The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041143	Bacillus velezensis strain UCMB5007 chromosome, complete genome	3983323	655484	665375	3983323		Synechococcus_phage(50.0%)	9	NA	NA
WP_007408896.1|655484_656777_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_088461589.1|656852_657572_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.7	4.4e-48
WP_003155758.1|657571_657826_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_105938008.1|657822_658506_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_105938007.1|658489_660718_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	1.6e-157
WP_007609856.1|660693_662124_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_105938006.1|662215_663256_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.3	1.4e-63
WP_007408902.1|663252_663840_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
WP_105938005.1|663836_665375_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	3.0e-78
>prophage 2
NZ_CP041143	Bacillus velezensis strain UCMB5007 chromosome, complete genome	3983323	1209180	1221266	3983323	portal,holin	uncultured_Caudovirales_phage(40.0%)	20	NA	NA
WP_087920760.1|1209180_1210317_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_140957286.1|1210306_1210441_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003154880.1|1210583_1211537_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_007610770.1|1211574_1211952_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_015239671.1|1212061_1212667_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	6.1e-43
WP_014417517.1|1212805_1213396_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1213544_1213883_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_029325864.1|1214073_1214253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105937831.1|1214242_1215070_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	1.7e-19
WP_105937830.1|1214969_1215770_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	1.4e-58
WP_032874575.1|1216034_1216376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|1216365_1216569_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_105937829.1|1216675_1217188_+	Fis family transcriptional regulator	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	6.5e-22
WP_140957745.1|1217910_1218378_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	47.9	2.0e-33
WP_032874603.1|1218390_1218762_+	YomQ/XkdW protein, phage-like element PBSX	NA	NA	NA	NA	NA
WP_105937827.1|1218766_1218964_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	60.0	1.2e-13
WP_105937826.1|1219020_1219782_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003154815.1|1219833_1220097_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1220110_1220374_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_105937825.1|1220387_1221266_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	6.3e-81
>prophage 3
NZ_CP041143	Bacillus velezensis strain UCMB5007 chromosome, complete genome	3983323	1772654	1778867	3983323		Bacillus_phage(50.0%)	7	NA	NA
WP_003154061.1|1772654_1773047_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
WP_007611605.1|1773006_1775109_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
WP_012117608.1|1775126_1776116_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
WP_032874993.1|1776164_1776785_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	5.4e-47
WP_020955856.1|1776833_1777592_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	4.8e-53
WP_101670455.1|1777625_1777850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015417523.1|1777898_1778867_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 4
NZ_CP041143	Bacillus velezensis strain UCMB5007 chromosome, complete genome	3983323	2064102	2077927	3983323		Bacillus_phage(90.91%)	14	NA	NA
WP_007612048.1|2064102_2064528_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	35.6	2.1e-13
WP_007612049.1|2064561_2064738_-	hypothetical protein	NA	O64196	Bacillus_phage	93.1	5.0e-22
WP_007407924.1|2064740_2064947_-	hypothetical protein	NA	O64195	Bacillus_phage	73.3	1.1e-15
WP_007407922.1|2065887_2066124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407921.1|2066247_2066622_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	51.2	1.2e-28
WP_140957336.1|2066847_2067300_-	hypothetical protein	NA	O64117	Bacillus_phage	77.3	4.8e-61
WP_021493942.1|2068788_2068911_+	PhrK family phosphatase-inhibitory pheromone	NA	NA	NA	NA	NA
WP_007612065.1|2070193_2070532_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	60.2	3.8e-26
WP_140957338.1|2071301_2071904_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	78.9	2.5e-81
WP_140957341.1|2071966_2072464_-	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	90.9	4.2e-90
WP_140957343.1|2072472_2074191_-	hypothetical protein	NA	O64023	Bacillus_phage	75.9	1.6e-242
WP_105938235.1|2074227_2074662_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_105937603.1|2074927_2075893_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.0	1.9e-78
WP_105937602.1|2076259_2077927_+	recombinase family protein	NA	O64015	Bacillus_phage	90.0	5.4e-275
>prophage 5
NZ_CP041143	Bacillus velezensis strain UCMB5007 chromosome, complete genome	3983323	2114752	2154859	3983323	holin,integrase,portal,tail,capsid,terminase,head	uncultured_Caudovirales_phage(47.06%)	60	2152454:2152468	2161771:2161785
WP_003155834.1|2114752_2115175_-|holin	holin	holin	D6R405	Bacillus_phage	88.0	9.4e-59
WP_015239639.1|2115209_2115431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957357.1|2115444_2115612_-	XkdX family protein	NA	NA	NA	NA	NA
WP_140957359.1|2115750_2116140_-	hypothetical protein	NA	O48465	Bacillus_phage	52.4	5.5e-29
WP_140957361.1|2116155_2119512_-	hypothetical protein	NA	Q5YA57	Bacillus_phage	46.1	2.7e-132
WP_140957363.1|2119524_2120289_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_140957365.1|2120285_2125001_-	hypothetical protein	NA	M9NRJ5	Staphylococcus_phage	25.3	9.9e-40
WP_071348589.1|2125005_2125314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957367.1|2125361_2125868_-	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	32.7	1.5e-10
WP_140957749.1|2125925_2126168_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_140957370.1|2126181_2126514_-	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	75.3	1.8e-25
WP_007408587.1|2126437_2126953_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_140957372.1|2126966_2127365_-	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	44.6	4.9e-25
WP_007408589.1|2127383_2127800_-	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	54.2	7.4e-32
WP_140957374.1|2127792_2128131_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_140957376.1|2128127_2128427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957378.1|2128435_2128687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957380.1|2128688_2129024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957382.1|2129028_2129946_-|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	67.5	8.5e-113
WP_140957751.1|2129961_2130549_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	53.6	7.0e-52
WP_140957384.1|2130651_2131578_-|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	51.5	1.7e-81
WP_140957386.1|2131564_2132968_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.8	6.4e-152
WP_140957754.1|2132967_2134176_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	87.2	3.4e-210
WP_140957388.1|2134162_2134924_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	56.9	1.5e-67
WP_140957390.1|2135220_2135979_+	DUF4393 domain-containing protein	NA	A0A1S5S9V3	Streptococcus_phage	35.9	1.5e-35
WP_105938240.1|2136248_2136620_-	YrdB family protein	NA	NA	NA	NA	NA
WP_105937692.1|2136649_2136859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071347897.1|2136940_2137483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957392.1|2137609_2138242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071347895.1|2138388_2138850_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	51.2	2.6e-25
WP_071347894.1|2138849_2139056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957394.1|2139450_2139630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957396.1|2139640_2140075_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	4.1e-49
WP_026092239.1|2140077_2140323_-	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
WP_140957398.1|2140319_2140628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957400.1|2140624_2141008_-	hypothetical protein	NA	A0A2H4J4Q6	uncultured_Caudovirales_phage	52.1	3.6e-33
WP_140957402.1|2141007_2141406_-	hypothetical protein	NA	R4JKA5	Bacillus_phage	64.1	3.6e-44
WP_140957404.1|2141406_2141658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957406.1|2141659_2142271_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	48.8	1.9e-36
WP_140957408.1|2142267_2142591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957410.1|2142708_2142963_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	41.6	2.2e-07
WP_140957412.1|2142959_2143343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155894.1|2143374_2143578_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_016938684.1|2143868_2144297_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	62.0	4.8e-42
WP_140957414.1|2144531_2145479_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	4.0e-57
WP_140957416.1|2145363_2146065_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	33.3	9.0e-06
WP_044803177.1|2146231_2147074_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	84.4	5.5e-127
WP_140957418.1|2147076_2148027_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	69.2	2.1e-127
WP_140957420.1|2148026_2148212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957422.1|2148313_2148511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957424.1|2148507_2148765_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	40.2	1.7e-07
WP_140957426.1|2148761_2149334_-	helix-turn-helix domain-containing protein	NA	A0A2H4J884	uncultured_Caudovirales_phage	57.1	4.0e-60
WP_140957428.1|2149443_2150205_-	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	71.1	3.3e-102
WP_140957430.1|2150208_2150418_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_140957433.1|2150542_2151019_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_140957435.1|2151251_2151566_-	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	55.7	1.0e-17
WP_140957437.1|2151605_2151836_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_140957439.1|2151998_2152361_+	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	44.0	1.9e-15
2152454:2152468	attL	TGGATCGGAAAAGAA	NA	NA	NA	NA
WP_140957756.1|2152617_2153520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140957441.1|2153662_2154859_+|integrase	tyrosine-type recombinase/integrase	integrase	S6C485	Thermus_phage	44.2	4.2e-80
2161771:2161785	attR	TTCTTTTCCGATCCA	NA	NA	NA	NA
>prophage 6
NZ_CP041143	Bacillus velezensis strain UCMB5007 chromosome, complete genome	3983323	2255845	2262098	3983323		Staphylococcus_phage(66.67%)	10	NA	NA
WP_007409428.1|2255845_2256439_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_007409427.1|2256428_2257184_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
WP_003153376.1|2257391_2257481_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_105937566.1|2257568_2258090_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153374.1|2258034_2258250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153373.1|2258155_2258530_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2258646_2259111_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_105937565.1|2259143_2260340_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	1.6e-116
WP_105937564.1|2260354_2261002_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.0e-39
WP_105937563.1|2260982_2262098_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	1.7e-54
>prophage 7
NZ_CP041143	Bacillus velezensis strain UCMB5007 chromosome, complete genome	3983323	2632046	2754155	3983323	protease,plate,holin,portal,coat,tail,capsid,tRNA,integrase	Bacillus_phage(40.3%)	143	2685989:2686038	2752649:2752698
WP_038459368.1|2632046_2633237_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_044801623.1|2633364_2634468_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_105937483.1|2634469_2635318_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_105937482.1|2635299_2636865_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_007408177.1|2636968_2638120_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A141ZJV0	Faustovirus	29.9	4.6e-31
WP_038459375.1|2638116_2638659_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_103695111.1|2638684_2639542_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2639555_2639999_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_007408172.1|2640054_2641341_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_032873815.1|2641372_2641951_-	sporulation protein	NA	NA	NA	NA	NA
WP_003152662.1|2642268_2642553_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012118103.1|2642565_2642907_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2642909_2643218_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_088461173.1|2643363_2644230_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_007408168.1|2644222_2645026_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_016938784.1|2645153_2645957_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003152653.1|2645959_2646640_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_007408167.1|2646693_2647212_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_007408166.1|2647208_2648072_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003152647.1|2648102_2649116_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_007408165.1|2649207_2649903_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_012118105.1|2649934_2650504_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_105937481.1|2650644_2651646_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_105937480.1|2651772_2652525_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_105937479.1|2652664_2653957_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_105937478.1|2654015_2656658_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
WP_007612879.1|2657110_2657302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105938230.1|2657316_2658339_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_140957469.1|2658372_2660172_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038459388.1|2660304_2661594_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_029326045.1|2661622_2662597_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_020956156.1|2662602_2663382_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_105937477.1|2663371_2664313_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_007408154.1|2664347_2665178_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_003152628.1|2665185_2666553_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_105937476.1|2666748_2667240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007612895.1|2667272_2667860_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_007612896.1|2667856_2670181_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	1.4e-183
WP_007612897.1|2670379_2672038_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_007612899.1|2672188_2673451_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.5	1.5e-147
WP_105937475.1|2673722_2674997_-	trigger factor	NA	NA	NA	NA	NA
WP_088461297.1|2675213_2676218_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_105937474.1|2676335_2676935_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_105937473.1|2676950_2678369_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_105937472.1|2678418_2679516_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_105937471.1|2679536_2681093_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	35.0	3.5e-10
WP_105937470.1|2681079_2682108_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_045208389.1|2682130_2682649_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_105938229.1|2682645_2684370_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	29.6	5.4e-60
WP_044801606.1|2685163_2685514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007408136.1|2685553_2685739_-	hypothetical protein	NA	NA	NA	NA	NA
2685989:2686038	attL	TACGTCCCAGGAGAGATTCGAACTCCCGACCGACGGCTTAGAAGGCCGTT	NA	NA	NA	NA
WP_140957471.1|2686202_2687018_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	30.2	1.1e-15
WP_069473335.1|2687149_2687356_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_140957473.1|2687380_2687626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140957475.1|2687685_2688021_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.7	4.4e-11
WP_140957477.1|2688036_2688597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069013261.1|2688689_2688947_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	56.5	1.6e-21
WP_140957480.1|2688968_2689907_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	66.6	7.9e-98
WP_013351581.1|2689986_2690196_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_140957482.1|2690199_2690388_-	XkdX family protein	NA	NA	NA	NA	NA
WP_140957484.1|2690388_2690658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957758.1|2690672_2692223_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	54.0	1.4e-54
WP_140957486.1|2692268_2694833_-	peptidase G2	NA	D6R401	Bacillus_phage	74.1	0.0e+00
WP_140957488.1|2694847_2696248_-	endopeptidase	NA	A6M966	Geobacillus_virus	31.2	3.3e-39
WP_140957490.1|2696259_2697684_-|tail	phage tail protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	44.0	2.4e-61
WP_140957492.1|2697690_2700489_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	38.3	7.3e-99
WP_140957496.1|2700489_2700726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957498.1|2700821_2701193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029973260.1|2701250_2701805_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_104678878.1|2701829_2702219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957500.1|2702225_2702633_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	2.3e-30
WP_129091899.1|2702629_2702950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957502.1|2702965_2703352_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.0	3.0e-19
WP_099320068.1|2703365_2703584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957504.1|2703892_2704996_-	DUF5309 family protein	NA	A0A2I7S650	Vibrio_phage	27.3	2.8e-30
WP_140957506.1|2705007_2705679_-|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	45.5	1.6e-15
WP_140957508.1|2705770_2706595_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	52.7	1.2e-73
WP_140957510.1|2706594_2708226_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	58.0	9.6e-168
WP_046341194.1|2708228_2708660_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	50.4	6.5e-31
WP_140957513.1|2708676_2710431_-	hypothetical protein	NA	A0A2H4J484	uncultured_Caudovirales_phage	71.4	3.7e-250
WP_140957515.1|2710513_2711062_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	50.0	1.2e-37
WP_140957760.1|2711259_2711478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957517.1|2712600_2712882_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	51.2	1.2e-17
WP_025851577.1|2714248_2714479_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_140957519.1|2714946_2715147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140957521.1|2715252_2715990_+	DUF2786 domain-containing protein	NA	A0A1U9WR73	Streptococcus_virus	32.3	3.0e-20
WP_140957524.1|2716003_2716441_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	68.1	1.7e-50
WP_013351549.1|2716572_2716752_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
WP_140957526.1|2716768_2717125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140957528.1|2717216_2718026_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	62.3	6.8e-98
WP_140957530.1|2718177_2718978_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	3.5e-70
WP_140957532.1|2719066_2719672_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	44.8	6.1e-19
WP_140957534.1|2719601_2719991_-	RNA polymerase subunit sigma	NA	A0A0N9RZI0	Paenibacillus_phage	44.3	2.2e-17
WP_140957536.1|2720060_2720450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140957538.1|2720422_2720866_-	hypothetical protein	NA	A0A1P8CX13	Bacillus_phage	60.7	5.8e-43
WP_140957540.1|2720747_2721407_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX13	Bacillus_phage	89.2	2.2e-86
WP_140957542.1|2721388_2721970_-	dephospho-CoA kinase	NA	U5PRK9	Bacillus_phage	45.1	1.4e-36
WP_140957544.1|2721966_2722914_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	58.2	2.1e-45
WP_140957547.1|2722929_2723553_-	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	58.8	1.4e-26
WP_140957549.1|2723522_2724320_-	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	69.1	9.7e-89
WP_140957551.1|2724320_2724542_-	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	94.5	3.2e-34
WP_140957553.1|2724542_2725154_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.6	4.0e-42
WP_140957762.1|2725462_2726428_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.6	9.8e-144
WP_140957555.1|2726607_2728713_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	79.1	0.0e+00
WP_140957557.1|2728696_2729053_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	53.4	5.5e-28
WP_069013224.1|2729058_2729244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957559.1|2729240_2729480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957561.1|2729485_2729992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957563.1|2729992_2730187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957565.1|2730186_2730735_-	crossover junction endodeoxyribonuclease RuvC	NA	A0A2H4IZL3	uncultured_Caudovirales_phage	43.5	2.0e-32
WP_140957567.1|2730716_2731037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957569.1|2731036_2732098_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.8	5.4e-79
WP_140957571.1|2732094_2732391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957573.1|2732383_2733094_-	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	44.3	2.3e-33
WP_140957575.1|2733095_2735333_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	54.3	8.4e-215
WP_140957577.1|2735508_2735688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957579.1|2735677_2736961_-	hypothetical protein	NA	A0A2H4J459	uncultured_Caudovirales_phage	26.0	2.9e-18
WP_140957581.1|2736961_2737213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247563.1|2737213_2737648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957582.1|2737690_2738446_-	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	50.0	1.0e-55
WP_140957584.1|2738683_2739250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957586.1|2739550_2740186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957588.1|2740451_2741693_-	hypothetical protein	NA	A0A288WG12	Bacillus_phage	31.0	2.7e-53
WP_140957590.1|2741806_2742016_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_140957592.1|2742071_2742317_+	helix-turn-helix domain-containing protein	NA	O64102	Bacillus_phage	41.2	2.8e-07
WP_140957594.1|2742333_2743329_-	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.9	1.8e-71
WP_140957597.1|2743463_2744852_-	DNA helicase	NA	A0A0N9SIP5	Paenibacillus_phage	55.3	4.0e-138
WP_140957599.1|2744848_2745073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957601.1|2745069_2745579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957603.1|2745575_2746358_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	55.3	2.7e-75
WP_140957606.1|2746377_2746590_-	hypothetical protein	NA	U5Q038	Bacillus_phage	69.6	5.1e-21
WP_140957608.1|2746586_2747621_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	43.7	2.5e-60
WP_140957610.1|2747883_2748252_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	41.4	4.7e-22
WP_140957611.1|2748238_2748472_-	hypothetical protein	NA	A0A0Y0ATQ5	Bacillus_phage	50.7	1.9e-13
WP_140957613.1|2748468_2748831_-	DUF1642 domain-containing protein	NA	R4JGJ3	Bacillus_phage	40.3	2.5e-12
WP_029974761.1|2749224_2749548_-	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	37.8	1.7e-07
WP_140957615.1|2749537_2749780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025851674.1|2749957_2750377_-	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	2.7e-34
WP_140957617.1|2750392_2750842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957619.1|2750838_2751300_-	hypothetical protein	NA	A0A1P8CX70	Bacillus_phage	33.8	2.6e-09
WP_140957621.1|2751430_2752486_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	27.7	2.2e-08
WP_038459402.1|2753033_2753543_-	metallophosphoesterase	NA	NA	NA	NA	NA
2752649:2752698	attR	TACGTCCCAGGAGAGATTCGAACTCCCGACCGACGGCTTAGAAGGCCGTT	NA	NA	NA	NA
WP_087920775.1|2753558_2754155_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	31.7	1.1e-09
>prophage 8
NZ_CP041143	Bacillus velezensis strain UCMB5007 chromosome, complete genome	3983323	3650102	3699337	3983323	protease,coat	Staphylococcus_phage(16.67%)	50	NA	NA
WP_045209218.1|3650102_3650762_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003151042.1|3650867_3651056_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_140957690.1|3651096_3651513_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038460224.1|3651898_3653278_+	amino acid permease	NA	NA	NA	NA	NA
WP_007407653.1|3653342_3653843_-	YwgA family protein	NA	NA	NA	NA	NA
WP_032875878.1|3653882_3655184_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	8.0e-24
WP_003151034.1|3655343_3655568_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_038464372.1|3655770_3656544_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_007407657.1|3656843_3657119_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088461817.1|3657119_3657674_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_044802454.1|3657771_3658692_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.0	7.6e-37
WP_105937189.1|3658688_3659642_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_105937188.1|3659631_3660468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105937187.1|3660458_3661256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105937186.1|3661224_3662148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151018.1|3662196_3662376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038460235.1|3662527_3663391_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_007407666.1|3663437_3664337_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
WP_105937185.1|3664452_3665430_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_003151012.1|3665468_3666440_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003151011.1|3666697_3667462_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_101670735.1|3667581_3668361_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_105937184.1|3668377_3669577_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_007407671.1|3669589_3670771_-	MFS transporter	NA	NA	NA	NA	NA
WP_088461827.1|3670767_3672186_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_044802445.1|3672203_3672965_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	1.1e-20
WP_003151000.1|3672961_3673672_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032875842.1|3673661_3674276_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_045209231.1|3674437_3675676_-	MFS transporter	NA	NA	NA	NA	NA
WP_105937183.1|3675898_3677101_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.4	7.1e-27
WP_105937182.1|3677133_3678552_-	amino acid permease	NA	NA	NA	NA	NA
WP_105937181.1|3678576_3680259_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003150992.1|3680330_3681878_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_105937180.1|3682085_3683372_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_140957692.1|3683604_3684540_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	7.5e-24
WP_105937178.1|3684541_3685240_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	1.1e-35
WP_105937177.1|3686317_3687022_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025649399.1|3687086_3688013_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.9	1.1e-43
WP_003150986.1|3688359_3688815_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_072589688.1|3688811_3689660_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	4.1e-37
WP_020957994.1|3689680_3690628_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	5.9e-69
WP_003150981.1|3690630_3691368_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_105937176.1|3691395_3692400_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_101670214.1|3692401_3693145_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007614529.1|3693134_3694256_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_105937175.1|3694255_3695119_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038460278.1|3695119_3696289_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_105937174.1|3696311_3697736_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_003150972.1|3697740_3698511_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
WP_007614539.1|3698791_3699337_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
