The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041179	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food chromosome, complete genome	4775876	628142	683497	4775876	holin,portal,tRNA,integrase,capsid,head,plate,terminase,tail	Cronobacter_phage(65.0%)	61	637343:637364	685806:685827
WP_023226578.1|628142_628541_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031219.1|628543_628849_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877297.1|628890_629259_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917512.1|629403_629787_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422141.1|629790_630453_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|630902_632147_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098833.1|632401_633370_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_023226577.1|633639_634638_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951045.1|634725_635418_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|635569_636067_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_023226576.1|636152_637289_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
637343:637364	attL	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
WP_023226575.1|637369_639388_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|639558_640938_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_064441647.1|641367_642888_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_089541743.1|644999_645647_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023226573.1|645878_646646_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_001748617.1|646856_647894_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|647880_648774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|648802_649381_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|649500_649722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|649752_650256_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|650265_650493_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_024139063.1|650482_650908_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|650907_651309_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|651455_651632_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|651622_652219_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|652215_652545_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|652534_653395_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|653391_655413_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748628.1|655532_655739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|655712_656036_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|656032_657094_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|657090_658866_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|659026_659827_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|659888_660911_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|660914_661619_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|661622_661817_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_023181179.1|661913_662366_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	2.3e-63
WP_000084220.1|662362_662869_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|662865_663573_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|663569_664697_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|664693_665149_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|665158_665452_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|665448_665790_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|665789_666122_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|666268_666526_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_051129153.1|666713_668684_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|668680_669010_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|669006_670191_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|670183_670771_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|670780_672793_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|672795_673326_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|673315_674041_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|674012_674558_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000977529.1|674557_676261_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_001128281.1|676848_677010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|677432_677939_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|678062_679910_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|680059_681805_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|682040_682256_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023200351.1|682483_683497_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
685806:685827	attR	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
NZ_CP041179	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food chromosome, complete genome	4775876	1180316	1261617	4775876	holin,portal,tRNA,integrase,capsid,head,plate,terminase,tail	Cronobacter_phage(51.22%)	82	1188293:1188308	1215983:1215998
WP_000469807.1|1180316_1181084_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1181124_1181472_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1181627_1182848_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_089541747.1|1182840_1183359_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1183798_1184869_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1184878_1186000_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1186057_1186966_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1186926_1188087_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1188186_1188234_-	hypothetical protein	NA	NA	NA	NA	NA
1188293:1188308	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1188397_1189390_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1189456_1189756_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1189864_1190203_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1190228_1190561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1190570_1191140_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1191142_1191361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1191399_1194057_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_001264830.1|1194084_1194354_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	78.4	5.1e-34
WP_054175273.1|1194407_1195427_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1195423_1197208_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|1197418_1198255_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1198289_1199318_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1199329_1200028_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1200126_1200579_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000080871.1|1200575_1201058_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1201054_1201759_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1201755_1202883_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1202879_1203335_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1203347_1203644_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1203640_1203982_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1203981_1204314_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1204460_1204718_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1204905_1206873_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1206869_1207199_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1207195_1208380_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1208372_1208960_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1208969_1210982_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1210984_1211515_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|1211504_1212230_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|1212201_1212747_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000977529.1|1212746_1214450_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_001748131.1|1215483_1215870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1216027_1216366_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1215983:1215998	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1216637_1217375_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1217506_1218487_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1218483_1219215_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1219344_1221918_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1227866_1228322_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1228425_1229727_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1229723_1230047_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1230091_1231447_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1231561_1234222_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1234275_1234956_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1235028_1235448_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1235651_1236689_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1236804_1237494_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1237812_1238196_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1238257_1238845_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1238947_1239847_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1239864_1241199_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1241328_1242066_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1242050_1243673_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1243936_1244101_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1244097_1244673_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1244704_1245355_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1245354_1246311_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1246307_1246787_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1247038_1248838_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1248854_1249829_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1250102_1250783_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1250779_1251685_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1251696_1252425_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1252436_1253168_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1253167_1253548_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1253659_1253920_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1253957_1254884_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1254999_1256196_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023227281.1|1256217_1257135_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1257172_1258021_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1258136_1259030_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1259040_1260402_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1260405_1261041_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1261065_1261617_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041179	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food chromosome, complete genome	4775876	1473352	1480213	4775876	transposase	Salmonella_virus(42.86%)	7	NA	NA
WP_106417237.1|1473352_1473499_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_109166850.1|1473514_1473658_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
WP_023226601.1|1474647_1476570_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	3.9e-301
WP_000703601.1|1476576_1476843_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
WP_023226602.1|1476811_1477201_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_001067855.1|1477312_1478017_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001590337.1|1479271_1480213_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
>prophage 4
NZ_CP041179	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food chromosome, complete genome	4775876	1711781	1720952	4775876	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1711781_1712729_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1712712_1713444_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1713424_1713532_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1713591_1714323_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1714545_1716231_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1716227_1716947_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1716993_1717461_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1717517_1718048_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1718219_1718678_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1718918_1720952_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 5
NZ_CP041179	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food chromosome, complete genome	4775876	1834829	1845336	4775876		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1834829_1836233_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1836410_1837304_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1837680_1838766_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1838765_1839665_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1839712_1840591_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1840591_1841143_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1841148_1842123_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1842138_1842912_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1842916_1843996_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1844022_1845336_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP041179	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food chromosome, complete genome	4775876	1957488	1966748	4775876	integrase	Morganella_phage(28.57%)	10	1949712:1949727	1964059:1964074
1949712:1949727	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226632.1|1957488_1958745_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|1959225_1959387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1959513_1959933_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|1959935_1961204_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|1961658_1961871_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1961881_1962070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|1962328_1963507_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|1964157_1964469_+	hypothetical protein	NA	NA	NA	NA	NA
1964059:1964074	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|1964548_1965244_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|1965317_1966748_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP041179	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food chromosome, complete genome	4775876	2147499	2186655	4775876	protease,integrase,transposase	Shigella_phage(37.5%)	30	2163936:2163952	2178523:2178539
WP_023227614.1|2147499_2148096_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000147031.1|2148092_2148824_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000070982.1|2148842_2150636_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023227615.1|2150632_2151751_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_023227616.1|2152244_2153510_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_089541817.1|2156072_2157300_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000136607.1|2158738_2161249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442952.1|2161252_2163817_+	hypothetical protein	NA	NA	NA	NA	NA
2163936:2163952	attL	TCAAACTGTTTTATTGA	NA	NA	NA	NA
WP_000716184.1|2164123_2164438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232453.1|2164449_2164968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108266.1|2165021_2165549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442951.1|2165561_2165831_-	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
WP_000093666.1|2165951_2166332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174655.1|2166489_2167032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142750.1|2167054_2167543_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_050516501.1|2167670_2168066_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_019841938.1|2168126_2168486_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000744655.1|2168595_2169213_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000213673.1|2169289_2170237_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.2e-10
WP_000870315.1|2170450_2170897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2171161_2171356_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000468111.1|2171357_2172230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165488789.1|2172439_2173668_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	3.2e-176
WP_001218334.1|2173924_2177827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087212.1|2178148_2179834_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
2178523:2178539	attR	TCAATAAAACAGTTTGA	NA	NA	NA	NA
WP_000151475.1|2179843_2180509_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000699006.1|2180509_2181907_-	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_080229793.1|2183824_2184604_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.1e-137
WP_069067343.1|2185245_2185584_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001443045.1|2185503_2186655_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
>prophage 8
NZ_CP041179	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food chromosome, complete genome	4775876	2280987	2286799	4775876		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2280987_2281794_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2281795_2282788_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2282787_2283678_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2283801_2284203_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_170967352.1|2284502_2285387_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2285696_2285966_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2286320_2286461_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2286499_2286799_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 9
NZ_CP041179	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food chromosome, complete genome	4775876	2750740	2758203	4775876	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2750740_2750980_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023226907.1|2751853_2752663_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2752735_2753113_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2753260_2753803_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2753994_2754723_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2754739_2755153_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2756103_2757228_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2757744_2758203_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 10
NZ_CP041179	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food chromosome, complete genome	4775876	3582638	3628878	4775876	transposase,protease,portal,integrase,lysis,terminase,coat	Enterobacteria_phage(73.13%)	68	3582305:3582350	3624987:3625032
3582305:3582350	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3582638_3583001_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3582997_3583930_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3583919_3585377_+	glucosyltransferase domain-containing protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3585435_3587439_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3587574_3587823_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3587843_3588137_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3588275_3590252_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3590251_3591688_-	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3591698_3592388_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3592390_3592846_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3592845_3593547_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3593550_3594969_-	packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3594928_3595429_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3595412_3595973_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3596013_3597306_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_051129359.1|3597305_3598214_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	94.1	4.3e-149
WP_051129358.1|3598227_3600393_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_051129357.1|3600393_3601893_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	9.1e-306
WP_000729923.1|3601870_3602359_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3602362_3602767_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3602766_3603156_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3603159_3603402_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3603624_3604155_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3604367_3604835_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_089541817.1|3605252_3606481_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000286100.1|3606642_3606846_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3607276_3608050_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3608046_3608226_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3608206_3608410_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3608406_3608631_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3608627_3609239_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3609231_3609408_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3609400_3609742_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3609744_3609921_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3609887_3610061_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3610057_3610495_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3610568_3610838_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3610834_3612211_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3612207_3613029_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_000166961.1|3613015_3613177_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001103492.1|3613211_3613493_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3613603_3613819_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3613929_3614619_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3614783_3615863_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3615901_3616105_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3616468_3616771_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3616783_3617371_-	super-infection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3617584_3617779_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_072097849.1|3617862_3618477_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	94.4	7.0e-47
WP_000713613.1|3618510_3618798_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3619073_3619388_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3619472_3619631_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_051129356.1|3619611_3619767_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	4.7e-24
WP_000902092.1|3619789_3619933_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3619929_3620637_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3620636_3620921_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3620967_3621261_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3621271_3621442_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3621438_3621948_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3621944_3622178_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_025617570.1|3622164_3622809_+	ead/Ea22-like family protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3622808_3623093_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3623085_3623370_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3623438_3623579_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3623808_3624972_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893225.1|3625177_3626428_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3624987:3625032	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3626439_3627543_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3627825_3628878_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 1
NZ_CP041180	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence	236217	0	8664	236217		Pacmanvirus(33.33%)	10	NA	NA
WP_031613424.1|1702_2053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|2429_2747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|2797_3205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|3234_3696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|4032_4263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|4924_5158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975182.1|5379_6276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572389.1|6278_6794_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833382.1|7008_8436_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000220758.1|8496_8664_+	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
>prophage 2
NZ_CP041180	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence	236217	18305	23200	236217		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_032192809.1|18305_20345_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	2.5e-24
WP_001572440.1|20657_20957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043843.1|21705_22131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|22384_23200_-	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
>prophage 3
NZ_CP041180	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence	236217	30171	39102	236217	protease	Caulobacter_phage(33.33%)	10	NA	NA
WP_000301242.1|30171_30747_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_000116677.1|30814_31393_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000255079.1|31441_32482_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007448.1|32504_32960_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054787.1|32982_34140_-	TerD family protein	NA	NA	NA	NA	NA
WP_042634303.1|34139_34721_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001035162.1|35044_36103_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001285478.1|36112_37255_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001040059.1|37247_38021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042634304.1|38022_39102_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
>prophage 4
NZ_CP041180	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence	236217	50445	51621	236217	integrase	Salmonella_phage(100.0%)	1	48124:48137	56962:56975
48124:48137	attL	TTATATTCATCCCG	NA	NA	NA	NA
WP_000795947.1|50445_51621_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V7J3	Salmonella_phage	26.6	1.6e-15
WP_000795947.1|50445_51621_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V7J3	Salmonella_phage	26.6	1.6e-15
56962:56975	attR	TTATATTCATCCCG	NA	NA	NA	NA
>prophage 5
NZ_CP041180	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence	236217	71360	73145	236217		Bacillus_phage(100.0%)	1	NA	NA
WP_042634277.1|71360_73145_-	ATP-dependent helicase	NA	S5M596	Bacillus_phage	26.7	3.5e-22
>prophage 6
NZ_CP041180	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence	236217	76736	195469	236217	transposase,integrase	Escherichia_phage(34.21%)	115	76725:76784	187716:189048
76725:76784	attL	GTGGATTTGCCCCTATATTTCCAGACACCTGTTATCACTTAACCCATTACTGGCCTGCTG	NA	NA	NA	NA
WP_089541817.1|76736_77965_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_001572423.1|78768_79827_-	TraU family protein	NA	NA	NA	NA	NA
WP_001256133.1|79968_81480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001286759.1|81466_81979_-	signal peptidase I	NA	NA	NA	NA	NA
WP_001232107.1|82256_86561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235777.1|86680_87235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836980.1|87243_87669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952689.1|87658_88111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107537.1|88514_89153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818955.1|89164_90202_-	hypothetical protein	NA	A0A0A7NPX4	Enterobacteria_phage	35.0	3.6e-43
WP_000718594.1|90565_91513_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_042634275.1|91509_92346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000598516.1|92338_92860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572421.1|92856_93246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192066.1|93307_94312_-	ParB N-terminal domain-containing protein	NA	A0A1I9KFW9	Aeromonas_phage	33.8	2.7e-11
WP_032084678.1|94308_95562_-	ParA family protein	NA	NA	NA	NA	NA
WP_000387412.1|99398_102080_-	TraC family protein	NA	NA	NA	NA	NA
WP_001022587.1|102088_103039_-	TraV family lipoprotein	NA	NA	NA	NA	NA
WP_001639798.1|103048_103864_-	DsbC family protein	NA	NA	NA	NA	NA
WP_000251250.1|103919_104342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000351841.1|104409_105765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000521240.1|105754_106216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592090.1|106217_107489_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000783153.1|107488_108277_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_000043357.1|108288_108606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000423602.1|108656_109010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000594612.1|110158_111034_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	43.0	2.1e-60
WP_001065779.1|111510_112566_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	31.2	1.1e-12
WP_000594931.1|112583_112784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000838218.1|112780_113497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970403.1|113731_114586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121575.1|114594_115407_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	38.5	3.0e-45
WP_000114859.1|115776_116940_+	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.3e-17
WP_001067855.1|118647_119352_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|119495_120050_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|120180_121011_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|121148_121781_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|121865_122318_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|122540_122888_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|122881_123721_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|123848_124052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|124169_124874_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013188475.1|125384_126260_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|126294_127263_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|129013_129718_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|130103_130520_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|130524_131043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|131108_131813_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|132397_133258_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|133855_134560_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|135315_136167_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|136473_137289_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|137349_138153_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|138152_138989_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|139049_139754_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000503573.1|139955_140744_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|140874_141348_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|141505_142519_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|142721_143072_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|143247_143808_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001067855.1|144590_145295_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063102497.1|145488_145875_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084745.1|146194_146587_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_001067858.1|146909_147614_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032193599.1|149403_150108_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_001067858.1|150137_150842_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000783758.1|150953_151112_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_087522250.1|151210_152580_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_000137793.1|152912_153518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703843.1|153733_154015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001424621.1|154389_154701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000814954.1|154923_155124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|155163_155388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781545.1|155442_155646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001424592.1|156198_156690_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_001165367.1|156694_157006_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001133831.1|157521_157842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276410.1|158021_158249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000280722.1|158476_159085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000241454.1|159199_159733_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	65.2	2.6e-45
WP_000159618.1|159793_159982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172889.1|159978_160290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053276277.1|160352_160601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000469466.1|160850_163235_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_000182314.1|163407_163857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774870.1|163908_164700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634392.1|164926_165184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556022.1|165249_165576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426334.1|165991_166138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000104323.1|166418_167669_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_000833773.1|167837_168446_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	39.8	5.4e-23
WP_001290637.1|168601_168859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001133498.1|168923_169352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000853477.1|169446_169824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001424497.1|170231_171413_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_000581857.1|171421_171718_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	35.1	3.2e-05
WP_000170638.1|171767_172238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694550.1|172672_175063_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_000803860.1|175135_175303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000277497.1|175623_176388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167416.1|176468_177230_+	methyltransferase	NA	A0A2I7RNS1	Vibrio_phage	32.9	1.2e-19
WP_000149861.1|177323_177587_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	46.5	3.2e-09
WP_000491822.1|177631_178219_+	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	71.1	1.1e-09
WP_000681217.1|178683_181104_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_000159529.1|183101_184190_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	50.6	2.4e-82
WP_131189077.1|185297_187721_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_089541817.1|187727_188956_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000966519.1|189462_190089_+	hypothetical protein	NA	NA	NA	NA	NA
187716:189048	attR	GTGGATTTGCCCCTATATTTCCAGACACCTGTTATCACTTAACCCATTACTGGCCTGCTGCCGCAGATATTCCCGTGGCGAGCGATAACCCAGTGCACTATGCGGATGCCATTCGTTATAATGCTCGAACGCCTCTGCAAGGTTCTTTGCTGCCGTTAACCCGTCTGGTTTAGGCATGATACTGATGTAGTCACGCTTTATCGTTTTCACGAAGCTCTCTGCTATGCCGTTACTCTCCGGACTCCGCACCGCCGTGTTCTTCGGTTCAAGCCCCAACATCCGGGCAAACTGCCGTGTTTCATTAGCCCGGTAGCATGAACCATTATCCGTCAGCCACTCTACTGGAGACGCCGGAAGCTCGTTGCCGAAGCGGCGTTCCACCGCTCCCAGCATGACGTCCTGTACTGTTTCACTGTCGAAGCCGCCCGTAGTGACTGCCCAGTGCAGTGCCTCACGGTCACAGCAGTCCAGCGCGAACGTGACTCGCAGTTTTTCTCCGTTATCACAGCGGAACTCGAACCCGTCAGAGCACCATCGTTGATTGCTTTCTTTCACGGCCACTTTGCCAGTATGTGCCCGTTTCGATGGCGGTACAGCGGTTTTTCGCTCAAGCAACAGCGCATTCTGGCGCATGATCCGGTAAACACGTTTGGCATTGATCGCAGGCATACCATCAAGTTCGGCCTGTCTGCGAAGCAGCGCCCATACCCGACGATAACCATACGTGGGCAGCTCTCCGATAACATGGTGTATACGGAGAAGCACATCCGTATCATCTGAGTGACGGCTGCGGCGACCATCTTTCCAGTCATCGGTTCGTCTGAGAATTACGTGCAACTGCGCACGCGACACCCGGAGACAACGGCTGACTAAGCTTACTCCCCATCCCCGGGCAATAAGGGCGCGTGCGCTATCCACTTTTTTGCACGCCCGTATTCAACGGCTTCTTTAAGGAGTTCATTTTCCATCGTTTTTTTGCCGAGCAGGCGCTGGAGTTCTTTAATCTGCTTCATGGCAGCAGCAAGTTCAGAGGCAGGAACGACCTGCTCTCCTGCGGCCACAGCAGTAAGACTTCCCTCCTGGTATTGCTTGCGCCAGAGAAATAACTGGCTGGCTGCCACACCGTGTTGCCGGGCAACAAGGGAGACCGTCATTCCCGGTTCAAAACTCTGCTGAACAATAGCGATCTTTTCCTGTGTAGTACGCCGTCTGCGTTTCTCCGGTCCTAAGACATCAATCATCTGCTCTCCAATGACTAGTCTAAAAACTAGTATTAAGACTATCACTTATTTAAGTGATATTGGTTGTCTGGAGATTCAGGGGGCCAGTCTAC	NA	NA	NA	NA
WP_000535422.1|190146_190428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502497.1|190408_190870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070863.1|190918_191095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|191446_192151_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|192264_193041_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|193269_194295_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|194716_195469_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
>prophage 7
NZ_CP041180	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence	236217	199141	211159	236217	transposase	Salmonella_phage(50.0%)	12	NA	NA
WP_001043260.1|199141_199957_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|200043_200346_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|200239_200491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|200521_202015_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|202126_202432_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|202459_203674_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|203890_204775_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|205699_206404_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|206488_206890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138064.1|206898_209865_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_131187008.1|209867_210419_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001067855.1|210454_211159_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 8
NZ_CP041180	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence	236217	214497	216106	236217	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001389365.1|214497_215262_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|215401_216106_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 9
NZ_CP041180	Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence	236217	223159	230214	236217	transposase	Enterobacteria_phage(40.0%)	7	NA	NA
WP_000027057.1|223159_224020_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|224202_224760_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|225163_225868_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_149029150.1|225903_226668_+	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000095725.1|226929_228189_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|228281_229073_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001067855.1|229509_230214_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
