The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041171	Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 chromosome, complete genome	4755719	1138583	1148464	4755719	integrase	Enterobacteria_phage(88.89%)	12	1144254:1144269	1151079:1151094
WP_107919754.1|1138583_1140917_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.0	0.0e+00
WP_000743150.1|1140931_1141252_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001145746.1|1141248_1141509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459283.1|1141582_1142032_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.5	1.5e-43
WP_000556707.1|1142024_1142324_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.7	6.1e-28
WP_001750323.1|1142313_1142916_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.8	4.2e-44
WP_001750322.1|1142912_1143179_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	78.4	1.1e-33
WP_000149859.1|1143726_1144464_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	62.3	1.7e-76
1144254:1144269	attL	GCAGCAGGTGAAAGCG	NA	NA	NA	NA
WP_000984203.1|1144460_1144706_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	75.3	5.3e-30
WP_000210076.1|1144722_1145289_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	1.3e-55
WP_001604631.1|1145821_1147231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001604633.1|1147267_1148464_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.0	4.1e-107
1151079:1151094	attR	CGCTTTCACCTGCTGC	NA	NA	NA	NA
>prophage 2
NZ_CP041171	Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 chromosome, complete genome	4755719	1439262	1489610	4755719	integrase,terminase,lysis,head,tail,protease	Salmonella_phage(72.22%)	78	1455745:1455760	1490404:1490419
WP_000716009.1|1439262_1440201_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
WP_053253392.1|1440463_1440667_-	histidine kinase	NA	I6RSG8	Salmonella_phage	98.5	1.0e-31
WP_155675089.1|1440763_1440904_-	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000002104.1|1440972_1441257_-	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_000371199.1|1441249_1441534_-	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_025617570.1|1441533_1442178_-	ead/Ea22-like family protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_071533029.1|1442164_1442398_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_065680793.1|1442394_1442820_-	hypothetical protein	NA	Q76H44	Enterobacteria_phage	79.3	7.2e-67
WP_001214770.1|1442816_1442987_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_141151304.1|1442997_1443291_-	DUF2856 family protein	NA	I6R0R5	Salmonella_phage	56.7	6.4e-22
WP_131535358.1|1443308_1443857_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	96.2	1.5e-101
WP_131535356.1|1443865_1444372_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	89.9	1.0e-83
WP_141151305.1|1444372_1445080_-	recombinase	NA	A0A192Y857	Salmonella_phage	94.0	9.1e-131
WP_016050294.1|1445076_1445220_-	hypothetical protein	NA	I6R9C0	Salmonella_phage	100.0	2.4e-19
WP_086127069.1|1445209_1445398_-	DUF5444 family protein	NA	A0A1R3Y5S5	Salmonella_virus	96.8	1.4e-30
WP_000141641.1|1445378_1445537_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_141151306.1|1445762_1446422_-	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	95.4	3.2e-45
WP_141151307.1|1446505_1446700_-	restriction endonuclease	NA	E7C9Q6	Salmonella_phage	98.4	5.5e-30
WP_141151308.1|1446914_1447502_+	super-infection exclusion protein B	NA	Q76H59	Enterobacteria_phage	95.9	7.1e-97
WP_141151309.1|1447514_1447877_-	antitermination protein	NA	C6ZR44	Salmonella_phage	95.8	5.2e-58
WP_065680786.1|1448227_1448437_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	98.6	2.0e-30
WP_000841071.1|1448778_1449297_-	hypothetical protein	NA	I6R9C4	Salmonella_phage	100.0	1.9e-85
WP_000020334.1|1449496_1450192_-	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	60.9	2.8e-76
WP_000449405.1|1450293_1450506_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	56.7	1.6e-14
WP_000424138.1|1450636_1450927_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
WP_000166968.1|1450947_1451109_+	hypothetical protein	NA	I6R9C7	Salmonella_phage	100.0	1.0e-21
WP_141151310.1|1451095_1451944_+	replication protein	NA	I6S659	Salmonella_phage	97.9	4.5e-153
WP_024156492.1|1452051_1453932_+	toprim domain-containing protein	NA	A0A0M4R313	Salmonella_phage	99.2	0.0e+00
WP_024156491.1|1453932_1454211_+	hypothetical protein	NA	B9UDH9	Salmonella_phage	92.4	1.5e-44
WP_141151311.1|1454283_1454490_+	hypothetical protein	NA	A0A192Y802	Salmonella_phage	95.6	1.3e-29
WP_172604432.1|1454504_1454657_+	hypothetical protein	NA	A0A2H4FWM4	Salmonella_phage	98.0	2.6e-19
WP_057518029.1|1454668_1454989_+	hypothetical protein	NA	I6R992	Salmonella_phage	59.4	4.8e-23
WP_000049340.1|1454991_1455288_+	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	6.8e-48
WP_141151312.1|1455244_1455691_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	98.0	3.0e-79
1455745:1455760	attL	CAACCTTATTGGCACC	NA	NA	NA	NA
WP_141151313.1|1455827_1456004_+	NinE family protein	NA	I6RSI9	Salmonella_phage	79.3	2.0e-18
WP_141151314.1|1456000_1456171_+	NinF family protein	NA	I6R994	Salmonella_phage	83.3	1.4e-21
WP_001749499.1|1456163_1456400_+	hypothetical protein	NA	C6ZR59	Salmonella_phage	88.5	3.4e-34
WP_141151316.1|1456838_1457021_+	hypothetical protein	NA	C6ZR61	Salmonella_phage	96.7	5.5e-24
WP_000027547.1|1457017_1457536_+	DUF1133 family protein	NA	A0A1R3Y5U9	Salmonella_virus	100.0	2.0e-95
WP_079778723.1|1458000_1458204_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	98.5	9.4e-33
WP_079778729.1|1458181_1458679_+	lysozyme	NA	A0A0M3ULD1	Salmonella_phage	97.0	9.3e-90
WP_000092260.1|1458675_1459113_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	98.6	3.8e-71
WP_079778722.1|1459325_1460012_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	2.7e-124
WP_000147264.1|1460445_1460877_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	100.0	7.6e-72
WP_065680782.1|1460860_1462180_+|terminase	terminase	terminase	Q5G8Y7	Enterobacteria_phage	98.4	2.3e-260
WP_065680781.1|1462312_1463662_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	98.7	1.3e-255
WP_065680780.1|1463621_1464548_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	97.7	1.9e-168
WP_065680779.1|1464550_1465816_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	96.9	3.4e-229
WP_000092740.1|1465828_1466278_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	100.0	9.6e-78
WP_001747836.1|1466295_1467372_+	hypothetical protein	NA	I6RSK5	Salmonella_phage	100.0	2.4e-207
WP_141151317.1|1467381_1467561_+	glycoprotein	NA	I6R9A3	Salmonella_phage	98.3	3.4e-26
WP_047641358.1|1467612_1468014_+	hypothetical protein	NA	I6S619	Salmonella_phage	99.2	1.6e-71
WP_016050271.1|1468185_1468548_+	hypothetical protein	NA	I6S1Q5	Salmonella_phage	100.0	4.3e-68
WP_001144355.1|1468555_1468951_+	hypothetical protein	NA	I6RSK8	Salmonella_phage	100.0	3.2e-69
WP_001650226.1|1468947_1469334_+	hypothetical protein	NA	I6R9A6	Salmonella_phage	100.0	2.0e-68
WP_065680778.1|1469349_1470087_+	immunoglobulin domain-containing protein	NA	Q5G8X3	Enterobacteria_phage	96.3	1.7e-127
WP_065680777.1|1470132_1470786_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	98.6	2.5e-119
WP_023972057.1|1470817_1471132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023972058.1|1471200_1471422_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	78.8	9.3e-26
WP_000360561.1|1471436_1471805_-	hypothetical protein	NA	H6WRU4	Salmonella_phage	65.0	9.4e-39
WP_065680776.1|1472004_1472331_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	94.9	8.6e-44
WP_000414200.1|1472433_1472595_+	hypothetical protein	NA	A0A077KAX5	Edwardsiella_phage	98.1	1.6e-22
WP_065680775.1|1472584_1473451_+	hypothetical protein	NA	B6SD57	Bacteriophage	53.2	5.1e-67
WP_001187765.1|1473515_1474304_+	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	100.0	5.2e-127
WP_141151318.1|1474683_1475262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141151319.1|1475296_1475710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141151320.1|1475772_1478958_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	70.3	1.2e-311
WP_000884616.1|1478958_1479357_-	hypothetical protein	NA	A0A1V0E5N6	Salmonella_phage	98.5	4.2e-69
WP_001115295.1|1479449_1479797_+|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	93.9	9.1e-60
WP_000796432.1|1479949_1480195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063266541.1|1480330_1481035_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	98.7	5.5e-136
WP_065680771.1|1481034_1481754_+	C40 family peptidase	NA	A0A1V0E5M9	Salmonella_phage	90.0	3.4e-133
WP_033905024.1|1481696_1482224_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	80.0	3.0e-62
WP_024133398.1|1482322_1482877_+	HNH endonuclease	NA	A0A2P1CKX5	Escherichia_phage	40.0	2.1e-10
WP_141151321.1|1482921_1486092_+	DUF1983 domain-containing protein	NA	A0A1V0E5M1	Salmonella_phage	97.7	0.0e+00
WP_001113928.1|1486100_1487060_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.7	6.2e-183
WP_001272647.1|1487070_1488369_+	hypothetical protein	NA	I6R0Q9	Salmonella_phage	99.5	4.5e-245
WP_080069444.1|1488440_1489610_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	99.0	1.0e-227
1490404:1490419	attR	GGTGCCAATAAGGTTG	NA	NA	NA	NA
>prophage 3
NZ_CP041171	Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 chromosome, complete genome	4755719	1727178	1736349	4755719	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1727178_1728126_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1728109_1728841_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1728821_1728929_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1728988_1729720_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1729942_1731628_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1731624_1732344_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1732390_1732858_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_017465874.1|1732914_1733445_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703143.1|1733616_1734075_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
WP_000195330.1|1734315_1736349_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP041171	Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 chromosome, complete genome	4755719	1910156	1917424	4755719		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1910156_1910576_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_017465541.1|1910578_1911847_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	3.5e-226
WP_000208509.1|1912301_1912514_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1912524_1912713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017465542.1|1912972_1914184_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	4.4e-109
WP_000107439.1|1914833_1915145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377042.1|1915224_1915920_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157305.1|1915993_1917424_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP041171	Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 chromosome, complete genome	4755719	2632067	2719083	4755719	integrase,portal,terminase,lysis,holin,capsid,head,tRNA,tail	Salmonella_phage(35.09%)	106	2652718:2652734	2718602:2718618
WP_162487925.1|2632067_2632586_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|2632582_2632690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2632895_2633342_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2633321_2634116_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205345.1|2634216_2635401_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2635519_2635867_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487129.1|2635852_2636164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2636232_2636484_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2636679_2636778_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2636916_2637165_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001670462.1|2637478_2638120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2638349_2638532_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2638534_2638897_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2639069_2639708_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617984.1|2639904_2640450_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000208086.1|2640778_2641027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2641281_2642130_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001738208.1|2642198_2642792_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|2642936_2643725_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_001537483.1|2643833_2644481_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2644677_2645004_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_000456063.1|2645197_2646331_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947465.1|2646412_2647003_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950202.1|2646996_2647794_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	9.6e-12
WP_000966649.1|2647787_2648600_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001672818.1|2648589_2649564_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946088.1|2649563_2651198_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2651878_2652193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929980.1|2652341_2652872_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2652718:2652734	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_000761747.1|2652954_2653998_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218118.1|2654336_2654804_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927825.1|2655001_2655229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|2655428_2655554_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977725.1|2655931_2656276_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789470.1|2657497_2658055_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|2658866_2659130_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2659261_2659474_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001537478.1|2659888_2660410_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000289208.1|2660600_2660840_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	84.8	6.1e-31
WP_001033398.1|2661329_2662118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917261.1|2663102_2664227_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|2664674_2664887_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334552.1|2665140_2665812_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	8.2e-81
WP_000481981.1|2666131_2668234_-	type III secretion system effector E3 ubiquitin transferase SspH1	NA	Q9MBL9	Phage_Gifsy-2	48.5	1.0e-28
WP_031609383.1|2670459_2670660_+	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000143179.1|2670756_2671341_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
WP_058214537.1|2671340_2673782_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	61.7	6.2e-86
WP_000178851.1|2673835_2674078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065680844.1|2674116_2677479_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.7	0.0e+00
WP_065314082.1|2677541_2678189_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	6.0e-89
WP_000662740.1|2678086_2678824_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
WP_058112038.1|2678830_2679529_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	6.0e-103
WP_000447370.1|2679538_2679868_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_065680843.1|2679870_2682912_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	64.6	4.4e-291
WP_010989052.1|2682883_2683222_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2683218_2683614_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077951392.1|2683664_2684411_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	77.3	6.7e-100
WP_000033885.1|2684418_2684820_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000677089.1|2684816_2685395_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_065680841.1|2685381_2685759_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.2e-28
WP_065680840.1|2685769_2686135_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|2686192_2687221_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_047588326.1|2687275_2687623_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	5.4e-20
WP_065680839.1|2687635_2689132_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	51.8	6.9e-96
WP_023237960.1|2689121_2690702_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	63.0	4.3e-189
WP_039513171.1|2690698_2690902_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	72.3	9.5e-17
WP_039513168.1|2690885_2692817_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.8e-258
WP_001102153.1|2692788_2693334_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669693.1|2693619_2694021_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001533543.1|2694256_2694709_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984587.1|2694726_2695179_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	5.1e-79
WP_001574216.1|2695162_2695492_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110788.1|2695767_2696454_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM2	Phage_Gifsy-1	98.7	5.1e-131
WP_000798705.1|2696814_2697264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2697399_2697525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047630.1|2697923_2698721_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_001617856.1|2698710_2698857_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096547.1|2698853_2699465_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_000929790.1|2699673_2700276_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|2700310_2700559_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2700675_2700909_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000445792.1|2701773_2702247_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000065104.1|2702246_2702771_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	100.0	1.0e-91
WP_000113623.1|2702767_2703115_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|2703125_2703875_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_031235175.1|2703877_2704861_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_010835408.1|2704945_2705320_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_051124477.1|2705285_2705522_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	71.8	2.6e-26
WP_015406390.1|2705626_2706022_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_023226317.1|2706091_2707153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038988958.1|2707130_2707502_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	1.5e-31
WP_001750115.1|2707528_2707735_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	4.3e-17
WP_000917563.1|2708132_2708291_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_022742800.1|2708312_2708663_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_107919747.1|2708789_2711501_+	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	44.7	4.1e-155
WP_001126032.1|2711493_2712324_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033921.1|2712359_2712680_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_058646427.1|2712672_2713005_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	63.6	4.9e-10
WP_023239955.1|2713001_2713505_+	hypothetical protein	NA	A0A075B8H2	Enterobacteria_phage	91.0	6.6e-35
WP_039513135.1|2713554_2713791_+	excisionase	NA	NA	NA	NA	NA
WP_065680837.1|2713780_2714923_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	80.0	3.1e-173
WP_000444509.1|2715036_2716287_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_024137237.1|2716458_2717124_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825956.1|2717120_2717450_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000476067.1|2717461_2717923_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2717976_2719083_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2718602:2718618	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 6
NZ_CP041171	Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 chromosome, complete genome	4755719	4341474	4388547	4755719	plate,tail,tRNA	Burkholderia_phage(36.36%)	49	NA	NA
WP_017465897.1|4341474_4342473_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|4342560_4343871_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4344117_4344633_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4344732_4344942_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4344963_4345077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128112.1|4345073_4346399_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4346577_4347186_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4347294_4347663_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4347833_4350254_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4350352_4351225_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4351238_4351736_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4351917_4352835_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_017465895.1|4352998_4354357_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4354445_4355555_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_107919762.1|4355916_4357107_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382570.1|4357238_4358783_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4358797_4359688_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4359853_4360264_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750810.1|4360406_4362503_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977968.1|4362502_4363240_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_126489750.1|4363236_4363905_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4363938_4364181_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4364624_4366274_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4366618_4367968_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4368098_4368446_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4369022_4369310_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_017465893.1|4369312_4369918_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
WP_017465892.1|4369930_4370245_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	1.1e-19
WP_000449433.1|4370405_4370861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4370857_4371055_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4371044_4372472_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4372471_4372996_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003639.1|4373047_4373365_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4373324_4373453_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262486.1|4373549_4375904_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.9	4.0e-66
WP_017465891.1|4375903_4376857_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_017465890.1|4376856_4377066_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	58.8	2.8e-16
WP_017465889.1|4377053_4378097_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	6.5e-77
WP_017465888.1|4378106_4378829_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|4379156_4379519_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703628.1|4379515_4380445_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_001095011.1|4380444_4381992_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_065680873.1|4382155_4382515_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	3.6e-35
WP_000951730.1|4382505_4383621_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_000359504.1|4383613_4384246_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_017465887.1|4384248_4386018_+|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	40.5	3.2e-52
WP_017465886.1|4386022_4386628_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_017465885.1|4386624_4387080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022544687.1|4387818_4388547_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	7.3e-35
>prophage 1
NZ_CP041172	Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 plasmid pSH11G0791, complete sequence	153516	37217	66330	153516	transposase,integrase	Escherichia_phage(42.86%)	29	34551:34566	39471:39486
34551:34566	attL	GTAATTATCATAATTA	NA	NA	NA	NA
WP_000543934.1|37217_38228_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|38230_38767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|39065_39347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|39616_40219_+	hypothetical protein	NA	NA	NA	NA	NA
39471:39486	attR	GTAATTATCATAATTA	NA	NA	NA	NA
WP_001326394.1|40857_41298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257735.1|41269_45523_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_000988731.1|45655_46381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868820.1|46494_46869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338626.1|46989_47106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|47511_48516_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000414383.1|48615_49050_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_001294666.1|49121_49472_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732290.1|49487_49763_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000149288.1|49834_51520_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
WP_000761850.1|51534_52173_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_000995361.1|52284_52650_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087810.1|52646_52883_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001276635.1|52879_53869_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|54078_54783_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067855.1|57021_57726_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|59115_59784_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|59819_60056_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|60052_60415_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000027057.1|61090_61951_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|62331_63036_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|63041_63182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|63667_64405_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|64401_64626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|64836_66330_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP041172	Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 plasmid pSH11G0791, complete sequence	153516	101535	147389	153516	transposase,integrase	Salmonella_phage(30.0%)	36	121391:121442	152196:152247
WP_000608644.1|101535_102798_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000976514.1|103121_104267_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_001221666.1|104360_104894_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_000118520.1|104890_105208_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000606835.1|105935_111422_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_001259346.1|111570_112278_+	DsbC family protein	NA	NA	NA	NA	NA
WP_000637384.1|112274_114722_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_000351984.1|114736_115054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010740.1|115050_115581_+	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_001447719.1|115543_116809_+	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_000575345.1|116805_117477_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000983282.1|117473_118481_+	TraU family protein	NA	NA	NA	NA	NA
121391:121442	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCC	NA	NA	NA	NA
WP_001067855.1|121442_122147_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001516695.1|122903_123560_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|124339_125731_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|125767_126340_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|126476_127067_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_072756842.1|127190_130178_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.7	1.5e-296
WP_000470623.1|130345_130981_+	recombinase family protein	NA	NA	NA	NA	NA
WP_071686688.1|131008_131845_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000235177.1|131910_132309_-	VOC family protein	NA	NA	NA	NA	NA
WP_000842086.1|132350_133460_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
WP_001141270.1|133490_133766_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_001161490.1|135421_135982_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000130000.1|136181_136487_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|136497_137703_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|137858_138062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|138189_139029_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|139022_139370_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|139533_140325_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|140330_140621_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|140732_141230_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001747814.1|142254_143787_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001470701.1|144043_144412_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_109638756.1|144439_145981_-	fluoroquinolone efflux MFS transporter QepA8	NA	NA	NA	NA	NA
WP_000845039.1|146375_147389_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
152196:152247	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCC	NA	NA	NA	NA
