The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041144	Bacillus velezensis strain UCMB5044 chromosome, complete genome	3983303	655487	665378	3983303		Synechococcus_phage(50.0%)	9	NA	NA
WP_007408896.1|655487_656780_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_088461589.1|656855_657575_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.7	4.4e-48
WP_003155758.1|657574_657829_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_105938008.1|657825_658509_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_105938007.1|658492_660721_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	1.6e-157
WP_007609856.1|660696_662127_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_105938006.1|662218_663259_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.3	1.4e-63
WP_007408902.1|663255_663843_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
WP_105938005.1|663839_665378_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	3.0e-78
>prophage 2
NZ_CP041144	Bacillus velezensis strain UCMB5044 chromosome, complete genome	3983303	1209163	1221249	3983303	portal,holin	uncultured_Caudovirales_phage(40.0%)	20	NA	NA
WP_140995944.1|1209163_1210300_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.6	1.1e-93
WP_140957286.1|1210289_1210424_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003154880.1|1210566_1211520_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_007610770.1|1211557_1211935_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_015239671.1|1212044_1212650_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	6.1e-43
WP_014417517.1|1212788_1213379_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1213527_1213866_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_029325864.1|1214056_1214236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105937831.1|1214225_1215053_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	1.7e-19
WP_105937830.1|1214952_1215753_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	1.4e-58
WP_032874575.1|1216017_1216359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|1216348_1216552_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_105937829.1|1216658_1217171_+	Fis family transcriptional regulator	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	6.5e-22
WP_140957745.1|1217893_1218361_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	47.9	2.0e-33
WP_032874603.1|1218373_1218745_+	YomQ/XkdW protein, phage-like element PBSX	NA	NA	NA	NA	NA
WP_105937827.1|1218749_1218947_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	60.0	1.2e-13
WP_105937826.1|1219003_1219765_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003154815.1|1219816_1220080_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1220093_1220357_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_105937825.1|1220370_1221249_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	6.3e-81
>prophage 3
NZ_CP041144	Bacillus velezensis strain UCMB5044 chromosome, complete genome	3983303	1772636	1778849	3983303		Bacillus_phage(50.0%)	7	NA	NA
WP_003154061.1|1772636_1773029_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
WP_007611605.1|1772988_1775091_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
WP_012117608.1|1775108_1776098_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
WP_032874993.1|1776146_1776767_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	5.4e-47
WP_020955856.1|1776815_1777574_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	4.8e-53
WP_101670455.1|1777607_1777832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015417523.1|1777880_1778849_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 4
NZ_CP041144	Bacillus velezensis strain UCMB5044 chromosome, complete genome	3983303	2064084	2077909	3983303		Bacillus_phage(90.91%)	14	NA	NA
WP_007612048.1|2064084_2064510_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	35.6	2.1e-13
WP_007612049.1|2064543_2064720_-	hypothetical protein	NA	O64196	Bacillus_phage	93.1	5.0e-22
WP_007407924.1|2064722_2064929_-	hypothetical protein	NA	O64195	Bacillus_phage	73.3	1.1e-15
WP_007407922.1|2065869_2066106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407921.1|2066229_2066604_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	51.2	1.2e-28
WP_140957336.1|2066829_2067282_-	hypothetical protein	NA	O64117	Bacillus_phage	77.3	4.8e-61
WP_021493942.1|2068770_2068893_+	PhrK family phosphatase-inhibitory pheromone	NA	NA	NA	NA	NA
WP_007612065.1|2070175_2070514_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	60.2	3.8e-26
WP_140957338.1|2071283_2071886_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	78.9	2.5e-81
WP_140957341.1|2071948_2072446_-	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	90.9	4.2e-90
WP_140957343.1|2072454_2074173_-	hypothetical protein	NA	O64023	Bacillus_phage	75.9	1.6e-242
WP_105938235.1|2074209_2074644_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_105937603.1|2074909_2075875_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.0	1.9e-78
WP_105937602.1|2076241_2077909_+	recombinase family protein	NA	O64015	Bacillus_phage	90.0	5.4e-275
>prophage 5
NZ_CP041144	Bacillus velezensis strain UCMB5044 chromosome, complete genome	3983303	2114734	2154841	3983303	portal,holin,terminase,capsid,tail,integrase,head	uncultured_Caudovirales_phage(47.06%)	60	2152436:2152450	2161753:2161767
WP_003155834.1|2114734_2115157_-|holin	holin	holin	D6R405	Bacillus_phage	88.0	9.4e-59
WP_015239639.1|2115191_2115413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957357.1|2115426_2115594_-	XkdX family protein	NA	NA	NA	NA	NA
WP_140957359.1|2115732_2116122_-	hypothetical protein	NA	O48465	Bacillus_phage	52.4	5.5e-29
WP_140957361.1|2116137_2119494_-	hypothetical protein	NA	Q5YA57	Bacillus_phage	46.1	2.7e-132
WP_140957363.1|2119506_2120271_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_140957365.1|2120267_2124983_-	hypothetical protein	NA	M9NRJ5	Staphylococcus_phage	25.3	9.9e-40
WP_071348589.1|2124987_2125296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957367.1|2125343_2125850_-	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	32.7	1.5e-10
WP_140957749.1|2125907_2126150_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_140957370.1|2126163_2126496_-	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	75.3	1.8e-25
WP_007408587.1|2126419_2126935_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_140957372.1|2126948_2127347_-	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	44.6	4.9e-25
WP_007408589.1|2127365_2127782_-	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	54.2	7.4e-32
WP_140957374.1|2127774_2128113_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_140957376.1|2128109_2128409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957378.1|2128417_2128669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957380.1|2128670_2129006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957382.1|2129010_2129928_-|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	67.5	8.5e-113
WP_140957751.1|2129943_2130531_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	53.6	7.0e-52
WP_140957384.1|2130633_2131560_-|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	51.5	1.7e-81
WP_140957386.1|2131546_2132950_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.8	6.4e-152
WP_140957754.1|2132949_2134158_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	87.2	3.4e-210
WP_140957388.1|2134144_2134906_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	56.9	1.5e-67
WP_140957390.1|2135202_2135961_+	DUF4393 domain-containing protein	NA	A0A1S5S9V3	Streptococcus_phage	35.9	1.5e-35
WP_105938240.1|2136230_2136602_-	YrdB family protein	NA	NA	NA	NA	NA
WP_105937692.1|2136631_2136841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071347897.1|2136922_2137465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957392.1|2137591_2138224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071347895.1|2138370_2138832_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	51.2	2.6e-25
WP_071347894.1|2138831_2139038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957394.1|2139432_2139612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957396.1|2139622_2140057_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	4.1e-49
WP_026092239.1|2140059_2140305_-	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
WP_140957398.1|2140301_2140610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140995949.1|2140606_2140993_-	hypothetical protein	NA	A0A2H4J4Q6	uncultured_Caudovirales_phage	52.1	3.6e-33
WP_140957402.1|2140989_2141388_-	hypothetical protein	NA	R4JKA5	Bacillus_phage	64.1	3.6e-44
WP_140957404.1|2141388_2141640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957406.1|2141641_2142253_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	48.8	1.9e-36
WP_140957408.1|2142249_2142573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957410.1|2142690_2142945_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	41.6	2.2e-07
WP_140957412.1|2142941_2143325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155894.1|2143356_2143560_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_016938684.1|2143850_2144279_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	62.0	4.8e-42
WP_140957414.1|2144513_2145461_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	4.0e-57
WP_140957416.1|2145345_2146047_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	33.3	9.0e-06
WP_044803177.1|2146213_2147056_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	84.4	5.5e-127
WP_140957418.1|2147058_2148009_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	69.2	2.1e-127
WP_140957420.1|2148008_2148194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957422.1|2148295_2148493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957424.1|2148489_2148747_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	40.2	1.7e-07
WP_140957426.1|2148743_2149316_-	helix-turn-helix domain-containing protein	NA	A0A2H4J884	uncultured_Caudovirales_phage	57.1	4.0e-60
WP_140957428.1|2149425_2150187_-	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	71.1	3.3e-102
WP_140957430.1|2150190_2150400_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_140957433.1|2150524_2151001_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_140957435.1|2151233_2151548_-	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	55.7	1.0e-17
WP_140957437.1|2151587_2151818_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_140957439.1|2151980_2152343_+	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	44.0	1.9e-15
2152436:2152450	attL	TGGATCGGAAAAGAA	NA	NA	NA	NA
WP_140957756.1|2152599_2153502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140957441.1|2153644_2154841_+|integrase	tyrosine-type recombinase/integrase	integrase	S6C485	Thermus_phage	44.2	4.2e-80
2161753:2161767	attR	TTCTTTTCCGATCCA	NA	NA	NA	NA
>prophage 6
NZ_CP041144	Bacillus velezensis strain UCMB5044 chromosome, complete genome	3983303	2255828	2262081	3983303		Staphylococcus_phage(66.67%)	10	NA	NA
WP_007409428.1|2255828_2256422_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_007409427.1|2256411_2257167_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
WP_003153376.1|2257374_2257464_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_105937566.1|2257551_2258073_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153374.1|2258017_2258233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153373.1|2258138_2258513_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2258629_2259094_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_105937565.1|2259126_2260323_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	1.6e-116
WP_105937564.1|2260337_2260985_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.0e-39
WP_105937563.1|2260965_2262081_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	1.7e-54
>prophage 7
NZ_CP041144	Bacillus velezensis strain UCMB5044 chromosome, complete genome	3983303	2632029	2754138	3983303	portal,holin,tail,plate,tRNA,capsid,integrase,coat,protease	Bacillus_phage(40.3%)	143	2685972:2686021	2752632:2752681
WP_038459368.1|2632029_2633220_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_044801623.1|2633347_2634451_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_105937483.1|2634452_2635301_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_105937482.1|2635282_2636848_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_007408177.1|2636951_2638103_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A141ZJV0	Faustovirus	29.9	4.6e-31
WP_038459375.1|2638099_2638642_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_103695111.1|2638667_2639525_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2639538_2639982_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_007408172.1|2640037_2641324_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_032873815.1|2641355_2641934_-	sporulation protein	NA	NA	NA	NA	NA
WP_003152662.1|2642251_2642536_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012118103.1|2642548_2642890_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2642892_2643201_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_088461173.1|2643346_2644213_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_007408168.1|2644205_2645009_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_016938784.1|2645136_2645940_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003152653.1|2645942_2646623_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_007408167.1|2646676_2647195_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_007408166.1|2647191_2648055_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003152647.1|2648085_2649099_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_007408165.1|2649190_2649886_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_012118105.1|2649917_2650487_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_105937481.1|2650627_2651629_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_105937480.1|2651755_2652508_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_105937479.1|2652647_2653940_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_105937478.1|2653998_2656641_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
WP_007612879.1|2657093_2657285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105938230.1|2657299_2658322_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_140957469.1|2658355_2660155_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038459388.1|2660287_2661577_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_029326045.1|2661605_2662580_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_020956156.1|2662585_2663365_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_105937477.1|2663354_2664296_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_007408154.1|2664330_2665161_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_003152628.1|2665168_2666536_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_105937476.1|2666731_2667223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007612895.1|2667255_2667843_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_007612896.1|2667839_2670164_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	1.4e-183
WP_007612897.1|2670362_2672021_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_007612899.1|2672171_2673434_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.5	1.5e-147
WP_105937475.1|2673705_2674980_-	trigger factor	NA	NA	NA	NA	NA
WP_088461297.1|2675196_2676201_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_105937474.1|2676318_2676918_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_105937473.1|2676933_2678352_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_105937472.1|2678401_2679499_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_105937471.1|2679519_2681076_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	35.0	3.5e-10
WP_105937470.1|2681062_2682091_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_045208389.1|2682113_2682632_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_105938229.1|2682628_2684353_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	29.6	5.4e-60
WP_044801606.1|2685146_2685497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007408136.1|2685536_2685722_-	hypothetical protein	NA	NA	NA	NA	NA
2685972:2686021	attL	TACGTCCCAGGAGAGATTCGAACTCCCGACCGACGGCTTAGAAGGCCGTT	NA	NA	NA	NA
WP_140957471.1|2686185_2687001_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	30.2	1.1e-15
WP_069473335.1|2687132_2687339_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_140957473.1|2687363_2687609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140957475.1|2687668_2688004_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.7	4.4e-11
WP_140957477.1|2688019_2688580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069013261.1|2688672_2688930_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	56.5	1.6e-21
WP_140957480.1|2688951_2689890_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	66.6	7.9e-98
WP_013351581.1|2689969_2690179_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_140957482.1|2690182_2690371_-	XkdX family protein	NA	NA	NA	NA	NA
WP_140957484.1|2690371_2690641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957758.1|2690655_2692206_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	54.0	1.4e-54
WP_140957486.1|2692251_2694816_-	peptidase G2	NA	D6R401	Bacillus_phage	74.1	0.0e+00
WP_140957488.1|2694830_2696231_-	endopeptidase	NA	A6M966	Geobacillus_virus	31.2	3.3e-39
WP_140957490.1|2696242_2697667_-|tail	phage tail protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	44.0	2.4e-61
WP_140957492.1|2697673_2700472_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	38.3	7.3e-99
WP_140957496.1|2700472_2700709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957498.1|2700804_2701176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029973260.1|2701233_2701788_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_104678878.1|2701812_2702202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957500.1|2702208_2702616_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	2.3e-30
WP_129091899.1|2702612_2702933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957502.1|2702948_2703335_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.0	3.0e-19
WP_099320068.1|2703348_2703567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957504.1|2703875_2704979_-	DUF5309 family protein	NA	A0A2I7S650	Vibrio_phage	27.3	2.8e-30
WP_140957506.1|2704990_2705662_-|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	45.5	1.6e-15
WP_140957508.1|2705753_2706578_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	52.7	1.2e-73
WP_140957510.1|2706577_2708209_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	58.0	9.6e-168
WP_046341194.1|2708211_2708643_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	50.4	6.5e-31
WP_140957513.1|2708659_2710414_-	hypothetical protein	NA	A0A2H4J484	uncultured_Caudovirales_phage	71.4	3.7e-250
WP_140957515.1|2710496_2711045_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	50.0	1.2e-37
WP_140957760.1|2711242_2711461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957517.1|2712583_2712865_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	51.2	1.2e-17
WP_025851577.1|2714231_2714462_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_140957519.1|2714929_2715130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140957521.1|2715235_2715973_+	DUF2786 domain-containing protein	NA	A0A1U9WR73	Streptococcus_virus	32.3	3.0e-20
WP_140957524.1|2715986_2716424_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	68.1	1.7e-50
WP_013351549.1|2716555_2716735_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
WP_140957526.1|2716751_2717108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140957528.1|2717199_2718009_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	62.3	6.8e-98
WP_140957530.1|2718160_2718961_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	3.5e-70
WP_140957532.1|2719049_2719655_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	44.8	6.1e-19
WP_140957534.1|2719584_2719974_-	RNA polymerase subunit sigma	NA	A0A0N9RZI0	Paenibacillus_phage	44.3	2.2e-17
WP_140957536.1|2720043_2720433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140957538.1|2720405_2720849_-	hypothetical protein	NA	A0A1P8CX13	Bacillus_phage	60.7	5.8e-43
WP_140957540.1|2720730_2721390_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX13	Bacillus_phage	89.2	2.2e-86
WP_140957542.1|2721371_2721953_-	dephospho-CoA kinase	NA	U5PRK9	Bacillus_phage	45.1	1.4e-36
WP_140957544.1|2721949_2722897_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	58.2	2.1e-45
WP_140957547.1|2722912_2723536_-	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	58.8	1.4e-26
WP_140957549.1|2723505_2724303_-	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	69.1	9.7e-89
WP_140957551.1|2724303_2724525_-	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	94.5	3.2e-34
WP_140957553.1|2724525_2725137_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.6	4.0e-42
WP_140957762.1|2725445_2726411_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.6	9.8e-144
WP_140957555.1|2726590_2728696_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	79.1	0.0e+00
WP_140957557.1|2728679_2729036_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	53.4	5.5e-28
WP_069013224.1|2729041_2729227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957559.1|2729223_2729463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957561.1|2729468_2729975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957563.1|2729975_2730170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957565.1|2730169_2730718_-	crossover junction endodeoxyribonuclease RuvC	NA	A0A2H4IZL3	uncultured_Caudovirales_phage	43.5	2.0e-32
WP_140957567.1|2730699_2731020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957569.1|2731019_2732081_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.8	5.4e-79
WP_140957571.1|2732077_2732374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957573.1|2732366_2733077_-	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	44.3	2.3e-33
WP_140957575.1|2733078_2735316_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	54.3	8.4e-215
WP_140957577.1|2735491_2735671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957579.1|2735660_2736944_-	hypothetical protein	NA	A0A2H4J459	uncultured_Caudovirales_phage	26.0	2.9e-18
WP_140957581.1|2736944_2737196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247563.1|2737196_2737631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957582.1|2737673_2738429_-	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	50.0	1.0e-55
WP_140957584.1|2738666_2739233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140995952.1|2739533_2740169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957588.1|2740434_2741676_-	hypothetical protein	NA	A0A288WG12	Bacillus_phage	31.0	2.7e-53
WP_140957590.1|2741789_2741999_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_140957592.1|2742054_2742300_+	helix-turn-helix domain-containing protein	NA	O64102	Bacillus_phage	41.2	2.8e-07
WP_140957594.1|2742316_2743312_-	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.9	1.8e-71
WP_140957597.1|2743446_2744835_-	DNA helicase	NA	A0A0N9SIP5	Paenibacillus_phage	55.3	4.0e-138
WP_140957599.1|2744831_2745056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957601.1|2745052_2745562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957603.1|2745558_2746341_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	55.3	2.7e-75
WP_140957606.1|2746360_2746573_-	hypothetical protein	NA	U5Q038	Bacillus_phage	69.6	5.1e-21
WP_140957608.1|2746569_2747604_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	43.7	2.5e-60
WP_140957610.1|2747866_2748235_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	41.4	4.7e-22
WP_140957611.1|2748221_2748455_-	hypothetical protein	NA	A0A0Y0ATQ5	Bacillus_phage	50.7	1.9e-13
WP_140957613.1|2748451_2748814_-	DUF1642 domain-containing protein	NA	R4JGJ3	Bacillus_phage	40.3	2.5e-12
WP_029974761.1|2749207_2749531_-	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	37.8	1.7e-07
WP_140957615.1|2749520_2749763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025851674.1|2749940_2750360_-	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	2.7e-34
WP_140957617.1|2750375_2750825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140957619.1|2750821_2751283_-	hypothetical protein	NA	A0A1P8CX70	Bacillus_phage	33.8	2.6e-09
WP_140957621.1|2751413_2752469_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	27.7	2.2e-08
WP_038459402.1|2753016_2753526_-	metallophosphoesterase	NA	NA	NA	NA	NA
2752632:2752681	attR	TACGTCCCAGGAGAGATTCGAACTCCCGACCGACGGCTTAGAAGGCCGTT	NA	NA	NA	NA
WP_087920775.1|2753541_2754138_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	31.7	1.1e-09
>prophage 8
NZ_CP041144	Bacillus velezensis strain UCMB5044 chromosome, complete genome	3983303	3650083	3699318	3983303	coat,protease	Staphylococcus_phage(16.67%)	50	NA	NA
WP_045209218.1|3650083_3650743_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003151042.1|3650848_3651037_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_140995960.1|3651074_3651494_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038460224.1|3651879_3653259_+	amino acid permease	NA	NA	NA	NA	NA
WP_007407653.1|3653323_3653824_-	YwgA family protein	NA	NA	NA	NA	NA
WP_032875878.1|3653863_3655165_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	8.0e-24
WP_003151034.1|3655324_3655549_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_038464372.1|3655751_3656525_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_007407657.1|3656824_3657100_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088461817.1|3657100_3657655_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_044802454.1|3657752_3658673_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.0	7.6e-37
WP_105937189.1|3658669_3659623_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_105937188.1|3659612_3660449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105937187.1|3660439_3661237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105937186.1|3661205_3662129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151018.1|3662177_3662357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038460235.1|3662508_3663372_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_007407666.1|3663418_3664318_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
WP_105937185.1|3664433_3665411_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_003151012.1|3665449_3666421_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003151011.1|3666678_3667443_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_101670735.1|3667562_3668342_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_105937184.1|3668358_3669558_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_007407671.1|3669570_3670752_-	MFS transporter	NA	NA	NA	NA	NA
WP_088461827.1|3670748_3672167_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_044802445.1|3672184_3672946_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	1.1e-20
WP_003151000.1|3672942_3673653_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032875842.1|3673642_3674257_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_045209231.1|3674418_3675657_-	MFS transporter	NA	NA	NA	NA	NA
WP_105937183.1|3675879_3677082_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.4	7.1e-27
WP_105937182.1|3677114_3678533_-	amino acid permease	NA	NA	NA	NA	NA
WP_105937181.1|3678557_3680240_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003150992.1|3680311_3681859_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_105937180.1|3682066_3683353_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_140957692.1|3683585_3684521_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	7.5e-24
WP_105937178.1|3684522_3685221_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	1.1e-35
WP_105937177.1|3686298_3687003_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025649399.1|3687067_3687994_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.9	1.1e-43
WP_003150986.1|3688340_3688796_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_072589688.1|3688792_3689641_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	4.1e-37
WP_020957994.1|3689661_3690609_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	5.9e-69
WP_003150981.1|3690611_3691349_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_105937176.1|3691376_3692381_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_101670214.1|3692382_3693126_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007614529.1|3693115_3694237_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_105937175.1|3694236_3695100_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038460278.1|3695100_3696270_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_105937174.1|3696292_3697717_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_003150972.1|3697721_3698492_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
WP_007614539.1|3698772_3699318_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
