The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041181	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food chromosome, complete genome	4776397	628220	683575	4776397	holin,integrase,capsid,terminase,head,plate,tRNA,portal,tail	Cronobacter_phage(65.0%)	61	637421:637442	685884:685905
WP_023226578.1|628220_628619_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031219.1|628621_628927_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877297.1|628968_629337_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917512.1|629481_629865_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422141.1|629868_630531_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|630980_632225_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098833.1|632479_633448_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_023226577.1|633717_634716_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951045.1|634803_635496_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|635647_636145_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_023226576.1|636230_637367_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
637421:637442	attL	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
WP_023226575.1|637447_639466_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|639636_641016_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_064441647.1|641445_642966_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_089541743.1|645077_645725_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023226573.1|645956_646724_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_001748617.1|646934_647972_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|647958_648852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|648880_649459_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|649578_649800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|649830_650334_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|650343_650571_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_024139063.1|650560_650986_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|650985_651387_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|651533_651710_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|651700_652297_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|652293_652623_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|652612_653473_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|653469_655491_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748628.1|655610_655817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|655790_656114_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|656110_657172_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|657168_658944_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|659104_659905_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|659966_660989_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|660992_661697_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|661700_661895_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_023181179.1|661991_662444_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	2.3e-63
WP_000084220.1|662440_662947_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|662943_663651_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|663647_664775_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|664771_665227_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|665236_665530_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|665526_665868_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|665867_666200_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|666346_666604_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_051129153.1|666791_668762_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|668758_669088_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|669084_670269_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|670261_670849_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|670858_672871_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|672873_673404_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|673393_674119_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|674090_674636_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_089541748.1|674635_676339_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.9e-223
WP_001128281.1|676926_677088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|677510_678017_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|678140_679988_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|680137_681883_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|682118_682334_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023200351.1|682561_683575_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
685884:685905	attR	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
NZ_CP041181	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food chromosome, complete genome	4776397	1179424	1260725	4776397	integrase,holin,capsid,terminase,head,plate,tRNA,portal,tail	Cronobacter_phage(51.22%)	82	1187401:1187416	1215091:1215106
WP_000469807.1|1179424_1180192_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1180232_1180580_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1180735_1181956_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_089541747.1|1181948_1182467_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1182906_1183977_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1183986_1185108_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1185165_1186074_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1186034_1187195_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1187294_1187342_-	hypothetical protein	NA	NA	NA	NA	NA
1187401:1187416	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1187505_1188498_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1188564_1188864_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1188972_1189311_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1189336_1189669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1189678_1190248_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1190250_1190469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1190507_1193165_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_001264830.1|1193192_1193462_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	78.4	5.1e-34
WP_054175273.1|1193515_1194535_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1194531_1196316_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|1196526_1197363_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1197397_1198426_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1198437_1199136_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1199234_1199687_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000080871.1|1199683_1200166_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1200162_1200867_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1200863_1201991_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1201987_1202443_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1202455_1202752_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1202748_1203090_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1203089_1203422_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1203568_1203826_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1204013_1205981_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1205977_1206307_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1206303_1207488_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1207480_1208068_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1208077_1210090_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1210092_1210623_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|1210612_1211338_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|1211309_1211855_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_089541748.1|1211854_1213558_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.9e-223
WP_001748131.1|1214591_1214978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1215135_1215474_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1215091:1215106	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1215745_1216483_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1216614_1217595_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1217591_1218323_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1218452_1221026_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1226974_1227430_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1227533_1228835_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1228831_1229155_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1229199_1230555_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1230669_1233330_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1233383_1234064_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1234136_1234556_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1234759_1235797_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1235912_1236602_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1236920_1237304_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1237365_1237953_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1238055_1238955_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1238972_1240307_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1240436_1241174_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1241158_1242781_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1243044_1243209_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1243205_1243781_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1243812_1244463_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1244462_1245419_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1245415_1245895_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1246146_1247946_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1247962_1248937_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1249210_1249891_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1249887_1250793_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1250804_1251533_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1251544_1252276_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1252275_1252656_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1252767_1253028_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1253065_1253992_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1254107_1255304_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023227281.1|1255325_1256243_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1256280_1257129_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1257244_1258138_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1258148_1259510_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1259513_1260149_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1260173_1260725_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041181	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food chromosome, complete genome	4776397	1472460	1479321	4776397	transposase	Salmonella_virus(42.86%)	7	NA	NA
WP_106417237.1|1472460_1472607_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_109166850.1|1472622_1472766_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
WP_023226601.1|1473755_1475678_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	3.9e-301
WP_000703601.1|1475684_1475951_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
WP_023226602.1|1475919_1476309_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_001067855.1|1476420_1477125_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001590337.1|1478379_1479321_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
>prophage 4
NZ_CP041181	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food chromosome, complete genome	4776397	1710889	1720060	4776397	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1710889_1711837_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1711820_1712552_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1712532_1712640_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1712699_1713431_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1713653_1715339_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1715335_1716055_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1716101_1716569_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1716625_1717156_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1717327_1717786_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1718026_1720060_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 5
NZ_CP041181	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food chromosome, complete genome	4776397	1833937	1844444	4776397		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1833937_1835341_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1835518_1836412_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1836788_1837874_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1837873_1838773_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1838820_1839699_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1839699_1840251_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1840256_1841231_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1841246_1842020_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1842024_1843104_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1843130_1844444_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP041181	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food chromosome, complete genome	4776397	1954566	1965856	4776397	integrase	Burkholderia_phage(25.0%)	12	1948820:1948835	1963167:1963182
1948820:1948835	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|1954566_1955748_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|1955748_1956495_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|1956596_1957853_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|1958333_1958495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1958621_1959041_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|1959043_1960312_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|1960766_1960979_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1960989_1961178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|1961436_1962615_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|1963265_1963577_+	hypothetical protein	NA	NA	NA	NA	NA
1963167:1963182	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|1963656_1964352_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|1964425_1965856_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP041181	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food chromosome, complete genome	4776397	2146605	2185761	4776397	integrase,transposase,protease	Shigella_phage(37.5%)	30	2163042:2163058	2177629:2177645
WP_023227614.1|2146605_2147202_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000147031.1|2147198_2147930_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000070982.1|2147948_2149742_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023227615.1|2149738_2150857_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_023227616.1|2151350_2152616_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_089541817.1|2155178_2156406_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000136607.1|2157844_2160355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442952.1|2160358_2162923_+	hypothetical protein	NA	NA	NA	NA	NA
2163042:2163058	attL	TCAAACTGTTTTATTGA	NA	NA	NA	NA
WP_000716184.1|2163229_2163544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232453.1|2163555_2164074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108266.1|2164127_2164655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442951.1|2164667_2164937_-	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
WP_000093666.1|2165057_2165438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174655.1|2165595_2166138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142750.1|2166160_2166649_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_050516501.1|2166776_2167172_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_019841938.1|2167232_2167592_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000744655.1|2167701_2168319_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000213673.1|2168395_2169343_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.2e-10
WP_000870315.1|2169556_2170003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2170267_2170462_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000468111.1|2170463_2171336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165488789.1|2171545_2172774_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	3.2e-176
WP_131186985.1|2173030_2176933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087212.1|2177254_2178940_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
2177629:2177645	attR	TCAATAAAACAGTTTGA	NA	NA	NA	NA
WP_000151475.1|2178949_2179615_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000699006.1|2179615_2181013_-	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_080229793.1|2182930_2183710_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.1e-137
WP_069067343.1|2184351_2184690_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001443045.1|2184609_2185761_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
>prophage 8
NZ_CP041181	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food chromosome, complete genome	4776397	2280093	2285905	4776397		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2280093_2280900_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2280901_2281894_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2281893_2282784_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2282907_2283309_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_170967352.1|2283608_2284493_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2284802_2285072_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2285426_2285567_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2285605_2285905_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 9
NZ_CP041181	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food chromosome, complete genome	4776397	2749846	2757309	4776397	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2749846_2750086_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023226907.1|2750959_2751769_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2751841_2752219_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2752366_2752909_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2753100_2753829_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2753845_2754259_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2755209_2756334_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2756850_2757309_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 10
NZ_CP041181	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food chromosome, complete genome	4776397	3581742	3627982	4776397	protease,coat,integrase,terminase,transposase,lysis,portal	Enterobacteria_phage(73.13%)	68	3581409:3581454	3624091:3624136
3581409:3581454	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3581742_3582105_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3582101_3583034_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3583023_3584481_+	glucosyltransferase domain-containing protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3584539_3586543_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3586678_3586927_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3586947_3587241_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3587379_3589356_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3589355_3590792_-	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3590802_3591492_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3591494_3591950_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3591949_3592651_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3592654_3594073_-	packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3594032_3594533_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3594516_3595077_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3595117_3596410_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_051129359.1|3596409_3597318_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	94.1	4.3e-149
WP_051129358.1|3597331_3599497_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_051129357.1|3599497_3600997_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	9.1e-306
WP_000729923.1|3600974_3601463_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3601466_3601871_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3601870_3602260_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3602263_3602506_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3602728_3603259_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3603471_3603939_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_089541817.1|3604356_3605585_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000286100.1|3605746_3605950_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3606380_3607154_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3607150_3607330_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3607310_3607514_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3607510_3607735_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3607731_3608343_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3608335_3608512_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3608504_3608846_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3608848_3609025_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3608991_3609165_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3609161_3609599_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3609672_3609942_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3609938_3611315_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3611311_3612133_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_000166961.1|3612119_3612281_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001103492.1|3612315_3612597_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3612707_3612923_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3613033_3613723_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3613887_3614967_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3615005_3615209_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3615572_3615875_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3615887_3616475_-	super-infection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3616688_3616883_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_072097849.1|3616966_3617581_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	94.4	7.0e-47
WP_000713613.1|3617614_3617902_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3618177_3618492_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3618576_3618735_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_051129356.1|3618715_3618871_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	4.7e-24
WP_000902092.1|3618893_3619037_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3619033_3619741_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3619740_3620025_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3620071_3620365_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3620375_3620546_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3620542_3621052_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3621048_3621282_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_025617570.1|3621268_3621913_+	ead/Ea22-like family protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3621912_3622197_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3622189_3622474_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3622542_3622683_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3622912_3624076_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893225.1|3624281_3625532_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3624091:3624136	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3625543_3626647_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3626929_3627982_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 1
NZ_CP041182	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food plasmid p13520, complete sequence	240209	120040	181489	240209	transposase,protease	Escherichia_phage(31.82%)	63	NA	NA
WP_042634304.1|120040_121120_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|121121_121895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|121887_123030_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|123039_124098_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_042634303.1|124421_125003_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|125002_126160_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007448.1|126182_126638_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|126660_127701_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|127749_128328_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|128395_128971_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|129399_130641_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000077926.1|131203_131485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|131534_131726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151575.1|131817_132159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|132531_132924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|133527_133821_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|133825_135151_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|135211_135418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|135519_135930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|135942_136758_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_001043843.1|137011_137437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572440.1|138185_138485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192809.1|138797_140837_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	2.5e-24
WP_001572342.1|140833_141820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194555.1|142850_143054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287392.1|143395_143800_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000175476.1|144297_144534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|144575_145031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|145090_145756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|145813_146194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|146836_147655_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|147651_148857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|149136_150456_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000220758.1|150478_150646_-	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000833382.1|150706_152134_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|152348_152864_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|152866_153763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|153984_154218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|154879_155110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|155446_155908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|155937_156345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|156395_156713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|157089_157440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001214976.1|159289_159697_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|159834_160719_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001493765.1|160750_161950_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001493764.1|162055_162706_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001067855.1|164616_165321_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|165381_166218_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|166217_167021_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|167081_167897_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000240536.1|168203_169055_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|169810_170515_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|171112_171973_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|172557_173262_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839979.1|173327_173846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|173850_174267_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|174652_175357_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013362812.1|177107_178076_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_013188475.1|178110_178986_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_001067855.1|179496_180201_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|180318_180522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|180649_181489_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
