The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041036	Shewanella polaris strain SM1901 chromosome, complete genome	4648537	664086	734706	4648537	protease,integrase,tRNA,transposase	Tupanvirus(12.5%)	57	710240:710299	718699:718787
WP_140233277.1|664086_665589_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.1	1.3e-86
WP_140233278.1|665724_667434_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_137223067.1|667470_667935_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_137223065.1|667980_668262_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_140235503.1|668467_669406_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_140233279.1|669718_670750_+	dihydroorotase	NA	NA	NA	NA	NA
WP_140233280.1|670926_674361_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_140233281.1|675165_676614_-	DUF4892 domain-containing protein	NA	NA	NA	NA	NA
WP_140233282.1|676890_677571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140233283.1|677656_678160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140233284.1|678318_679557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140233285.1|679655_680261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140233286.1|680463_682308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140233287.1|682459_683092_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_140233288.1|683419_684301_-	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_140235504.1|684431_685280_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_140233289.1|685557_688605_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_140233290.1|688719_689160_-	DUF3429 family protein	NA	NA	NA	NA	NA
WP_140233291.1|689288_689774_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_140233292.1|689779_689962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140233293.1|690242_691499_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.1	4.8e-42
WP_140233294.1|691704_693771_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_137223045.1|694185_694572_+	VOC family protein	NA	NA	NA	NA	NA
WP_140233295.1|694753_697075_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_140233296.1|697089_697770_+	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	32.5	1.1e-16
WP_140233297.1|697989_698931_-	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_140233298.1|698927_699614_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_137223035.1|699620_700082_-	nitrite reductase	NA	NA	NA	NA	NA
WP_137223033.1|700156_700621_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_140233299.1|701108_702071_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_140233300.1|703222_704020_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_140233301.1|704016_704319_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_137223025.1|704417_705857_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_137223023.1|705883_706543_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_137223021.1|706550_707081_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.0	3.7e-12
WP_137223019.1|707147_708083_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	2.8e-23
WP_137223017.1|708082_708853_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_140235505.1|708967_709927_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	38.1	2.8e-50
710240:710299	attL	GTTGAACTAAGCCGCTGCGCGGAGCCCAAAAGCCCGTCATTTGCACCACACTTACCTCAG	NA	NA	NA	NA
WP_140233302.1|710329_711166_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	23.5	3.2e-10
WP_140233303.1|711170_712280_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_140233304.1|712623_713061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140233305.1|713567_714611_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_119969152.1|714811_714991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167495973.1|715125_715686_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_167495974.1|717474_718611_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_140233308.1|719157_720135_+|transposase	transposase	transposase	NA	NA	NA	NA
718699:718787	attR	GTTGAACTAAGCCGCTGCGCGGAGCCCAAAAGCCCGTCATTTGCACCACACTTACCTCAGTGGATTTTCCCACTATCAAGGAGGTAAGT	NA	NA	NA	NA
WP_140233309.1|720565_721600_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_137222993.1|721948_722983_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_137222991.1|722979_723831_-	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_137222989.1|723857_725096_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.2	1.5e-27
WP_140235506.1|726181_728215_-	cytochrome C	NA	NA	NA	NA	NA
WP_140233310.1|728870_729890_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_140233311.1|730427_731033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140233313.1|731655_732096_+	DUF2202 domain-containing protein	NA	NA	NA	NA	NA
WP_140233315.1|732105_732840_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_140233316.1|732978_733470_-	DUF1097 family protein	NA	NA	NA	NA	NA
WP_140233317.1|734004_734706_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP041036	Shewanella polaris strain SM1901 chromosome, complete genome	4648537	1755616	1765480	4648537		Faustovirus(14.29%)	9	NA	NA
WP_137221298.1|1755616_1756831_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.8	2.8e-31
WP_137221296.1|1756903_1757287_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	5.4e-53
WP_137221294.1|1757301_1757625_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	41.1	3.5e-21
WP_140233917.1|1757680_1758205_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_140233918.1|1758273_1760133_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.9	3.7e-99
WP_137221288.1|1760141_1760477_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_137221286.1|1760647_1761544_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	36.2	5.7e-37
WP_137221284.1|1761718_1762150_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	4.8e-18
WP_140233919.1|1762960_1765480_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	25.0	1.1e-32
>prophage 3
NZ_CP041036	Shewanella polaris strain SM1901 chromosome, complete genome	4648537	2013877	2023000	4648537	tRNA	uncultured_Caudovirales_phage(50.0%)	10	NA	NA
WP_140234051.1|2013877_2016487_+	DUF87 domain-containing protein	NA	S5VNE3	Mycobacterium_phage	47.5	8.9e-83
WP_140235554.1|2016495_2017140_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_140234052.1|2017148_2018480_+	AAA family ATPase	NA	G3MBE0	Bacillus_virus	38.7	1.0e-79
WP_137220902.1|2018472_2018847_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	37.6	3.1e-05
WP_140234053.1|2018865_2020152_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.9	5.5e-94
WP_140234054.1|2020872_2021211_-	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_140234055.1|2021204_2021513_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_140234056.1|2021509_2021866_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_140234057.1|2021885_2022275_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.6	8.8e-19
WP_140234058.1|2022340_2023000_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	45.4	2.1e-36
>prophage 4
NZ_CP041036	Shewanella polaris strain SM1901 chromosome, complete genome	4648537	3431794	3439287	4648537		Staphylococcus_phage(50.0%)	7	NA	NA
WP_137226333.1|3431794_3432271_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.0	3.6e-30
WP_140234850.1|3432394_3433498_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	38.4	5.7e-63
WP_140234851.1|3433598_3434258_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	32.0	3.7e-25
WP_140234852.1|3434322_3435468_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	1.1e-48
WP_137226325.1|3435545_3435995_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_140234853.1|3436104_3437358_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.6	7.8e-101
WP_140234854.1|3437619_3439287_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.7	2.3e-39
>prophage 5
NZ_CP041036	Shewanella polaris strain SM1901 chromosome, complete genome	4648537	3746354	3792746	4648537	integrase,portal,coat,protease,terminase	Vibrio_phage(33.33%)	43	3745252:3745265	3794885:3794898
3745252:3745265	attL	TTTGTATGGGTTTA	NA	NA	NA	NA
WP_140235008.1|3746354_3747863_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_140235009.1|3748342_3750823_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_140235010.1|3750937_3753124_-	OsmC domain/YcaO domain-containing protein	NA	NA	NA	NA	NA
WP_137225806.1|3753602_3754619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137225804.1|3755226_3755454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137225803.1|3755782_3755995_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	67.6	9.6e-20
WP_140235011.1|3756302_3756689_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_140235012.1|3756685_3757474_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_140235013.1|3758089_3758302_-	hypothetical protein	NA	A0A088C533	Shewanella_sp._phage	61.4	3.5e-14
WP_140235014.1|3758335_3760114_-	hypothetical protein	NA	A0A2I7QS09	Vibrio_phage	44.8	9.2e-148
WP_140235015.1|3760113_3760416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235016.1|3760408_3761332_-	hypothetical protein	NA	A0A2I7S8P4	Vibrio_phage	32.7	4.8e-39
WP_140235017.1|3761362_3763801_-	hypothetical protein	NA	A0A2I7QRV0	Vibrio_phage	62.0	1.3e-288
WP_140235018.1|3763835_3764213_-	hypothetical protein	NA	A0A088C532	Shewanella_sp._phage	46.7	2.0e-20
WP_140235019.1|3767881_3768250_+	QacE	NA	NA	NA	NA	NA
WP_140235020.1|3768359_3769079_-	hypothetical protein	NA	A0A2I7S8N4	Vibrio_phage	35.5	3.3e-27
WP_140235021.1|3769075_3769501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235022.1|3769525_3770077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235023.1|3770085_3770412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235024.1|3770404_3770725_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	47.7	1.6e-13
WP_140235631.1|3770838_3772866_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	52.1	1.1e-176
WP_140235025.1|3772831_3774391_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	49.1	2.9e-129
WP_140235026.1|3774399_3774603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235027.1|3774602_3776585_-|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	49.2	2.5e-194
WP_140235028.1|3776559_3777093_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	50.0	9.8e-37
WP_140235029.1|3777096_3777420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235030.1|3777518_3777956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235031.1|3777955_3778423_-	glycoside hydrolase family protein	NA	A0A1B1ITF9	uncultured_Mediterranean_phage	53.6	2.7e-38
WP_140235032.1|3778863_3780174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235033.1|3780446_3781184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235034.1|3781445_3782468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235035.1|3783125_3783710_+	Rha family transcriptional regulator	NA	A0A1C9IHV9	Salmonella_phage	48.1	1.7e-18
WP_140235036.1|3783888_3784515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235037.1|3784630_3785254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235038.1|3785566_3786862_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_140235039.1|3786954_3787659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235040.1|3788097_3788601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167496043.1|3788698_3789166_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_140235042.1|3789858_3790362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235043.1|3790577_3790775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235044.1|3790861_3791227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140235632.1|3791213_3791432_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_140235045.1|3791486_3792746_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A067ZJC5	Vibrio_phage	34.0	7.4e-51
3794885:3794898	attR	TAAACCCATACAAA	NA	NA	NA	NA
