4355923_4356841_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4357004_4358363_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4358451_4359561_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4359922_4361113_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|4361244_4362789_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|4362803_4363694_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4363859_4364270_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4364412_4366509_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4366508_4367246_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4367242_4367911_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4367944_4368187_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4368630_4370280_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4370624_4371974_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4372104_4372452_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4373027_4373315_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4373317_4373923_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4373935_4374250_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4374409_4374865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|4374861_4375059_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|4375048_4376476_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|4376475_4377000_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4377051_4377369_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4377328_4377457_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4377553_4379908_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4379907_4380861_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4380860_4381070_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4381057_4382101_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4382110_4382833_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4383160_4383523_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4383519_4384449_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4384448_4385996_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4386159_4386519_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4386509_4387625_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4387617_4388250_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4388252_4389734_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|4389743_4390259_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
