The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	355064	427841	4955441	transposase,tRNA,protease,terminase,integrase,portal,holin,tail	Enterobacteria_phage(26.09%)	72	364375:364391	425166:425182
WP_020838469.1|355064_355238_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	98.2	1.7e-22
WP_020838472.1|355303_355576_-	Pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	89.8	1.2e-38
WP_139935004.1|357575_357830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001253786.1|357826_358003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139935005.1|357990_358530_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	80.4	2.1e-79
WP_139935006.1|358658_359486_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	90.9	5.6e-140
WP_001515608.1|359542_359914_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	1.1e-58
WP_139935007.1|360189_360558_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_139935008.1|360796_361429_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.6	5.4e-34
WP_139935009.1|361526_361751_+	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	54.7	2.4e-13
WP_139935010.1|361785_362352_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	60.5	1.1e-57
WP_103848493.1|362524_362704_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	71.2	6.6e-14
WP_139935011.1|362693_363575_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	87.8	2.0e-34
WP_139935012.1|363571_364891_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	52.5	3.3e-118
364375:364391	attL	CTGGGCGGCGGATTCTG	NA	NA	NA	NA
WP_000780154.1|364887_365286_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	90.2	4.7e-60
WP_139935894.1|365459_366257_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	47.2	4.2e-60
WP_069219404.1|366253_366775_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	39.7	3.3e-05
WP_071681477.1|366785_367841_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	2.6e-118
WP_139935013.1|367856_368687_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.9	2.7e-57
WP_134393419.1|368810_369347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008784467.1|369435_369822_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	92.2	1.0e-56
WP_000250463.1|369808_370090_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.0	3.1e-18
WP_139935014.1|370089_370707_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.4	2.2e-93
WP_139935015.1|370703_371243_+	DUF2514 family protein	NA	A0A0A0P0G7	Enterobacteria_phage	42.2	2.1e-07
WP_127790516.1|371458_371947_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	93.2	3.4e-76
WP_139935016.1|371946_374049_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	86.4	0.0e+00
WP_001082414.1|374045_374261_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	82.9	1.5e-25
WP_044700357.1|374257_375766_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	86.3	6.0e-257
WP_139935017.1|375710_377723_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	86.3	0.0e+00
WP_048217461.1|377814_378141_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	60.2	1.9e-30
WP_139935018.1|378133_378409_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	60.4	2.9e-24
WP_071667532.1|378421_378976_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	78.5	4.8e-63
WP_008784478.1|378972_379371_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	62.8	4.0e-43
WP_139935019.1|379378_380116_+|tail	phage tail protein	tail	O64327	Escherichia_phage	62.0	3.1e-81
WP_003826205.1|380152_380560_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	58.6	1.7e-25
WP_071596416.1|380568_380889_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	70.8	9.4e-35
WP_139935020.1|380866_383383_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	70.3	0.0e+00
WP_103014282.1|383838_384345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139935021.1|384448_384697_+	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	41.5	5.0e-12
WP_139935022.1|384756_385356_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	73.5	7.8e-75
WP_139935023.1|388715_389660_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	67.4	5.6e-120
WP_139935024.1|389670_391029_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.3	2.4e-111
WP_139935025.1|391164_391407_-	DinI-like family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_020838546.1|391485_391875_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	73.6	9.3e-53
WP_047722298.1|391906_393001_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	85.0	2.1e-179
WP_103798251.1|393088_394126_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_003031713.1|394259_394502_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_003841359.1|394803_395787_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_003826610.1|395851_397267_+	replicative DNA helicase	NA	O80281	Escherichia_phage	77.9	1.8e-199
WP_003844721.1|397283_398363_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.5	6.2e-30
WP_087879458.1|398491_399685_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_044702294.1|399933_400647_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_003031719.1|400774_401131_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_003031720.1|401246_404069_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_003826621.1|404320_404845_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	1.1e-53
WP_139935026.1|405326_407636_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_003844730.1|407719_408001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003841054.1|408554_410141_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003031731.1|410143_410467_-	superoxide response transcriptional regulator SoxS	NA	NA	NA	NA	NA
WP_003031733.1|410553_411012_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_003031735.1|411736_413086_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	8.8e-159
WP_003031737.1|413243_414890_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_003844732.1|414973_415864_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003031742.1|415965_416376_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_003031745.1|416368_417058_+	LrgB family protein	NA	NA	NA	NA	NA
WP_003031747.1|417104_418754_-	cation/acetate symporter ActP	NA	NA	NA	NA	NA
WP_003031750.1|418750_419065_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_139935027.1|419302_421261_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	1.2e-92
WP_003031758.1|423175_423742_+	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_005132585.1|423738_424410_+	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
WP_139935028.1|424406_425363_+	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
425166:425182	attR	CTGGGCGGCGGATTCTG	NA	NA	NA	NA
WP_094309343.1|426836_427841_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	515631	579818	4955441	transposase,tRNA,protease,integrase,holin	Vibrio_phage(23.08%)	55	509450:509464	526229:526243
509450:509464	attL	AGTTTTTTACTTTGA	NA	NA	NA	NA
WP_045332247.1|515631_516939_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9T1P3	Pseudomonas_phage	32.0	5.2e-23
WP_103015402.1|517024_518938_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	26.8	1.1e-16
WP_053520772.1|518987_519344_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_045332297.1|519399_520584_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	31.7	3.6e-31
WP_016245729.1|521128_523126_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	2.6e-21
WP_003036928.1|523190_524468_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_003843774.1|524743_525094_+	Morphinone reductase	NA	NA	NA	NA	NA
WP_042111466.1|525575_525989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042111470.1|526276_526843_+	hypothetical protein	NA	NA	NA	NA	NA
526229:526243	attR	AGTTTTTTACTTTGA	NA	NA	NA	NA
WP_042111475.1|527362_528241_+	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_085950818.1|528326_529446_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_052672191.1|529670_530468_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_045332109.1|530563_532192_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_045332107.1|532251_533985_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_000019450.1|535287_536268_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_045268678.1|536756_537215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003025441.1|538092_538668_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_121540680.1|538704_540414_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_003025447.1|540389_540737_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_003025449.1|540864_542166_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_003025452.1|542281_543718_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_003025457.1|544056_544533_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_003844990.1|544582_545848_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_000027827.1|546123_546417_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
WP_003025464.1|546460_548107_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.1	2.9e-188
WP_003025468.1|548241_548595_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_087879107.1|548774_549638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139935039.1|549822_550851_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_003025478.1|550892_551459_+	elongation factor P	NA	NA	NA	NA	NA
WP_003830568.1|551516_551651_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_003025482.1|551758_551905_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_003025485.1|551935_552535_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000118520.1|552790_553108_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_003025522.1|553104_553638_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	1.6e-47
WP_063859877.1|553730_554876_-	class C beta-lactamase CMY-85	NA	NA	NA	NA	NA
WP_016149439.1|555007_555883_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003025535.1|555925_556282_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_003025537.1|556292_556688_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_003025540.1|556698_557433_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_003025543.1|557425_559216_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_003830517.1|559540_560518_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	8.1e-29
WP_139935040.1|560732_562235_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_110249121.1|562371_565686_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_003844975.1|565703_566672_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_003025561.1|566764_567817_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_003839477.1|567922_568468_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	2.2e-28
WP_044699183.1|569342_570482_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_139935041.1|570480_572028_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_003025570.1|571999_572461_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_016149446.1|572477_573809_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	1.1e-17
WP_003844967.1|573818_575684_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	42.4	6.9e-61
WP_016149447.1|575676_576627_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003025584.1|576711_577020_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_003025589.1|577094_578375_+	GTPase HflX	NA	NA	NA	NA	NA
WP_003025593.1|578564_579818_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 3
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	1070413	1078042	4955441	transposase	Lactobacillus_phage(16.67%)	8	NA	NA
WP_003031421.1|1070413_1071772_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	28.6	8.9e-10
WP_139935120.1|1071843_1072599_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_049016139.1|1072632_1073355_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003838896.1|1073351_1073819_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	60.1	6.5e-53
WP_003031410.1|1073883_1074612_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.7	3.1e-41
WP_139935121.1|1074872_1075823_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	27.3	1.1e-19
WP_139935122.1|1075896_1076493_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.7	2.4e-23
WP_089617520.1|1076834_1078042_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
>prophage 4
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	2017256	2023303	4955441		uncultured_Caudovirales_phage(50.0%)	9	NA	NA
WP_003841892.1|2017256_2018507_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_139935307.1|2018642_2019152_-	DedA family protein	NA	NA	NA	NA	NA
WP_003840850.1|2019326_2019569_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_139935308.1|2019647_2019881_+	DNA polymerase V	NA	A0A222YZE2	Escherichia_phage	78.8	4.3e-21
WP_139935309.1|2019957_2020656_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.7	6.5e-89
WP_003030762.1|2020741_2021062_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_071684642.1|2021106_2022396_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.2	1.2e-165
WP_003030760.1|2022408_2022834_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
WP_075206724.1|2023090_2023303_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.6e-22
>prophage 5
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	2116780	2120578	4955441	integrase	Stx2-converting_phage(28.57%)	8	2116579:2116601	2125328:2125350
2116579:2116601	attL	TCTTTGTATGTGATCTTACGTGT	NA	NA	NA	NA
WP_139935331.1|2116780_2117989_+|integrase	tyrosine-type recombinase/integrase	integrase	I6R9B6	Salmonella_phage	76.7	1.5e-181
WP_032936075.1|2117946_2118183_-	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	53.7	3.3e-13
WP_139935332.1|2118285_2118450_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_139935333.1|2118442_2118922_-	AP2 domain-containing protein	NA	A0A2I7R856	Vibrio_phage	49.7	5.5e-39
WP_139935334.1|2118923_2119139_-	TraR/DksA family transcriptional regulator	NA	A0A0P0ZCX5	Stx2-converting_phage	62.3	1.7e-16
WP_139935335.1|2119230_2119617_-	DUF2591 family protein	NA	A0A1J0GUX1	Halomonas_phage	35.1	2.9e-06
WP_022650956.1|2119613_2119805_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	66.1	4.1e-14
WP_168199046.1|2119801_2120578_-	MmcB family DNA repair protein	NA	A9YWY3	Burkholderia_phage	39.0	4.4e-46
2125328:2125350	attR	TCTTTGTATGTGATCTTACGTGT	NA	NA	NA	NA
>prophage 6
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	2128928	2138966	4955441	tRNA	Brazilian_cedratvirus(28.57%)	10	NA	NA
WP_003832580.1|2128928_2129912_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_003030574.1|2129927_2132315_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003030571.1|2132319_2132619_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003832584.1|2132772_2133753_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_137348238.1|2133813_2134365_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003030567.1|2134364_2135114_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003836644.1|2135191_2135656_+	lipoprotein nlpC	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_003836643.1|2135972_2136686_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_016150131.1|2136747_2138190_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
WP_058842631.1|2138186_2138966_-	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.4	5.1e-10
>prophage 7
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	2806117	2881957	4955441	transposase,protease,capsid,portal,tRNA,tail,head	Shigella_phage(29.55%)	84	NA	NA
WP_089617520.1|2806117_2807324_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_003844127.1|2807395_2808433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041162689.1|2808638_2809073_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	8.8e-20
WP_003034964.1|2809130_2810012_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_049002329.1|2810204_2812253_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.6e-87
WP_003034957.1|2812272_2812959_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_003034953.1|2813055_2813553_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_139935480.1|2813681_2814965_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_016150396.1|2814933_2817567_+	PqiB family protein	NA	NA	NA	NA	NA
WP_139935481.1|2817646_2819068_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_029139506.1|2819168_2819405_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_003034941.1|2819507_2819699_+	YebW family protein	NA	NA	NA	NA	NA
WP_003034937.1|2819699_2820341_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	8.7e-56
WP_003034934.1|2820753_2821092_-	YebY family protein	NA	NA	NA	NA	NA
WP_003844135.1|2821112_2821985_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003844136.1|2821988_2822363_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003844137.1|2822621_2822831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164562674.1|2822994_2823576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322661.1|2824068_2824260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003844140.1|2824579_2825482_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.0	5.5e-16
WP_071684716.1|2825835_2826414_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	37.2	4.2e-17
WP_071684717.1|2826727_2827420_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_019076528.1|2827864_2829616_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	33.3	7.2e-44
WP_003034925.1|2829764_2829995_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_003841657.1|2830101_2830758_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003844144.1|2830781_2831444_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	39.3	2.0e-07
WP_032939143.1|2831446_2833525_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	36.3	8.3e-31
WP_003844146.1|2833587_2834247_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_003034909.1|2834341_2834695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003034906.1|2834816_2835107_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_003844149.1|2835238_2836417_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_003034901.1|2836484_2837126_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003841668.1|2837160_2838972_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003034896.1|2839205_2840681_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
WP_003034893.1|2841048_2841918_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003034890.1|2842036_2843479_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_003841672.1|2843523_2844495_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_003034883.1|2844614_2845934_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_049002353.1|2845949_2846894_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003034877.1|2846972_2847728_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	6.5e-18
WP_003034874.1|2847724_2848510_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003034872.1|2848588_2849599_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_003034869.1|2849607_2850219_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034867.1|2850299_2850821_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003034865.1|2850855_2851599_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003844155.1|2851627_2852071_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_049002340.1|2852072_2853845_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003841685.1|2854111_2854678_+	hydrolase	NA	NA	NA	NA	NA
WP_139935482.1|2855031_2855271_+	DinI-like family protein	NA	K7PKR6	Enterobacteria_phage	98.7	9.7e-37
WP_139935483.1|2855356_2855767_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_000506745.1|2855958_2856291_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.1	5.2e-20
WP_000661045.1|2857880_2858150_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	80.9	4.9e-37
WP_049015471.1|2858149_2858506_-|tail	tail protein	tail	U5P076	Shigella_phage	89.8	8.8e-58
WP_139935484.1|2858505_2859999_-|tail	phage tail protein	tail	Q8SBH2	Shigella_phage	73.7	8.7e-208
WP_046671236.1|2859995_2860178_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	61.8	3.7e-12
WP_139935485.1|2860185_2860746_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	76.9	5.2e-81
WP_109862846.1|2860745_2861249_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	89.2	6.1e-81
WP_139935486.1|2861223_2861637_-|head	phage head closure protein	head	U5P0R0	Shigella_phage	69.3	1.9e-48
WP_139935487.1|2861633_2861957_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	63.6	6.1e-34
WP_139935488.1|2862030_2863248_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	73.8	1.0e-166
WP_045888755.1|2863257_2863857_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	80.0	4.3e-89
WP_168199050.1|2863849_2865259_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	88.4	9.7e-201
WP_048221270.1|2866077_2866944_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	87.8	1.9e-34
WP_003034732.1|2866933_2867113_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	3.0e-14
WP_053390030.1|2867285_2867837_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	53.5	1.2e-45
WP_115601843.1|2867865_2868063_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	73.8	2.6e-19
WP_115602402.1|2868162_2868819_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	66.5	1.8e-85
WP_096757391.1|2869153_2869345_-	hypothetical protein	NA	S5FM78	Shigella_phage	92.1	8.9e-25
WP_085049599.1|2869657_2870575_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.7	2.0e-106
WP_046669975.1|2870960_2871500_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	80.4	9.5e-80
WP_001253787.1|2871487_2871664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139935489.1|2871660_2871915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139935490.1|2872358_2872652_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	88.7	2.7e-44
WP_139935491.1|2872648_2873257_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	70.6	3.8e-29
WP_139935492.1|2873258_2873828_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.8	9.6e-91
WP_003839185.1|2873868_2874105_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	89.7	4.6e-39
WP_139935493.1|2874163_2875477_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	90.1	3.9e-236
WP_168199061.1|2875455_2876229_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	78.0	1.8e-55
WP_003034689.1|2876281_2876677_+	membrane protein	NA	NA	NA	NA	NA
WP_003034686.1|2876717_2877461_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
WP_003839177.1|2877457_2878426_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_016150525.1|2878669_2879416_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_071684724.1|2879418_2879985_-	VOC family protein	NA	NA	NA	NA	NA
WP_003034673.1|2880223_2881957_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.7e-85
>prophage 8
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	3089367	3098945	4955441	tRNA,protease	Bacillus_phage(28.57%)	8	NA	NA
WP_003844344.1|3089367_3090771_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
WP_003036797.1|3090767_3091490_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003841759.1|3091625_3091958_+	YegP family protein	NA	NA	NA	NA	NA
WP_003844346.1|3092117_3093479_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	4.1e-204
WP_003036804.1|3093748_3096025_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003036810.1|3096055_3096376_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036813.1|3096699_3096924_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003840216.1|3096998_3098945_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
>prophage 9
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	3148273	3156691	4955441	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_003027344.1|3148273_3150307_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
WP_003840158.1|3150512_3150971_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.1e-50
WP_003027346.1|3151013_3151484_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_003840155.1|3151530_3152250_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027348.1|3152246_3153932_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_049002964.1|3154157_3154889_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
WP_003027354.1|3154940_3155048_+	protein YohO	NA	NA	NA	NA	NA
WP_086539162.1|3155028_3155760_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032949638.1|3155743_3156691_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	5.4e-22
>prophage 10
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	3375149	3401923	4955441	tail,integrase	Enterobacteria_phage(53.33%)	40	3370521:3370535	3379509:3379523
3370521:3370535	attL	CTCTGCTTTCAGGGT	NA	NA	NA	NA
WP_003839292.1|3375149_3376091_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	89.3	7.5e-149
WP_139935608.1|3376401_3377559_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZ40	Salmonella_phage	82.3	2.8e-190
WP_139935609.1|3378361_3378775_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	48.9	2.7e-26
WP_139935610.1|3379604_3380339_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	83.6	5.6e-59
3379509:3379523	attR	ACCCTGAAAGCAGAG	NA	NA	NA	NA
WP_116291301.1|3380335_3380452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139935611.1|3380448_3380808_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	95.8	2.4e-63
WP_139935612.1|3380804_3381095_-	DUF1364 family protein	NA	K7PGZ6	Enterobacteria_phage	90.5	4.1e-45
WP_054626103.1|3381087_3381258_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	60.0	2.9e-11
WP_032180568.1|3381257_3381695_-	recombination protein NinB	NA	G8C7V3	Escherichia_phage	77.9	2.6e-59
WP_139935613.1|3383088_3383307_-	DUF4014 family protein	NA	Q5G8V0	Enterobacteria_phage	91.7	5.0e-32
WP_139935614.1|3383311_3383878_-	hypothetical protein	NA	K7P858	Enterobacteria_phage	56.4	3.5e-16
WP_139935616.1|3384215_3384620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139935617.1|3384621_3385245_-	phage replication protein	NA	K7PM39	Enterobacteria_phage	84.8	1.4e-95
WP_139935618.1|3385371_3386085_+	helix-turn-helix domain-containing protein	NA	M1FN96	Enterobacteria_phage	75.9	4.1e-99
WP_106931048.1|3386140_3386395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106931050.1|3386391_3386904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139935619.1|3387057_3387282_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	2.1e-17
WP_139935620.1|3387617_3387983_+	antitermination protein	NA	C6ZR44	Salmonella_phage	68.6	5.5e-39
WP_139935621.1|3387985_3388723_+	keratin	NA	A0A088CC14	Shigella_phage	53.5	8.4e-63
WP_139935622.1|3388763_3389027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139815595.1|3389070_3389301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003833690.1|3389442_3389601_+	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	75.0	5.3e-15
WP_003833696.1|3389597_3389804_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	84.4	3.9e-26
WP_139935623.1|3389813_3390650_+	hypothetical protein	NA	M9NYX5	Enterobacteria_phage	92.1	2.5e-143
WP_139935624.1|3390744_3391713_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	70.0	6.3e-34
WP_139935625.1|3391720_3392005_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	91.5	1.6e-46
WP_139935626.1|3392023_3392869_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.2	2.8e-70
WP_139935627.1|3392865_3393546_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	97.8	4.3e-130
WP_071701032.1|3394098_3394371_+	DUF5405 family protein	NA	K7P7M4	Enterobacteria_phage	61.2	1.1e-20
WP_139935628.1|3394367_3394589_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	53.7	1.4e-13
WP_139935629.1|3394588_3394951_+	hypothetical protein	NA	G8C7S4	Escherichia_phage	92.0	3.7e-56
WP_139935630.1|3394913_3395153_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	46.2	7.8e-10
WP_139935631.1|3395162_3395780_+	DUF5420 family protein	NA	A0A075B8I7	Enterobacteria_phage	77.1	1.2e-89
WP_023294204.1|3395919_3396120_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	84.8	5.3e-28
WP_003839291.1|3396231_3396861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139935632.1|3397035_3398934_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	6.4e-14
WP_139935633.1|3399452_3399707_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_003845054.1|3399830_3400424_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_139935634.1|3400954_3401485_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_139935635.1|3401533_3401923_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	44.1	5.7e-18
>prophage 11
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	3518413	3533256	4955441	holin	Salmonella_phage(75.0%)	13	NA	NA
WP_139935653.1|3518413_3518617_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	69.8	7.3e-17
WP_003838477.1|3518981_3519860_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_139935654.1|3520082_3520565_-	DUF2514 family protein	NA	Q858E9	Salmonella_phage	91.2	6.1e-70
WP_139935655.1|3520561_3521188_-	glycoside hydrolase family 19 protein	NA	T1SBJ3	Salmonella_phage	94.2	7.5e-113
WP_139935656.1|3521177_3521486_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	98.0	3.2e-48
WP_001275998.1|3521472_3521877_-	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_139935657.1|3522049_3523075_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	28.3	3.1e-23
WP_003847193.1|3525451_3525712_+	hypothetical protein	NA	T1SA06	Salmonella_phage	100.0	7.6e-43
WP_045719437.1|3525761_3525902_-	hypothetical protein	NA	T1SA77	Salmonella_phage	93.5	1.1e-13
WP_139935658.1|3525912_3528387_-	hypothetical protein	NA	T1S9I6	Salmonella_phage	98.3	0.0e+00
WP_139935659.1|3528391_3530194_-	hypothetical protein	NA	T1SAQ5	Salmonella_phage	92.2	1.1e-289
WP_139935660.1|3530190_3532701_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	82.7	0.0e+00
WP_139935661.1|3532713_3533256_-	hypothetical protein	NA	T1SA02	Salmonella_phage	98.9	1.4e-70
>prophage 12
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	3537157	3554193	4955441	terminase,integrase	Salmonella_phage(56.52%)	26	3542149:3542163	3567600:3567614
WP_052922682.1|3537157_3537751_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	98.5	5.7e-102
WP_139935663.1|3537854_3538193_-	hypothetical protein	NA	Q858C6	Salmonella_phage	91.1	7.5e-51
WP_139935664.1|3538463_3538706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139935665.1|3538702_3539470_-	DUF551 domain-containing protein	NA	A0A192Y7X3	Salmonella_phage	54.1	5.0e-18
WP_125112488.1|3539480_3539756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139935666.1|3539757_3540315_-	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	32.1	2.6e-08
WP_139935667.1|3540311_3540566_-	hypothetical protein	NA	A2I2Z5	Vibrio_virus	40.7	2.2e-10
WP_168199040.1|3540562_3540958_-	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	32.8	1.2e-07
WP_139935669.1|3541459_3542512_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	72.6	5.8e-158
3542149:3542163	attL	CAACCTGTTCGCCAA	NA	NA	NA	NA
WP_139935670.1|3542856_3543090_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	96.1	5.0e-38
WP_139935671.1|3543245_3543842_+	helix-turn-helix domain-containing protein	NA	Q858D7	Salmonella_phage	98.0	3.2e-105
WP_001198622.1|3544066_3544216_+	hypothetical protein	NA	T1SA20	Salmonella_phage	70.2	1.1e-14
WP_139935672.1|3544212_3545205_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	75.4	4.3e-54
WP_052930710.1|3545212_3545515_+	hypothetical protein	NA	T1SA88	Salmonella_phage	97.0	3.8e-46
WP_139935673.1|3545511_3546333_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	96.7	2.7e-158
WP_109174198.1|3546329_3547211_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	94.9	3.9e-155
WP_000816432.1|3547257_3547506_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	81.7	1.5e-32
WP_000041117.1|3547615_3547915_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	99.0	4.0e-48
WP_139935674.1|3547907_3548066_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	82.7	1.1e-17
WP_139935675.1|3548062_3548635_+	morphogenetic protein	NA	Q71T76	Escherichia_phage	47.4	3.6e-45
WP_139935676.1|3548631_3548823_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	76.3	6.8e-17
WP_139935677.1|3548819_3549467_+	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	95.3	8.3e-123
WP_168199052.1|3549463_3549631_+	hypothetical protein	NA	T1SA82	Salmonella_phage	98.2	8.0e-22
WP_139935678.1|3549639_3550893_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	96.4	9.5e-232
WP_003037760.1|3551085_3552663_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_003037756.1|3552726_3554193_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	5.7e-87
3567600:3567614	attR	TTGGCGAACAGGTTG	NA	NA	NA	NA
>prophage 13
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	3712403	3719894	4955441	integrase	Escherichia_phage(33.33%)	7	3697674:3697687	3721877:3721890
3697674:3697687	attL	AACATCAGCGGCAG	NA	NA	NA	NA
WP_139935915.1|3712403_3712613_-	hypothetical protein	NA	G8C7R9	Escherichia_phage	68.1	3.5e-22
WP_139935694.1|3712682_3712976_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	89.6	7.7e-44
WP_139935695.1|3713822_3714392_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.3	2.1e-90
WP_139935696.1|3714597_3715770_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	66.2	9.7e-146
WP_139935697.1|3715814_3716615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023337654.1|3716825_3718055_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	85.8	6.7e-206
WP_047743978.1|3718337_3719894_+	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	3.2e-19
3721877:3721890	attR	AACATCAGCGGCAG	NA	NA	NA	NA
>prophage 14
NZ_CP041051	Citrobacter sp. CF971 chromosome, complete genome	4955441	4382332	4389983	4955441		Pseudoalteromonas_phage(16.67%)	10	NA	NA
WP_139935814.1|4382332_4383310_+	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	23.0	8.1e-05
WP_003025063.1|4383323_4384310_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_003025065.1|4384330_4384897_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	4.2e-54
WP_003025068.1|4384893_4385469_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003025070.1|4385437_4385986_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_003025073.1|4385992_4386718_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_003025074.1|4386764_4388198_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003025078.1|4388220_4388508_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_003025083.1|4388591_4389083_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025085.1|4389128_4389983_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
>prophage 1
NZ_CP041047	Citrobacter sp. CF971 plasmid pBM527-1, complete sequence	301036	2884	52005	301036	transposase,holin,integrase	Escherichia_phage(50.0%)	52	1731:1744	17999:18012
1731:1744	attL	TCCGGCAACGATCA	NA	NA	NA	NA
WP_032425611.1|2884_3916_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_039265231.1|5994_6525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048213827.1|6859_7639_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	1.7e-50
WP_048213826.1|7635_8202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048213825.1|8264_8624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168199034.1|8762_9224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|9180_9411_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|9407_9824_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001348075.1|9897_10134_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_059331711.1|10180_10885_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_139934917.1|10830_11646_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033488203.1|11635_13297_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_021242984.1|13280_13841_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	41.8	1.9e-30
WP_089617520.1|14132_15339_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_001567386.1|15530_16007_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001567387.1|16099_16366_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001567388.1|16506_17127_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001567390.1|17587_18457_-	DMT family transporter	NA	NA	NA	NA	NA
17999:18012	attR	TCCGGCAACGATCA	NA	NA	NA	NA
WP_004729622.1|18697_19450_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_135716487.1|19889_20894_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_094309343.1|23021_24026_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001567377.1|24746_25241_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001567378.1|25230_25692_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_021243014.1|25715_25853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567380.1|25926_26433_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_001567381.1|26463_26724_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001567382.1|26936_27494_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001567383.1|27590_27857_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|28230_29235_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|30951_31656_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012695450.1|33324_33909_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.1	2.0e-22
WP_000108589.1|34093_34651_+	OsmC family protein	NA	NA	NA	NA	NA
WP_020277920.1|34792_35374_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020277919.1|35378_35717_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002431133.1|35746_36076_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
WP_006687059.1|36289_37396_+	alkene reductase	NA	NA	NA	NA	NA
WP_020277918.1|37461_38163_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_020277917.1|38228_39002_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001067855.1|39099_39804_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001097412.1|41205_41769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348195.1|41792_42167_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001515734.1|42231_42795_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000046891.1|43037_43373_+	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
WP_000624775.1|43988_44222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139934918.1|44246_44951_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.0e-135
WP_001067855.1|44987_45692_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001752509.1|46018_46519_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000019445.1|46835_47816_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000780222.1|48093_48375_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|48355_48685_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000625672.1|50097_51375_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_168199035.1|51438_52005_-|holin	choline transporter	holin	NA	NA	NA	NA
>prophage 2
NZ_CP041047	Citrobacter sp. CF971 plasmid pBM527-1, complete sequence	301036	118667	163100	301036	transposase,integrase	Escherichia_phage(28.57%)	38	123794:123808	137516:137530
WP_000019445.1|118667_119648_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_077260398.1|119646_120354_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046499110.1|120380_120767_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_046499539.1|120780_121743_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	41.1	9.6e-59
WP_139212154.1|122533_123853_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
123794:123808	attL	TTATTACAACATGAT	NA	NA	NA	NA
WP_071199356.1|123842_125393_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_071199357.1|125389_127753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008786699.1|128426_130154_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_008786698.1|130150_131566_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_032941625.1|131696_132326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020996176.1|132989_133883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008786695.1|134550_134808_-	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_008786694.1|134880_136077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020996177.1|136460_137240_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_008786692.1|137578_137968_-	hypothetical protein	NA	NA	NA	NA	NA
137516:137530	attR	TTATTACAACATGAT	NA	NA	NA	NA
WP_008786691.1|137964_139338_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	33.6	2.0e-41
WP_008786690.1|139694_140273_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_008786689.1|140607_141570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008786688.1|141573_142002_+	universal stress protein	NA	NA	NA	NA	NA
WP_008786687.1|142017_143304_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	54.3	1.0e-124
WP_159060712.1|143379_143517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020996179.1|143622_144309_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_008786685.1|144343_144718_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	62.0	9.6e-31
WP_008786684.1|144828_147165_+	HAD-IC family P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	24.0	7.6e-33
WP_008786683.1|147229_148750_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	26.4	6.7e-06
WP_059331711.1|149134_149839_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_139934922.1|150153_151845_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.9	6.7e-39
WP_032309857.1|151957_152077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|152412_153117_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001000602.1|153309_154461_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.7	6.7e-99
WP_007372347.1|155915_157529_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	37.0	2.2e-07
WP_016241542.1|158108_158375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372345.1|158586_158805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372343.1|159087_159411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372342.1|159446_160370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372341.1|160550_160778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048213831.1|161130_161928_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.7	1.5e-137
WP_048213832.1|161927_163100_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	94.6	1.3e-219
>prophage 1
NZ_CP041048	Citrobacter sp. CF971 plasmid pBM527-2, complete sequence	151402	85116	116454	151402	integrase,transposase	Salmonella_phage(38.46%)	30	82997:83012	119340:119355
82997:83012	attL	GCTCTTGTTTTTTGGC	NA	NA	NA	NA
WP_000608644.1|85116_86379_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_011091028.1|86713_87589_+	class A extended-spectrum beta-lactamase CTX-M-3	NA	A0A1B0VBP7	Salmonella_phage	82.1	5.4e-125
WP_013023839.1|87635_88112_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_000027057.1|88370_89231_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|89413_89971_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|90134_93140_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_000575656.1|93440_93722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132404.1|93740_94304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039272368.1|94306_95311_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	35.5	1.3e-42
WP_039272366.1|95675_95927_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024134513.1|95936_97244_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_039272364.1|97240_97735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044596315.1|97909_98848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031611419.1|99046_100687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031611417.1|101058_101361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138014.1|102488_105455_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|105458_106019_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323888.1|106007_106175_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_000454193.1|106194_106545_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|106747_107761_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_013263789.1|107927_108728_+	subclass B1 metallo-beta-lactamase VIM-1	NA	NA	NA	NA	NA
WP_003159191.1|108835_109390_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_019407932.1|109460_110255_+	aminoglycoside O-phosphotransferase APH(3')-XV	NA	Q75ZG1	Hepacivirus	39.4	1.3e-40
WP_001206317.1|110371_111163_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_012477387.1|111215_111848_+	type B-2 chloramphenicol O-acetyltransferase CatB2	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	44.4	4.1e-26
WP_000679427.1|112016_112364_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|112357_113197_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|113324_113825_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011899345.1|113881_114781_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_139934932.1|114783_116454_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
119340:119355	attR	GCCAAAAAACAAGAGC	NA	NA	NA	NA
>prophage 2
NZ_CP041048	Citrobacter sp. CF971 plasmid pBM527-2, complete sequence	151402	123309	131086	151402	transposase	Escherichia_phage(57.14%)	8	NA	NA
WP_001067855.1|123309_124014_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|124150_125011_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|125031_125793_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001067855.1|126633_127338_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549892.1|127730_127970_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_000343760.1|128071_129292_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001549893.1|129380_130043_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|130423_131086_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 1
NZ_CP041050	Citrobacter sp. CF971 plasmid pBM527-4, complete sequence	85170	31695	78001	85170	transposase,integrase	Escherichia_phage(50.0%)	46	24371:24386	81156:81171
24371:24386	attL	ATGACTTTGTCATGCA	NA	NA	NA	NA
WP_135716487.1|31695_32700_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_008322801.1|33011_33203_+	DUF2767 family protein	NA	NA	NA	NA	NA
WP_042201113.1|33225_33993_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_042201111.1|34311_35316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322807.1|35312_35576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053065240.1|35991_36666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042201108.1|36928_38062_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_042201107.1|38220_38961_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_042201105.1|38996_39785_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_042201102.1|39781_40402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042201100.1|40398_41010_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_048213817.1|44479_45979_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.7	8.0e-44
WP_048213818.1|46771_47041_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048213819.1|47044_47575_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048213820.1|47659_48664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048213821.1|48668_48914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048213854.1|49672_50695_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_048213822.1|51049_51583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048213823.1|52245_54456_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001568025.1|55145_55364_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_139934942.1|55365_55671_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_017899885.1|55839_56235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389906.1|56261_56576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017899884.1|56586_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197635.1|57800_58595_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_077253981.1|59034_59214_-	Par-like protein	NA	NA	NA	NA	NA
WP_004197649.1|59333_59960_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_001067855.1|60495_61200_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_106931107.1|61233_61503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032640602.1|61594_62563_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_004099038.1|62559_63264_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004099036.1|63396_63936_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_004099035.1|63937_64381_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_032425611.1|64505_65537_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_018716209.1|65682_66642_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004357650.1|66786_68019_+	OsmC family protein	NA	NA	NA	NA	NA
WP_025760400.1|68021_68615_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_004357654.1|68614_69640_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_026227539.1|70036_70612_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004357657.1|70847_71030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004099027.1|71088_71577_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_004099026.1|71847_72234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004099025.1|72272_73232_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_004357616.1|73258_73792_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|74000_74705_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_139934944.1|74992_78001_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.0	0.0e+00
81156:81171	attR	ATGACTTTGTCATGCA	NA	NA	NA	NA
