The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041176	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 chromosome, complete genome	4679991	1415004	1421057	4679991		Salmonella_virus(50.0%)	6	NA	NA
WP_105789229.1|1415004_1415172_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
WP_105789228.1|1415187_1415331_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_000400616.1|1416320_1418243_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_000703599.1|1418260_1418515_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|1418483_1418873_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000377779.1|1420115_1421057_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 2
NZ_CP041176	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 chromosome, complete genome	4679991	1657490	1666661	4679991	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1657490_1658438_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1658421_1659153_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1659133_1659241_-	protein YohO	NA	NA	NA	NA	NA
WP_001240420.1|1659300_1660032_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
WP_000272845.1|1660254_1661940_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1661936_1662656_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1662702_1663170_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1663226_1663757_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1663928_1664387_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1664627_1666661_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP041176	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 chromosome, complete genome	4679991	1733859	1744366	4679991		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1733859_1735263_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1735440_1736334_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1736710_1737796_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1737795_1738695_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1738742_1739621_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1739621_1740173_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1740178_1741153_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1741168_1741942_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1741946_1743026_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1743052_1744366_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP041176	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 chromosome, complete genome	4679991	1851361	1904785	4679991	head,protease,plate,tail,capsid,holin,integrase,terminase,portal,transposase	Salmonella_phage(76.36%)	65	1860190:1860204	1908380:1908394
WP_001127942.1|1851361_1853200_+|tail	tail fiber protein	tail	I1TR70	Cronobacter_phage	49.0	1.0e-32
WP_000028416.1|1853773_1854655_-	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	42.0	3.3e-29
WP_000072670.1|1855065_1855629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001084817.1|1855990_1856488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042271.1|1856966_1857218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001680077.1|1857289_1858564_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
WP_000598920.1|1859889_1860687_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1860190:1860204	attL	AGGGATGCCGCTGGC	NA	NA	NA	NA
WP_000532847.1|1860978_1861968_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|1861969_1862197_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061370.1|1862236_1862806_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_000208076.1|1862802_1863666_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_000267991.1|1863662_1863956_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000065085.1|1864227_1864587_-	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000071068.1|1864583_1865099_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000764235.1|1865095_1865326_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1865396_1865936_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000551790.1|1866030_1866948_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_000078504.1|1867517_1867769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067433.1|1867844_1868030_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_001020644.1|1868235_1868931_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_001191666.1|1869028_1869253_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509728.1|1869281_1869836_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
WP_001087406.1|1869832_1870990_+	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_000620702.1|1870986_1871211_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000096529.1|1871207_1872182_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000054227.1|1872178_1872652_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_000200166.1|1872648_1873530_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000779149.1|1873538_1873928_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_001061459.1|1873944_1874805_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
WP_012543375.1|1874812_1875802_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_001047141.1|1875815_1876568_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
WP_000357930.1|1876617_1877691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765639.1|1877703_1878276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294874.1|1878364_1878754_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000226304.1|1878740_1879022_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001075993.1|1879021_1879639_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000127618.1|1879635_1880175_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001135228.1|1880198_1880549_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000501481.1|1880695_1881133_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_000257219.1|1881132_1882863_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
WP_000838395.1|1882859_1883018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077905357.1|1883134_1884229_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000003793.1|1884221_1884824_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_000766103.1|1884833_1886063_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000927251.1|1886142_1886466_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000776844.1|1886462_1886867_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_001135695.1|1886838_1887351_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000779215.1|1887347_1887908_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_000497739.1|1887911_1888076_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007993.1|1888065_1889562_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000515952.1|1889561_1889918_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1889914_1890241_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785387.1|1890325_1892254_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000863817.1|1892287_1893628_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_001066630.1|1893624_1894683_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273650.1|1894682_1895216_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_000605050.1|1895220_1895634_+	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001699732.1|1895626_1896706_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	5.5e-204
WP_001207832.1|1896708_1897296_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554738.1|1897282_1898845_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	9.8e-287
WP_015701331.1|1898814_1899414_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000492926.1|1899698_1900706_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1900918_1901140_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_001176778.1|1902482_1903301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028172.1|1903762_1904785_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
1908380:1908394	attR	AGGGATGCCGCTGGC	NA	NA	NA	NA
>prophage 5
NZ_CP041176	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 chromosome, complete genome	4679991	2436971	2452915	4679991	holin,tRNA	Escherichia_phage(64.71%)	23	NA	NA
WP_001082296.1|2436971_2437406_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2437455_2437794_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000729249.1|2438433_2438607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000802786.1|2438639_2439185_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2439181_2439463_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2439452_2439641_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2439562_2439958_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2442128_2442665_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2442661_2442952_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2442951_2443551_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000734094.1|2443613_2443784_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000882662.1|2444074_2444287_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556390.1|2444656_2445589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2445585_2446140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2446301_2446631_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2446903_2447371_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2447755_2447911_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2448018_2448540_-	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_000560208.1|2448977_2449199_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2449283_2449601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2449628_2450246_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2450562_2451498_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2451541_2452915_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP041176	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 chromosome, complete genome	4679991	2644205	2693455	4679991	protease,tail,holin,integrase,lysis	Salmonella_phage(27.27%)	48	2673970:2673999	2693591:2693620
WP_000984498.1|2644205_2645087_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|2645280_2647329_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2647348_2648035_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|2648132_2648630_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2648758_2650042_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_164092565.1|2650010_2652644_+	MCE family protein	NA	NA	NA	NA	NA
WP_001531515.1|2652721_2654161_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2654278_2654515_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|2654625_2654817_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986173.1|2654835_2655486_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_001134856.1|2655709_2655874_-	membrane protein	NA	NA	NA	NA	NA
WP_000182071.1|2656158_2656881_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|2657564_2657960_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|2658289_2658766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025515.1|2659138_2659558_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001576019.1|2659930_2660200_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001576018.1|2660365_2660506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2663644_2664559_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2664691_2664850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|2664859_2665474_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000951652.1|2665961_2666108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|2666608_2666734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012543349.1|2667303_2667504_+	phage encoded PagK	NA	NA	NA	NA	NA
WP_001687735.1|2667600_2668101_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_000348541.1|2670205_2670697_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_001576014.1|2670751_2670940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2671004_2671172_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|2671428_2671962_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_001013467.1|2672015_2672246_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_077681935.1|2672435_2672930_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
WP_000622159.1|2673573_2673843_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	47.8	2.7e-11
2673970:2673999	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_001536069.1|2674787_2675588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|2676067_2676790_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001152416.1|2680844_2681540_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2681629_2682163_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2683057_2683537_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2683554_2684007_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2683990_2684320_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2684595_2685282_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2685642_2686092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2686465_2686990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2687086_2687776_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2687905_2688133_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2688129_2688729_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000911593.1|2688792_2689041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2689729_2691709_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2692122_2692401_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2692375_2693455_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2693591:2693620	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP041176	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 chromosome, complete genome	4679991	2865846	2906113	4679991	protease,tail	Salmonella_phage(23.08%)	39	NA	NA
WP_000938186.1|2865846_2866527_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2867145_2867805_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2867891_2868221_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2868217_2868499_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2868547_2869327_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2869352_2869901_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2870115_2871327_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2871384_2871702_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001676378.1|2871746_2872160_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2872333_2872996_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2873090_2873549_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2873584_2875639_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2875762_2876209_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2876227_2878381_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_066038538.1|2878367_2878973_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2879189_2879699_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2880055_2881108_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2881179_2881632_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2881817_2883578_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2883646_2884165_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2884264_2884432_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2884687_2885251_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2885247_2886888_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2886892_2888146_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2888160_2890068_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2890080_2892189_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2892287_2893397_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2893393_2893936_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2894101_2895112_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2895319_2897932_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2898358_2898550_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2898820_2899507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2899866_2900493_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2901140_2902109_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2902334_2902583_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2902586_2903168_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2903167_2904877_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2904873_2905500_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2905483_2906113_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
>prophage 8
NZ_CP041176	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 chromosome, complete genome	4679991	2977823	2985136	4679991	protease,integrase	Ralstonia_phage(16.67%)	7	2972620:2972634	2983872:2983886
2972620:2972634	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2977823_2978201_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2978362_2978560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2978772_2981049_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2981079_2981400_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2981723_2981945_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2982074_2984021_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2983872:2983886	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2984017_2985136_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP041177	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence	111764	318	21304	111764	transposase,integrase	Escherichia_phage(37.5%)	25	6588:6647	17723:17866
WP_072648941.1|318_1518_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_024129958.1|2003_2357_-	DNA distortion protein 3	NA	NA	NA	NA	NA
WP_001074384.1|2493_2940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435064.1|2943_3786_-	replication initiation protein	NA	NA	NA	NA	NA
WP_024129959.1|3806_4646_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000121743.1|5880_6132_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000220561.1|6121_6403_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
6588:6647	attL	CGGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_072648941.1|6899_8099_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|8108_8297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|8526_8631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|8759_9017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|9074_9851_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|9847_10591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|10641_10992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246635.1|11671_12667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991830.1|12670_13603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|13706_14411_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_049824851.1|14420_14891_+	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_014839978.1|14910_15699_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014839979.1|15698_16217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|16221_16638_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|17023_17728_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013023839.1|18779_19256_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
17723:17866	attR	ATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCAC	NA	NA	NA	NA
WP_015387340.1|19302_20178_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001067858.1|20599_21304_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP041177	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence	111764	80573	109205	111764	transposase	Escherichia_phage(62.5%)	26	NA	NA
WP_072648941.1|80573_81773_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|81782_81971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557619.1|82390_82648_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|82580_82982_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|84292_84997_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063865358.1|86668_87844_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA2	NA	NA	NA	NA	NA
WP_001067855.1|88226_88931_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|90827_91832_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|92013_92190_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|92519_93335_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|93395_94199_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|94198_95035_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_058914914.1|95340_95586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001493764.1|95614_96265_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032153701.1|96370_97570_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|97836_98142_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023300759.1|98169_99384_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_021598067.1|99600_100485_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|100515_102009_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|102219_102444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|102440_103178_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|103663_103804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|103809_104514_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|105530_106235_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000888203.1|107932_108412_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|108500_109205_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
NZ_CP041178	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367B, complete sequence	59372	39585	46493	59372	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925628.1|39585_40008_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|40007_41282_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000064277.1|41363_42338_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	5.1e-84
WP_000427676.1|42337_43543_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|43957_44899_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|44895_45501_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|45557_45893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|46076_46493_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
