The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041173	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12519v2 chromosome, complete genome	4679929	1414987	1421040	4679929		Salmonella_virus(50.0%)	6	NA	NA
WP_105789229.1|1414987_1415155_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
WP_105789228.1|1415170_1415314_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_000400616.1|1416303_1418226_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_000703599.1|1418243_1418498_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|1418466_1418856_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000377779.1|1420098_1421040_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 2
NZ_CP041173	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12519v2 chromosome, complete genome	4679929	1657473	1666644	4679929	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1657473_1658421_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1658404_1659136_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1659116_1659224_-	protein YohO	NA	NA	NA	NA	NA
WP_001240420.1|1659283_1660015_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
WP_000272845.1|1660237_1661923_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1661919_1662639_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1662685_1663153_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1663209_1663740_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1663911_1664370_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1664610_1666644_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP041173	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12519v2 chromosome, complete genome	4679929	1733842	1744349	4679929		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1733842_1735246_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1735423_1736317_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1736693_1737779_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1737778_1738678_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1738725_1739604_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1739604_1740156_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1740161_1741136_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1741151_1741925_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1741929_1743009_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1743035_1744349_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP041173	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12519v2 chromosome, complete genome	4679929	1851344	1904768	4679929	plate,portal,tail,capsid,holin,head,transposase,integrase,terminase,protease	Salmonella_phage(76.36%)	65	1860173:1860187	1908363:1908377
WP_001127942.1|1851344_1853183_+|tail	tail fiber protein	tail	I1TR70	Cronobacter_phage	49.0	1.0e-32
WP_000028416.1|1853756_1854638_-	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	42.0	3.3e-29
WP_000072670.1|1855048_1855612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001084817.1|1855973_1856471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042271.1|1856949_1857201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001680077.1|1857272_1858547_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
WP_000598920.1|1859872_1860670_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1860173:1860187	attL	AGGGATGCCGCTGGC	NA	NA	NA	NA
WP_000532847.1|1860961_1861951_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|1861952_1862180_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061370.1|1862219_1862789_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_000208076.1|1862785_1863649_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_000267991.1|1863645_1863939_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000065085.1|1864210_1864570_-	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000071068.1|1864566_1865082_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000764235.1|1865078_1865309_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1865379_1865919_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000551790.1|1866013_1866931_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_000078504.1|1867500_1867752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067433.1|1867827_1868013_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_001020644.1|1868218_1868914_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_001191666.1|1869011_1869236_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509728.1|1869264_1869819_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
WP_001087406.1|1869815_1870973_+	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_000620702.1|1870969_1871194_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000096529.1|1871190_1872165_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000054227.1|1872161_1872635_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_000200166.1|1872631_1873513_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000779149.1|1873521_1873911_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_001061459.1|1873927_1874788_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
WP_012543375.1|1874795_1875785_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_001047141.1|1875798_1876551_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
WP_000357930.1|1876600_1877674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765639.1|1877686_1878259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294874.1|1878347_1878737_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000226304.1|1878723_1879005_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001075993.1|1879004_1879622_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000127618.1|1879618_1880158_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001135228.1|1880181_1880532_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000501481.1|1880678_1881116_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_000257219.1|1881115_1882846_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
WP_000838395.1|1882842_1883001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077905357.1|1883117_1884212_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000003793.1|1884204_1884807_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_000766103.1|1884816_1886046_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000927251.1|1886125_1886449_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000776844.1|1886445_1886850_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_001135695.1|1886821_1887334_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000779215.1|1887330_1887891_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_000497739.1|1887894_1888059_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007993.1|1888048_1889545_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000515952.1|1889544_1889901_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1889897_1890224_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785387.1|1890308_1892237_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000863817.1|1892270_1893611_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_001066630.1|1893607_1894666_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273650.1|1894665_1895199_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_000605050.1|1895203_1895617_+	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001699732.1|1895609_1896689_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	5.5e-204
WP_001207832.1|1896691_1897279_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554738.1|1897265_1898828_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	9.8e-287
WP_015701331.1|1898797_1899397_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000492926.1|1899681_1900689_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1900901_1901123_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_001176778.1|1902465_1903284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028172.1|1903745_1904768_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
1908363:1908377	attR	AGGGATGCCGCTGGC	NA	NA	NA	NA
>prophage 5
NZ_CP041173	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12519v2 chromosome, complete genome	4679929	2436944	2452888	4679929	tRNA,holin	Escherichia_phage(64.71%)	23	NA	NA
WP_001082296.1|2436944_2437379_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2437428_2437767_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000729249.1|2438406_2438580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000802786.1|2438612_2439158_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2439154_2439436_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2439425_2439614_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2439535_2439931_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2442101_2442638_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2442634_2442925_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2442924_2443524_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000734094.1|2443586_2443757_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000882662.1|2444047_2444260_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556390.1|2444629_2445562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2445558_2446113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2446274_2446604_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2446876_2447344_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2447728_2447884_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2447991_2448513_-	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_000560208.1|2448950_2449172_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2449256_2449574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2449601_2450219_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2450535_2451471_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2451514_2452888_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP041173	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12519v2 chromosome, complete genome	4679929	2644178	2693428	4679929	tail,holin,lysis,integrase,protease	Salmonella_phage(27.27%)	48	2673943:2673972	2693564:2693593
WP_000984498.1|2644178_2645060_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|2645253_2647302_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2647321_2648008_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|2648105_2648603_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2648731_2650015_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001529852.1|2649983_2652617_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001531515.1|2652694_2654134_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2654251_2654488_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|2654598_2654790_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986173.1|2654808_2655459_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_001134856.1|2655682_2655847_-	membrane protein	NA	NA	NA	NA	NA
WP_000182071.1|2656131_2656854_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|2657537_2657933_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|2658262_2658739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025515.1|2659111_2659531_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001576019.1|2659903_2660173_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001576018.1|2660338_2660479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2663617_2664532_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2664664_2664823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|2664832_2665447_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000951652.1|2665934_2666081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|2666581_2666707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012543349.1|2667276_2667477_+	phage encoded PagK	NA	NA	NA	NA	NA
WP_001687735.1|2667573_2668074_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_000348541.1|2670178_2670670_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_001576014.1|2670724_2670913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2670977_2671145_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|2671401_2671935_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_001013467.1|2671988_2672219_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_077681935.1|2672408_2672903_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
WP_000622159.1|2673546_2673816_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	47.8	2.7e-11
2673943:2673972	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_001536069.1|2674760_2675561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|2676040_2676763_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001152416.1|2680817_2681513_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2681602_2682136_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2683030_2683510_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2683527_2683980_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2683963_2684293_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2684568_2685255_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2685615_2686065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2686438_2686963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2687059_2687749_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2687878_2688106_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2688102_2688702_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000911593.1|2688765_2689014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2689702_2691682_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2692095_2692374_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2692348_2693428_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2693564:2693593	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP041173	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12519v2 chromosome, complete genome	4679929	2865820	2906087	4679929	tail,protease	Salmonella_phage(23.08%)	39	NA	NA
WP_000938186.1|2865820_2866501_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2867119_2867779_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2867865_2868195_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2868191_2868473_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2868521_2869301_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2869326_2869875_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2870089_2871301_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2871358_2871676_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001676378.1|2871720_2872134_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_058662153.1|2872307_2872970_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2873064_2873523_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2873558_2875613_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2875736_2876183_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2876201_2878355_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2878341_2878947_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2879163_2879673_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2880029_2881082_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2881153_2881606_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2881791_2883552_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2883620_2884139_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2884238_2884406_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2884661_2885225_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2885221_2886862_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2886866_2888120_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2888134_2890042_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2890054_2892163_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2892261_2893371_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2893367_2893910_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2894075_2895086_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2895293_2897906_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2898332_2898524_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2898794_2899481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2899840_2900467_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2901114_2902083_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2902308_2902557_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2902560_2903142_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2903141_2904851_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2904847_2905474_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2905457_2906087_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
>prophage 8
NZ_CP041173	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12519v2 chromosome, complete genome	4679929	2977797	2985110	4679929	integrase,protease	Ralstonia_phage(16.67%)	7	2972594:2972608	2983846:2983860
2972594:2972608	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2977797_2978175_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2978336_2978534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2978746_2981023_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2981053_2981374_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2981697_2981919_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2982048_2983995_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2983846:2983860	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2983991_2985110_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP041174	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12519v2 plasmid p12519A, complete sequence	248746	158135	211974	248746	transposase,protease	Escherichia_phage(29.41%)	58	NA	NA
WP_042634304.1|158135_159215_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|159216_159990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|159982_161125_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|161134_162193_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_042634303.1|162516_163098_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|163097_164255_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007448.1|164277_164733_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|164755_165796_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|165844_166423_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|166490_167066_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|167494_168736_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000077926.1|169298_169580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|169629_169821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151575.1|169912_170254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|170626_171019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|171622_171916_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086722013.1|171920_173246_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|173306_173513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|173614_174025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|174037_174853_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_001043843.1|175106_175532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572440.1|176276_176576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192809.1|176888_178928_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	2.5e-24
WP_001572342.1|178924_179911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194555.1|180941_181145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287392.1|181486_181891_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000175476.1|182388_182625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|182666_183122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|183181_183847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|183904_184285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|184927_185746_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|185742_186948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|187227_188547_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000220758.1|188569_188737_-	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000833382.1|188797_190225_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|190439_190955_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|190957_191854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|192075_192309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|192970_193201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|193537_193999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|194028_194436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|194486_194804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|195180_195531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|197220_197925_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001617865.1|198227_199103_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_014839980.1|199714_200131_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|200135_200654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071448054.1|200653_201400_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|201405_202110_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|202223_203000_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|203228_204254_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|204675_205428_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_170628443.1|207364_207724_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_085940648.1|207920_209011_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_140077967.1|209100_209916_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|210002_210305_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|210198_210450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|210480_211974_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP041174	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12519v2 plasmid p12519A, complete sequence	248746	228712	236568	248746	transposase	Bacillus_phage(33.33%)	8	NA	NA
WP_000034420.1|228712_229504_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|229972_230218_-	GrpB family protein	NA	NA	NA	NA	NA
WP_000612791.1|230255_231119_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_000018329.1|232203_233019_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|233208_233913_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001083725.1|234317_234815_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|234926_235217_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|235863_236568_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
