The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041082	Klebsiella pneumoniae strain Kp202, complete genome	5462019	132587	145070	5462019	integrase	Morganella_phage(33.33%)	16	132567:132580	149847:149860
132567:132580	attL	CTATTTCTGGATGA	NA	NA	NA	NA
WP_100117515.1|132587_132911_-	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	45.0	8.0e-18
WP_074513081.1|132980_133139_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_029497057.1|133575_134532_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	43.0	4.6e-61
WP_029497056.1|134544_134982_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	35.1	7.3e-14
WP_100774730.1|135682_138445_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.7	1.0e-294
WP_100774729.1|138459_139086_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	34.2	5.0e-24
WP_029497051.1|139082_139295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029497050.1|139291_139552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117008212.1|139548_140508_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	41.2	1.6e-05
WP_004866303.1|140504_140684_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_074513084.1|140683_141256_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	58.0	2.6e-51
WP_074513085.1|141287_142097_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	44.1	1.5e-28
WP_074513086.1|142110_142458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070544355.1|142457_142676_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_124034788.1|142823_143696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074513109.1|143810_145070_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	80.3	1.3e-199
149847:149860	attR	CTATTTCTGGATGA	NA	NA	NA	NA
>prophage 2
NZ_CP041082	Klebsiella pneumoniae strain Kp202, complete genome	5462019	1325401	1391484	5462019	protease,tail,capsid,terminase,holin,transposase,integrase	Salmonella_phage(41.67%)	72	1326396:1326413	1394232:1394249
WP_032418525.1|1325401_1326868_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.5e-87
1326396:1326413	attL	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
WP_004151979.1|1326935_1328513_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_032418526.1|1328704_1329958_+|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	83.6	3.5e-202
WP_032418527.1|1330219_1330882_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	75.5	4.7e-97
WP_032418529.1|1330878_1331481_-	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	92.4	4.0e-103
WP_023285452.1|1331477_1331984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009485474.1|1331980_1332139_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.8	8.7e-18
WP_009485475.1|1332131_1332425_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004144294.1|1332534_1332783_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_032418530.1|1332833_1333856_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	4.0e-180
WP_004144292.1|1333865_1334765_-	endonuclease	NA	Q858E0	Salmonella_phage	91.0	6.5e-158
WP_004164029.1|1334761_1335061_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1335427_1336009_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1336163_1336397_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1336543_1336753_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1336752_1337520_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1337516_1338302_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_032418534.1|1338421_1338769_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	81.7	1.9e-49
WP_032419436.1|1338961_1339363_+	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	51.6	8.7e-22
WP_025860565.1|1339434_1339644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418536.1|1339640_1339895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032419437.1|1339894_1340158_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	65.5	3.5e-27
WP_032418538.1|1340851_1341091_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	8.6e-09
WP_032418539.1|1341090_1341429_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	79.1	3.1e-44
WP_032418540.1|1341503_1341761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418541.1|1341838_1342423_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	9.9e-91
WP_032418542.1|1342419_1343895_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.4	2.4e-279
WP_032413826.1|1343937_1344309_-	phage family protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	93.5	6.8e-61
WP_071890493.1|1344359_1344560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004225268.1|1344896_1345085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152472.1|1345106_1345310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004149313.1|1345313_1346993_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
WP_004152470.1|1346989_1347295_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|1347576_1347975_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_117008232.1|1347987_1348995_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	6.1e-181
WP_004152466.1|1349004_1349397_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_024622837.1|1349389_1349668_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_004197381.1|1349716_1350328_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
WP_032418543.1|1350327_1352805_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.4	2.3e-266
WP_032418545.1|1352806_1353277_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	9.5e-44
WP_025860587.1|1353269_1353767_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	8.9e-24
WP_032418548.1|1353779_1356524_+	bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	39.7	3.9e-97
WP_032418549.1|1356523_1359913_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	2.4e-120
WP_025368005.1|1359922_1360537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071844733.1|1360572_1360725_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	5.6e-14
WP_032418553.1|1361154_1361343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418554.1|1361494_1362184_-	anti-repressor protein	NA	A0A193GYJ9	Enterobacter_phage	58.5	9.9e-74
WP_057193984.1|1362655_1363507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409245.1|1363720_1364017_-	hypothetical protein	NA	T1SA06	Salmonella_phage	62.7	1.2e-23
WP_032418557.1|1366685_1366961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418558.1|1367073_1367478_+	membrane protein	NA	T1SA79	Salmonella_phage	82.6	2.1e-55
WP_032418559.1|1367464_1367770_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	4.6e-39
WP_032418560.1|1367759_1368389_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	78.4	1.5e-92
WP_032418561.1|1368385_1368886_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	90.0	1.1e-69
WP_009309501.1|1369072_1370941_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_032440239.1|1370924_1372103_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_032418564.1|1372396_1373629_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913846.1|1373726_1374614_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913843.1|1374710_1374902_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
WP_021469752.1|1375254_1377483_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_004149289.1|1377536_1379069_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913838.1|1379072_1381133_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004145656.1|1381313_1381955_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
WP_002913836.1|1381951_1382989_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004213188.1|1383252_1384146_+	ROK family protein	NA	NA	NA	NA	NA
WP_004174870.1|1384155_1385589_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913827.1|1385806_1386433_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913824.1|1386528_1387815_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_020947395.1|1387913_1388615_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913812.1|1388611_1389523_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_002913810.1|1389651_1390011_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913807.1|1390020_1391484_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
1394232:1394249	attR	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
>prophage 3
NZ_CP041082	Klebsiella pneumoniae strain Kp202, complete genome	5462019	1782793	1791172	5462019		Enterobacteria_phage(28.57%)	8	NA	NA
WP_032418677.1|1782793_1784200_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.8e-37
WP_032418679.1|1784422_1785487_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
WP_004175258.1|1785513_1786383_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_004175259.1|1786414_1787305_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_021313307.1|1787319_1787874_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_004175261.1|1788053_1789220_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_032409012.1|1789645_1789768_-	small membrane protein	NA	NA	NA	NA	NA
WP_004175262.1|1790167_1791172_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 4
NZ_CP041082	Klebsiella pneumoniae strain Kp202, complete genome	5462019	1915588	2049656	5462019	head,protease,portal,tail,capsid,plate,terminase,holin,integrase,tRNA	Enterobacteria_phage(23.4%)	152	1968351:1968369	2006099:2006117
WP_000059623.1|1915588_1916851_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	4.8e-74
WP_002911729.1|1917418_1918336_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_032418726.1|1918442_1919393_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_064147810.1|1919471_1920413_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004141160.1|1920791_1921712_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002911718.1|1921852_1922242_+	RidA family protein	NA	NA	NA	NA	NA
WP_002911599.1|1922907_1923705_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_004184758.1|1924000_1924993_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
WP_032418728.1|1924994_1925222_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	3.8e-30
WP_077261142.1|1925254_1925533_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	44.9	6.7e-13
WP_050598702.1|1925529_1926438_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.6	9.8e-45
WP_055314381.1|1926430_1927507_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.1	2.1e-147
WP_032418730.1|1927634_1928420_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	1.4e-60
WP_032418731.1|1928419_1928719_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	3.8e-14
WP_032418732.1|1928806_1929724_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.9	3.1e-46
WP_032408726.1|1930170_1930818_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_016530206.1|1930922_1931120_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_004213338.1|1931145_1931607_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001208720.1|1931844_1932024_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_032418734.1|1932013_1932982_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	1.0e-84
WP_032418735.1|1933187_1934012_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.5	2.6e-113
WP_032418736.1|1934021_1934399_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	3.3e-47
WP_032418737.1|1934411_1935392_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	8.4e-135
WP_032418738.1|1935405_1935984_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	1.7e-50
WP_032418739.1|1936135_1936375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140561791.1|1936545_1936842_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	84.7	7.6e-39
WP_032418741.1|1936841_1937381_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	2.0e-101
WP_032418742.1|1937377_1937725_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	2.1e-40
WP_032418743.1|1937721_1937997_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	70.3	3.9e-05
WP_032418744.1|1937947_1938142_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.3	4.6e-21
WP_022065473.1|1938499_1938745_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.6e-34
WP_032419453.1|1939256_1939607_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	4.6e-51
WP_004884285.1|1939738_1940233_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_032418747.1|1940229_1941960_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.4	9.2e-302
WP_021313630.1|1941969_1942155_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	63.9	5.2e-14
WP_004899640.1|1942154_1943384_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.5	1.7e-201
WP_004884313.1|1943370_1944024_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
WP_021313628.1|1944038_1945247_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.5	9.9e-194
WP_077254151.1|1945273_1945489_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	1.9e-07
WP_021313626.1|1945485_1945806_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
WP_032408655.1|1945814_1946153_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
WP_019705270.1|1946149_1946599_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_016530186.1|1946595_1946943_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_021313623.1|1946999_1947704_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	2.5e-80
WP_029497345.1|1947734_1948139_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	3.2e-32
WP_032418748.1|1948141_1948447_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.6	1.4e-27
WP_016530182.1|1948520_1948754_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_032418749.1|1948814_1952201_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.9	2.5e-303
WP_023301979.1|1952221_1952695_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.8	4.6e-54
WP_021313618.1|1952681_1953167_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
WP_021313617.1|1953176_1953557_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
WP_032418750.1|1953553_1956637_+	kinase	NA	A0A286S259	Klebsiella_phage	71.9	0.0e+00
WP_032419560.1|1959134_1959425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116993091.1|1959479_1961189_-	hypothetical protein	NA	H6X4Y8	Enterobacteria_phage	37.0	1.2e-16
WP_032418751.1|1961321_1961900_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	93.4	2.2e-90
WP_004892499.1|1961950_1962373_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
WP_004216505.1|1962784_1963024_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	54.4	7.5e-21
WP_032418752.1|1963026_1963353_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.9	1.6e-26
WP_002911596.1|1963956_1965102_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_004148893.1|1965493_1965760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151461.1|1965640_1965922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|1965964_1966672_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_032418753.1|1966715_1968149_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.7	2.0e-100
WP_032419454.1|1968129_1968624_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	9.7e-31
1968351:1968369	attL	TCTGTTTAAGGTGCCGGCC	NA	NA	NA	NA
WP_004184683.1|1968598_1969510_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911591.1|1969693_1970605_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_032418754.1|1970719_1972399_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	3.1e-20
WP_004151458.1|1972698_1972923_-	YodD family protein	NA	NA	NA	NA	NA
WP_004141144.1|1973047_1973245_+	protein DsrB	NA	NA	NA	NA	NA
WP_002911561.1|1973277_1973901_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_004175397.1|1974276_1974708_+	lipoprotein	NA	NA	NA	NA	NA
WP_004189225.1|1974749_1976237_-	alpha-amylase	NA	NA	NA	NA	NA
WP_004141135.1|1976437_1977238_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004180445.1|1977333_1978320_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_002911547.1|1978335_1979004_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_004151455.1|1979000_1979753_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
WP_002911542.1|1980070_1980793_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_002911541.1|1980860_1981085_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_002911539.1|1981546_1982203_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_002911538.1|1982199_1984032_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_002911537.1|1984089_1984638_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_032418755.1|1985211_1986219_-|integrase	tyrosine-type recombinase/integrase	integrase	Q1I119	Pasteurella_virus	56.5	1.3e-103
WP_050598706.1|1986215_1987082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418756.1|1987098_1987728_-	membrane protein	NA	NA	NA	NA	NA
WP_077261143.1|1987737_1988166_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	38.5	1.0e-07
WP_032418759.1|1988438_1988642_+	hypothetical protein	NA	P79674	Haemophilus_phage	37.1	6.4e-05
WP_050598721.1|1988864_1989062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418760.1|1989078_1989477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418761.1|1989486_1989759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418762.1|1989827_1990052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418763.1|1990048_1990627_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	41.1	3.2e-33
WP_032418764.1|1990635_1990863_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	49.0	5.5e-05
WP_032418765.1|1990859_1991054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418766.1|1991046_1992000_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.3	3.6e-82
WP_032418767.1|1992314_1993331_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	55.1	1.9e-97
WP_032418768.1|1993323_1995918_+	replication protein	NA	A0A0M4RTM8	Salmonella_phage	52.4	1.2e-196
WP_032418769.1|1996114_1997116_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_032418771.1|1997851_1998898_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.1	5.8e-142
WP_032418772.1|1998897_2000619_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.2	6.2e-226
WP_032418773.1|2000779_2001613_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	1.1e-95
WP_032418774.1|2001637_2002687_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.0	5.7e-105
WP_032418775.1|2002734_2003634_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	77.0	3.5e-87
WP_032418776.1|2003736_2004234_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	71.5	1.2e-60
WP_032418777.1|2004233_2004434_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	64.6	6.7e-15
WP_032418778.1|2004424_2004706_+	hypothetical protein	NA	B9A7B8	Serratia_phage	57.1	1.1e-18
WP_032418779.1|2004702_2005254_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	9.2e-30
WP_050598707.1|2005250_2005646_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_032418780.1|2005790_2006249_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.1	6.2e-32
2006099:2006117	attR	TCTGTTTAAGGTGCCGGCC	NA	NA	NA	NA
WP_032418781.1|2006245_2006887_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.3	1.5e-44
WP_032418782.1|2006886_2007465_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	62.6	5.1e-63
WP_032418783.1|2007461_2007830_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.3	2.3e-29
WP_032418784.1|2007816_2008716_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.9	6.2e-92
WP_032418785.1|2008708_2009305_+|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	46.3	1.5e-41
WP_140561738.1|2009309_2010233_+	hypothetical protein	NA	G8GDR5	Salmonella_phage	46.3	2.3e-09
WP_140561741.1|2010229_2011468_+	hypothetical protein	NA	H6X4Y8	Enterobacteria_phage	37.0	9.0e-17
WP_032418787.1|2012687_2013845_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.8	2.5e-45
WP_032418788.1|2013972_2014461_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	65.0	1.6e-49
WP_032418789.1|2014472_2017412_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	44.2	2.6e-208
WP_101972624.1|2017392_2017569_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	69.8	1.5e-10
WP_032418790.1|2017565_2017865_-	hypothetical protein	NA	B9A7B2	Serratia_phage	73.7	3.1e-32
WP_032418791.1|2017919_2018435_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
WP_032418792.1|2018434_2019616_-|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	1.2e-156
WP_032418793.1|2019769_2020924_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.7	4.2e-178
WP_044785060.1|2020968_2021217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004180444.1|2021603_2022485_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_023316206.1|2022583_2023252_+	YecA family protein	NA	NA	NA	NA	NA
WP_004151453.1|2023276_2024488_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_004175410.1|2024679_2024919_+	YecH family protein	NA	NA	NA	NA	NA
WP_004141101.1|2024954_2025452_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_020956668.1|2025509_2025689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911524.1|2027552_2027804_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_004175412.1|2027841_2029404_-	MFS transporter	NA	NA	NA	NA	NA
WP_004148869.1|2029418_2029577_+	succinate dehydrogenase	NA	NA	NA	NA	NA
WP_004175413.1|2029647_2030157_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_071890473.1|2030250_2030454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911518.1|2031051_2032032_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032418795.1|2032094_2033609_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	4.1e-11
WP_002911507.1|2033623_2034604_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_002911505.1|2034765_2035554_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_004175414.1|2035528_2036953_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_002911500.1|2036976_2037405_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_002911499.1|2037758_2039342_+	MFS transporter	NA	NA	NA	NA	NA
WP_004184668.1|2039346_2040486_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_004151452.1|2040547_2042281_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_002911491.1|2042516_2043086_+	VOC family protein	NA	NA	NA	NA	NA
WP_032418796.1|2043162_2043906_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_023316208.1|2043987_2044992_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|2044988_2045732_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|2045771_2046167_-	membrane protein	NA	NA	NA	NA	NA
WP_002911483.1|2046219_2047038_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_004145564.1|2047034_2047601_-	hydrolase	NA	NA	NA	NA	NA
WP_002911479.1|2047868_2049656_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
>prophage 5
NZ_CP041082	Klebsiella pneumoniae strain Kp202, complete genome	5462019	2138119	2186812	5462019	protease,transposase,plate	Staphylococcus_phage(22.22%)	42	NA	NA
WP_032418810.1|2138119_2138866_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_004211065.1|2139304_2140291_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032418811.1|2140283_2141084_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004145488.1|2141121_2141244_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_004148811.1|2141271_2141457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2141861_2142803_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2142896_2143886_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2143911_2145243_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_020804920.1|2145270_2146479_+	propionate kinase	NA	NA	NA	NA	NA
WP_020804899.1|2146507_2148802_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	2.6e-158
WP_020804919.1|2149231_2150347_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|2150456_2151371_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032418812.1|2151380_2152667_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004148803.1|2152663_2153539_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_002910721.1|2153535_2154255_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2154260_2155154_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|2155437_2157081_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|2157130_2157607_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2157705_2158632_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175494.1|2158935_2160231_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_004175495.1|2160245_2161052_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152315.1|2161026_2161926_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2162035_2162518_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004197491.1|2162708_2163407_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|2163432_2164017_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2164086_2164416_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_077254994.1|2164502_2164748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071890448.1|2164757_2164937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200314.1|2164984_2166325_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000608644.1|2166513_2167776_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|2168031_2168907_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|2168953_2169286_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_004180407.1|2169297_2169951_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032418814.1|2169954_2171652_+	OmpA family protein	NA	NA	NA	NA	NA
WP_071891524.1|2174741_2176769_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	30.0	5.2e-70
WP_140561747.1|2178170_2178578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004899008.1|2178603_2178861_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032418815.1|2178865_2180077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117008229.1|2183039_2184803_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024622680.1|2184802_2185849_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032418817.1|2185823_2186366_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032418818.1|2186368_2186812_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 6
NZ_CP041082	Klebsiella pneumoniae strain Kp202, complete genome	5462019	2858571	2869458	5462019		Escherichia_phage(87.5%)	9	NA	NA
WP_032419001.1|2858571_2861679_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_032419002.1|2861733_2862999_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2863029_2864118_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2864204_2864465_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2864762_2865623_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|2865643_2866405_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_117008240.1|2866665_2867568_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	1.3e-158
WP_004224682.1|2867579_2868845_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|2868837_2869458_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP041082	Klebsiella pneumoniae strain Kp202, complete genome	5462019	3576706	3586180	5462019	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_023158537.1|3576706_3578428_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3578472_3579174_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3579527_3579746_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_117008244.1|3579876_3582156_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.8e-165
WP_002896520.1|3582186_3582504_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3582829_3583051_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_117008243.1|3583127_3585068_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3585064_3586180_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
NZ_CP041082	Klebsiella pneumoniae strain Kp202, complete genome	5462019	4095959	4143109	5462019	holin,terminase,head,integrase,tRNA	Cronobacter_phage(24.07%)	71	4092913:4092958	4140181:4140226
4092913:4092958	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_032419291.1|4095959_4098437_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	2.6e-196
WP_032419292.1|4098423_4098819_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	3.6e-36
WP_032419293.1|4098815_4099286_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
WP_117008211.1|4099285_4099705_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	2.6e-29
WP_074513099.1|4099874_4100045_+	ATP-NAD kinase	NA	NA	NA	NA	NA
WP_029884074.1|4100253_4100496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074513100.1|4100495_4103108_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	33.8	2.7e-79
WP_032415940.1|4103164_4103680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023342743.1|4103754_4103967_-	hypothetical protein	NA	H6WRV2	Salmonella_phage	58.8	1.0e-13
WP_032426232.1|4104046_4104406_-	hypothetical protein	NA	A0A1V0E5N7	Salmonella_phage	54.2	6.8e-34
WP_074513101.1|4104539_4105514_-	hypothetical protein	NA	A0A0M4REH5	Salmonella_phage	79.0	1.3e-79
WP_074513112.1|4105581_4105743_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_074513102.1|4105821_4106073_+	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	67.9	9.0e-25
WP_074513103.1|4106075_4106483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074513104.1|4106498_4106678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074513105.1|4106835_4107393_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	86.4	1.6e-85
WP_074513106.1|4107609_4108323_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	6.2e-63
WP_023339086.1|4109214_4109598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073546891.1|4109594_4109963_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	2.9e-48
WP_073546892.1|4110014_4110569_-	hypothetical protein	NA	A0A2I7S010	Vibrio_phage	39.7	4.3e-35
WP_040229587.1|4110666_4111029_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	52.5	4.3e-28
WP_048336937.1|4111028_4111202_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	4.1e-13
WP_004191534.1|4111201_4111582_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	3.1e-29
WP_032419306.1|4111584_4111878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178847.1|4111887_4112985_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	73.6	4.2e-151
WP_012967726.1|4112996_4113428_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	6.2e-42
WP_047680688.1|4113431_4114817_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.2	2.7e-155
WP_047680685.1|4114829_4115012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077269087.1|4115076_4115691_-	HNH endonuclease	NA	A0A2I7S0H7	Vibrio_phage	43.9	1.6e-30
WP_073546894.1|4115763_4116768_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.0	1.8e-108
WP_032419309.1|4116694_4118164_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	1.2e-148
WP_032419310.1|4118176_4119649_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	6.9e-250
WP_032419311.1|4119648_4120251_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	78.7	3.1e-79
WP_032419312.1|4120688_4121039_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	42.9	7.6e-14
WP_032419505.1|4121035_4121533_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	83.0	4.8e-78
WP_012542609.1|4121510_4121780_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_032419313.1|4121999_4122539_-	HNH endonuclease	NA	A5PJ37	Escherichia_virus	46.1	2.1e-34
WP_060578954.1|4122976_4123666_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	1.0e-57
WP_060578953.1|4123662_4123803_-	YlcG family protein	NA	NA	NA	NA	NA
WP_060578952.1|4123799_4124441_-	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	40.7	8.4e-35
WP_060578951.1|4124437_4125076_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	65.1	2.8e-70
WP_023342724.1|4125068_4125239_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_064147790.1|4125238_4125694_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.2	1.5e-54
WP_064147791.1|4125945_4126227_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	40.2	1.0e-05
WP_077267114.1|4126219_4126678_-	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	91.5	2.5e-28
WP_023339691.1|4127144_4127333_-	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	88.7	3.7e-23
WP_064147793.1|4127793_4128039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077267115.1|4128035_4128482_-	hypothetical protein	NA	K7P858	Enterobacteria_phage	42.8	4.1e-20
WP_012542626.1|4128484_4128778_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_117008209.1|4128777_4130208_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.2	9.0e-186
WP_117008208.1|4130197_4131097_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.5	2.7e-87
WP_004139615.1|4131321_4131543_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_032431544.1|4131583_4131811_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	5.6e-18
WP_032431543.1|4131879_4132602_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	62.8	4.7e-74
WP_020804196.1|4132624_4132744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|4133283_4133490_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_060568332.1|4133571_4133856_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	3.3e-39
WP_060578943.1|4133865_4134780_+	DNA recombinase	NA	G8C7T0	Escherichia_phage	91.4	1.0e-158
WP_064147796.1|4134776_4135259_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	92.5	3.1e-74
WP_055316540.1|4135293_4135599_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_055316537.1|4135595_4136252_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	2.7e-113
WP_032419330.1|4136248_4137385_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	73.1	7.4e-159
WP_032419331.1|4137600_4137873_+	hypothetical protein	NA	Q716F1	Shigella_phage	63.5	3.7e-24
WP_032419332.1|4137869_4138574_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	34.3	1.0e-25
WP_040182114.1|4138570_4138789_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_072032585.1|4138790_4139126_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021441323.1|4139002_4140166_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_072032583.1|4140235_4140559_-	hypothetical protein	NA	NA	NA	NA	NA
4140181:4140226	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143017.1|4140597_4141464_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|4141465_4141678_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4141723_4143109_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
NZ_CP041083	Klebsiella pneumoniae strain Kp202 plasmid pKp202_1, complete sequence	179254	107217	135673	179254	transposase,integrase	Enterobacteria_phage(22.22%)	26	112479:112492	132701:132714
WP_020442388.1|107217_108222_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001294663.1|108807_109158_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|109171_109447_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|109482_109905_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_020442400.1|109956_111651_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	2.0e-38
WP_001277456.1|111668_112031_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|112027_112264_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|112260_112968_+	EAL domain-containing protein	NA	NA	NA	NA	NA
112479:112492	attL	AGGCGCGTGGGTGC	NA	NA	NA	NA
WP_000935452.1|113006_114311_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000027057.1|114879_115740_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001217881.1|115922_116480_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000608644.1|117043_118306_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|118561_119437_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|119483_119816_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_004896925.1|122877_123420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155092.1|123778_124663_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|124718_126194_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_002001451.1|126592_127777_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|127825_128011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252464.1|128230_128512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140561819.1|128492_129266_-	Rmt family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_000050481.1|130664_132206_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|132610_133450_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
132701:132714	attR	AGGCGCGTGGGTGC	NA	NA	NA	NA
WP_060560601.1|133443_133746_-	bleomycin resistance protein	NA	NA	NA	NA	NA
WP_004201164.1|133749_134562_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004683689.1|134662_135673_-|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	4.1e-52
>prophage 1
NZ_CP041084	Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence	158439	1727	61046	158439	integrase,transposase,protease	uncultured_Caudovirales_phage(31.25%)	54	NA	NA
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|4961_5885_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|6554_6812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140561822.1|7413_8868_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9850_11128_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|11190_13188_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14227_15435_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16863_17295_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17545_19021_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_117241251.1|19013_19694_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000475512.1|19883_21269_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21297_21651_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21764_23057_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23067_26214_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26300_26741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26867_29315_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29355_29553_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29586_30324_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30612_31062_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|31295_33113_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33112_34009_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34048_34429_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34433_35363_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35417_36098_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36094_37495_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37711_38146_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38377_38557_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40299_40809_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40858_41356_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41687_42014_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|42013_42724_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42732_43278_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43353_43716_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|45612_46149_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46181_46607_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46619_47909_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|47956_49708_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49725_50088_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50137_50488_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50845_51115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51102_51678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51708_52203_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52246_52615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52648_52852_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52900_53158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53233_53488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53663_53930_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53917_54400_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001567368.1|54600_56004_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|56032_56665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314316.1|56894_58241_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|60083_61046_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP041084	Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence	158439	66533	94813	158439	transposase	Escherichia_phage(30.77%)	26	NA	NA
WP_004118209.1|66533_66797_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|67998_68979_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004159231.1|69155_69482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152692.1|70187_71057_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|71050_72061_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|72069_72897_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|72905_73769_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|73765_74593_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|75448_76153_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_073972769.1|76188_76734_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.6	2.2e-31
WP_004197546.1|76763_77630_-	class A beta-lactamase SCO-1	NA	A0A1B0VBP7	Salmonella_phage	42.0	5.3e-56
WP_004197531.1|77791_78991_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_000019473.1|80009_80990_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_124045295.1|81047_81290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197540.1|81325_82603_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	44.2	6.7e-84
WP_004197551.1|82608_83037_-	peptidase S24	NA	A0A1W6JNS2	Morganella_phage	39.5	1.3e-15
WP_004197545.1|83132_83405_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085947932.1|83529_84289_+|transposase	IS5-like element ISKpn12 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	2.0e-11
WP_002063129.1|84357_84909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197549.1|85181_85367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189111.1|85983_87492_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_031944099.1|87800_88205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031944096.1|88893_89187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557452.1|89199_90060_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001235713.1|91241_91799_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_140561825.1|93832_94813_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.5	1.3e-183
>prophage 1
NZ_CP041086	Klebsiella pneumoniae strain Kp202 plasmid pKp202_4, complete sequence	61718	6380	60639	61718	integrase,transposase	Escherichia_phage(34.62%)	64	16543:16602	59389:60182
WP_000227969.1|6380_7457_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|8169_8874_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001445937.1|9450_10407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|10591_11203_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|11256_11538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|11710_12046_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_032445200.1|12596_12785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001327128.1|13268_13463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|13463_14219_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_000861580.1|15230_15422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039463.1|15430_15817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549086.1|16362_16623_+	hypothetical protein	NA	NA	NA	NA	NA
16543:16602	attL	GCAGCGTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATT	NA	NA	NA	NA
WP_001067855.1|16568_17273_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000522996.1|18483_18909_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|18936_19212_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_004200999.1|19227_19593_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|19664_20120_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001776119.1|20379_20907_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001776120.1|20939_21371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001776122.1|21850_22816_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_032419551.1|23023_23293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|23285_24770_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|24769_25021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776034.1|25178_25610_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|25609_26881_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_012600007.1|26962_27940_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|27936_29142_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|29556_29826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100115263.1|29858_30056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|30182_31049_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000764642.1|31816_32074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|32131_32908_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|32904_33648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|33698_34049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015060090.1|34192_34627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|34610_34841_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|34837_35254_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004152334.1|35327_36038_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072093211.1|36769_36895_+	mercury transporter	NA	NA	NA	NA	NA
WP_001340589.1|36930_37353_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|37404_39099_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|39116_39479_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|39475_39712_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|39708_40416_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|40454_41759_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000027057.1|42326_43187_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001217881.1|43369_43927_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000608644.1|44490_45753_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|46008_46884_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|46930_47263_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|48733_49438_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|50412_51117_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015344971.1|51356_51641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|51609_52623_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|52778_53252_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|53472_53739_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|53881_54646_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024139167.1|54687_54900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749969.1|54912_56121_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|56154_57588_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|57969_58176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549088.1|58180_58693_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001067855.1|58717_59422_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_087759376.1|59519_60639_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
59389:60182	attR	AATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAACGCTGCTGACCTGCTCCCCGTTGATTAGTACACCCCGATGTTAGTAATGTCTTCATAAGCCACATGAGGACATCCCCATGAAGAAGCGTTTTTCCGACGAACAGATCATCTGTATTCTCCGCGAAGCCGAAGCTGGGGTACCCGCCCGTGAACTCTGCCGCAAGCATGCCATTTCCGATGCCACGTTTTACACCTGGCGTAAGAAGTATGGCGGTATGGAGGTGCCTGAAGTTAAGCGCCTGAAGTCGCTTGAGGAAGAGAACGCCAGACTCAAGAAGCTGCTTGCCGAAGCCATGCTGGATAAAGAGGCGCTTCAGGTGGCTCTTGGGCGAAAGTACTGACGACAGACCAGAAGCGGGAAGCCGTGATGCTGATGTGTGATGCGACCGGTCTGTCGCAACGTCGTGCCTGCAGGCTTACAGGTTTATCCCTGTCGACCTGCCGCTATGAGGCTCACCGTCCGGCTGCTGATGCGCATTTATCAGGGCGCATCACTGAGCTGGCACTGGAGCGCAGGCGTTTTGGCTACCGTCGTATTTGGCAGTTGCTGCGCCGTGAAGGGCTTCATGTTAATCATAAGCGCGTGTACCGGCTTTATCACCTCAGTGGCCTGGGCGTAAAACGCAGAAGACGTCGTAAAGGGCTGGCAACAGAACGTCTGCCGCTGCTCCGTCCGGCGGCGCCCAATCTGACCTGGTCGATGGATTTCGTCATGGACGCACTTTCCACCGGTCGCAGGA	NA	NA	NA	NA
