The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041026	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 chromosome, complete genome	4968488	364189	405499	4968488	portal,protease,lysis,coat	Salmonella_phage(50.94%)	55	NA	NA
WP_001043675.1|364189_365242_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|365524_366628_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|366639_367890_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_023972680.1|369694_370090_-	hypothetical protein	NA	C6ZR27	Salmonella_phage	54.4	7.0e-24
WP_023972681.1|370093_370567_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	2.5e-68
WP_022630918.1|370566_371016_-	ead/Ea22-like family protein	NA	Q716F4	Shigella_phage	85.3	2.7e-48
WP_022630919.1|371017_371317_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	96.0	3.1e-56
WP_022630920.1|371313_371712_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	72.0	3.5e-31
WP_023167639.1|371708_371873_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	5.5e-23
WP_022630922.1|371883_372177_-	DUF2856 family protein	NA	Q5G8U3	Enterobacteria_phage	87.6	3.8e-43
WP_001253478.1|372223_372508_-	Anti-RecBCD protein 1	NA	E7C9P9	Salmonella_phage	97.9	1.5e-44
WP_023167638.1|372507_373215_-	hypothetical protein	NA	I6R0N0	Salmonella_phage	99.1	2.2e-137
WP_000156731.1|373344_373533_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_023167636.1|373513_373687_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	94.2	2.4e-21
WP_078341693.1|374021_374756_-	pentapeptide repeat-containing protein	NA	I6S1T3	Salmonella_phage	91.5	2.0e-32
WP_001066179.1|375005_375593_+	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000216178.1|375605_375908_-	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_000834175.1|376271_376475_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000712403.1|377756_378446_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000182204.1|378556_378772_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|378882_379164_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000539342.1|379346_380168_+	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_001248410.1|380164_381541_+	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_001036030.1|381537_381807_+	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_041111780.1|381880_382318_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	99.3	6.5e-79
WP_000679702.1|382314_382488_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|382454_382631_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|382633_382966_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|382958_383135_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|383127_383739_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|383735_383960_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149926.1|383956_384160_+	protein ninH	NA	Q5G8R8	Enterobacteria_phage	100.0	7.2e-33
WP_023167457.1|384140_384320_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	98.3	1.6e-23
WP_000027545.1|384316_384805_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
WP_022630928.1|385074_385593_+	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	66.9	6.3e-57
WP_011233123.1|386580_387030_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001028469.1|387242_387764_+	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_000808100.1|388087_388330_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_012532521.1|388332_388737_+	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
WP_000729925.1|388740_389229_+	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_023170969.1|390701_392879_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.4	0.0e+00
WP_023167453.1|392892_393804_+	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	1.1e-160
WP_023167452.1|393803_395096_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	98.8	2.3e-241
WP_023167451.1|395136_395697_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	1.6e-101
WP_001166098.1|395680_396181_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|396140_397559_+	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_023167450.1|397562_398264_+	hypothetical protein	NA	C6ZR14	Salmonella_phage	97.9	2.8e-76
WP_000627703.1|398263_398719_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_023167449.1|398721_399411_+	hypothetical protein	NA	A0A1R3Y5P8	Salmonella_virus	98.3	1.4e-88
WP_071790660.1|399453_400791_+	DNA transfer protein	NA	A0A1R3Y5Q4	Salmonella_virus	97.3	1.8e-236
WP_077909811.1|400787_402608_+	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	93.3	4.1e-276
WP_023167446.1|402625_402955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023972977.1|403015_403657_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_031306893.1|404003_404642_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	84.0	5.3e-98
WP_031306894.1|404725_405499_+	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	66.1	8.0e-80
>prophage 2
NZ_CP041026	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 chromosome, complete genome	4968488	1017412	1026144	4968488	transposase,protease	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|1017412_1018531_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1018527_1020474_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1020603_1020825_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1021148_1021469_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1021499_1023776_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1023967_1024426_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_119920232.1|1024598_1024874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085983316.1|1024888_1026144_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP041026	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 chromosome, complete genome	4968488	1076237	1175044	4968488	lysis,integrase,terminase,tail,tRNA,protease,holin,portal	Salmonella_phage(43.64%)	101	1079146:1079165	1150932:1150951
WP_001154025.1|1076237_1077041_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1077033_1078356_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1078336_1079041_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1079040_1083507_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1079146:1079165	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1083851_1085693_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1085952_1086501_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1086528_1087176_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1087237_1088428_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1088612_1089704_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1090310_1091711_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1091911_1092373_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|1092369_1092603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023972943.1|1092689_1093904_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1094148_1095585_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1095662_1096865_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1097059_1098352_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1098396_1098645_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1098685_1098925_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1098967_1100125_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000407058.1|1103097_1103334_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	81.1	1.5e-34
WP_000917564.1|1103418_1103577_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_077910972.1|1103569_1103830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1103879_1104290_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1104409_1104649_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1104614_1104989_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1105073_1106057_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1106059_1106809_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1106819_1107167_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1107163_1107475_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1107552_1107843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1108134_1108368_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1108479_1108701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1108783_1109386_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001241019.1|1109385_1109592_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_001096552.1|1109594_1110206_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1110202_1110349_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1110338_1111136_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1111202_1111520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1111693_1111819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1111954_1112404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1112764_1113451_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1113726_1114056_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1114039_1114492_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1114509_1114989_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1115196_1115730_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1115686_1117825_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1117821_1118028_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1118054_1119572_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1119495_1121577_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1121667_1121991_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_023972924.1|1121983_1122283_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	5.9e-15
WP_000453194.1|1122263_1122830_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1122826_1123228_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1123239_1123989_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1124034_1124433_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1124429_1124759_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1124838_1127826_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_023972925.1|1127822_1128155_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	60.6	2.2e-34
WP_000725267.1|1128253_1128751_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1128867_1129401_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1129490_1130186_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1130195_1130933_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1130830_1131535_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000178849.1|1134995_1135238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1135291_1137730_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1137729_1138311_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1138786_1139755_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1140402_1141029_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1141097_1141397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1141381_1142068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1142338_1142530_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1142956_1145569_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1145776_1146787_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1146952_1147495_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1147491_1148601_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1148699_1150808_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1150820_1152728_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1150932:1150951	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1152742_1153996_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1154000_1155641_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1155637_1156201_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1156456_1156624_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1156723_1157242_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1157310_1159071_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1159256_1159709_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1159780_1160833_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1161189_1161699_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1161915_1162521_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1162507_1164661_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1164679_1165126_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_041112204.1|1165249_1167304_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.4e-19
WP_000424187.1|1167339_1167798_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1167892_1168555_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1168725_1169142_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1169186_1169504_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1169561_1170773_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1170987_1171536_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1171561_1172341_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1172389_1172671_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1172667_1172997_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1173083_1173743_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1174363_1175044_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP041026	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 chromosome, complete genome	4968488	1939747	2000881	4968488	terminase,integrase,protease,holin,portal,coat	Salmonella_phage(49.12%)	78	1932397:1932411	1991671:1991685
1932397:1932411	attL	TAACGGTTACGCTGC	NA	NA	NA	NA
WP_000984498.1|1939747_1940629_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|1940822_1942871_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|1942890_1943577_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_000145727.1|1943674_1944259_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|1944300_1945584_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_000551143.1|1945546_1948186_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001542138.1|1948263_1949703_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_000978525.1|1949817_1950057_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457836.1|1950167_1950359_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986176.1|1950377_1951028_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_001134856.1|1951251_1951416_-	membrane protein	NA	NA	NA	NA	NA
WP_000182072.1|1951700_1952423_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|1953106_1953502_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|1953831_1954308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354408.1|1954695_1955115_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001526544.1|1955243_1955438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752421.1|1955484_1955754_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_001617922.1|1955919_1956060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000684835.1|1957523_1957892_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
WP_001531557.1|1958377_1958578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233446.1|1959195_1960110_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|1960242_1960401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|1960410_1961025_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_077942643.1|1961163_1961343_-	hypothetical protein	NA	M1E3P7	Enterobacteria_phage	92.3	4.3e-13
WP_000915528.1|1961459_1961822_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|1961818_1962751_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|1962740_1964198_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_140222634.1|1964256_1966260_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	99.4	0.0e+00
WP_031306894.1|1966371_1967145_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	66.1	8.0e-80
WP_031306893.1|1967228_1967867_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	84.0	5.3e-98
WP_023972977.1|1968213_1968855_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023167446.1|1968915_1969245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077909811.1|1969262_1971083_-	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	93.3	4.1e-276
WP_140222654.1|1971079_1972417_-	DNA transfer protein	NA	A0A1R3Y5Q4	Salmonella_virus	97.1	3.0e-236
WP_000627703.1|1973023_1973479_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_023167450.1|1973478_1974180_-	hypothetical protein	NA	C6ZR14	Salmonella_phage	97.9	2.8e-76
WP_001122424.1|1974183_1975602_-	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_001166098.1|1975561_1976062_-	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_023167451.1|1976045_1976606_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	1.6e-101
WP_023167452.1|1976646_1977939_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	98.8	2.3e-241
WP_023170969.1|1978862_1981040_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.4	0.0e+00
WP_023972976.1|1981039_1982539_-|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.2	1.0e-304
WP_000729925.1|1982516_1983005_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_012532521.1|1983008_1983413_-	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
WP_000808100.1|1983415_1983658_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_001028469.1|1983981_1984503_-	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_140222635.1|1985702_1985927_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	100.0	2.7e-12
WP_023167456.1|1985923_1986361_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	3.7e-74
WP_000738703.1|1986344_1986671_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_140222636.1|1986894_1987413_-	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	66.3	1.1e-56
WP_023167457.1|1988167_1988347_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	98.3	1.6e-23
WP_000149926.1|1988327_1988531_-	protein ninH	NA	Q5G8R8	Enterobacteria_phage	100.0	7.2e-33
WP_140222637.1|1988527_1988752_-	protein ninY	NA	Q5G8R9	Enterobacteria_phage	98.6	6.3e-38
WP_140222638.1|1988748_1989360_-	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	99.5	5.1e-98
WP_000950959.1|1989352_1989529_-	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001531428.1|1989521_1989854_-	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000113772.1|1989856_1990033_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_000679702.1|1989999_1990173_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_041111780.1|1990169_1990607_-	recombination protein NinB	NA	A8CGE3	Salmonella_phage	99.3	6.5e-79
WP_000145948.1|1990680_1990971_-	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_001601985.1|1990967_1991813_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	73.2	3.6e-110
1991671:1991685	attR	TAACGGTTACGCTGC	NA	NA	NA	NA
WP_052319315.1|1991815_1992658_-	replication protein	NA	K7PGT1	Enterobacteria_phage	94.2	1.3e-128
WP_041111776.1|1992644_1993289_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_041111774.1|1993321_1993618_-	hypothetical protein	NA	G9L678	Escherichia_phage	95.9	7.5e-47
WP_000067727.1|1993727_1993943_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000872381.1|1994060_1994714_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.8	1.9e-122
WP_140222639.1|1995067_1995370_+	regulator	NA	Q76H58	Enterobacteria_phage	97.0	7.0e-48
WP_001066179.1|1995382_1995970_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_078341693.1|1996219_1996954_+	pentapeptide repeat-containing protein	NA	I6S1T3	Salmonella_phage	91.5	2.0e-32
WP_023167636.1|1997288_1997462_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	94.2	2.4e-21
WP_000156731.1|1997442_1997631_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_023167638.1|1997760_1998468_+	hypothetical protein	NA	I6R0N0	Salmonella_phage	99.1	2.2e-137
WP_001253478.1|1998467_1998752_+	Anti-RecBCD protein 1	NA	E7C9P9	Salmonella_phage	97.9	1.5e-44
WP_022630922.1|1998798_1999092_+	DUF2856 family protein	NA	Q5G8U3	Enterobacteria_phage	87.6	3.8e-43
WP_023167639.1|1999102_1999267_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	5.5e-23
WP_022630919.1|1999657_1999957_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	96.0	3.1e-56
WP_022630918.1|1999958_2000408_+	ead/Ea22-like family protein	NA	Q716F4	Shigella_phage	85.3	2.7e-48
WP_023972681.1|2000407_2000881_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	2.5e-68
>prophage 5
NZ_CP041026	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 chromosome, complete genome	4968488	2004932	2011741	4968488	tail,integrase	Salmonella_phage(33.33%)	11	2007010:2007024	2017283:2017297
WP_000275418.1|2004932_2005814_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|2006286_2006475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2006539_2006707_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|2006963_2007497_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
2007010:2007024	attL	CGTTCACACGTCATT	NA	NA	NA	NA
WP_001013467.1|2007550_2007781_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|2007970_2008465_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|2008524_2009379_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|2009752_2010106_-	YebY family protein	NA	NA	NA	NA	NA
WP_000979702.1|2010122_2010998_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|2010998_2011373_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|2011510_2011741_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
2017283:2017297	attR	CGTTCACACGTCATT	NA	NA	NA	NA
>prophage 6
NZ_CP041026	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 chromosome, complete genome	4968488	2087191	2166533	4968488	terminase,lysis,integrase,transposase,tail,capsid,head,portal,protease,holin,plate	Salmonella_phage(84.85%)	104	2093729:2093744	2168156:2168171
WP_000502119.1|2087191_2087650_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2087830_2089036_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2089114_2090602_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2090858_2092262_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2092276_2092684_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_023972883.1|2092683_2093052_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_041112560.1|2093123_2094608_+	alpha-amylase	NA	NA	NA	NA	NA
2093729:2093744	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2094647_2095073_-	lipoprotein	NA	NA	NA	NA	NA
WP_023972907.1|2095258_2096464_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2096460_2096694_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2096958_2097345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2097464_2097779_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2097995_2099678_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2099670_2100666_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2100658_2101366_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2101365_2102736_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2102757_2103201_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2103197_2104415_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2104519_2104987_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2104991_2105996_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_140222640.1|2105992_2106406_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2106405_2106783_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2106782_2107520_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2107529_2107799_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2107807_2108602_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2108883_2109507_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2109545_2109794_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2109868_2110096_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2110405_2111221_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2111199_2112912_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2113076_2113322_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2113338_2114250_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2114425_2115346_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2115334_2115805_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2115785_2117216_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2117289_2117985_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2118076_2118376_-	membrane protein	NA	NA	NA	NA	NA
WP_023972908.1|2119025_2120222_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.3	1.1e-109
WP_024131109.1|2120482_2120671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2120681_2120894_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2121348_2122617_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2122619_2123039_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2123165_2123327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099112411.1|2123628_2123844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2123957_2124179_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2124391_2125399_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_000760554.1|2125683_2126253_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000554737.1|2126252_2127815_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001207832.1|2127801_2128389_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_014343855.1|2128391_2128913_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_014343856.1|2128947_2129493_-	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2129464_2129878_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2129882_2130416_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2130415_2131474_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2131470_2132811_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2132844_2134773_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2134857_2135184_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2135180_2135537_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2135536_2137033_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_023233175.1|2137022_2137187_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	98.1	3.8e-24
WP_000779218.1|2137190_2137751_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2137747_2138260_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2138231_2138636_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2138632_2138956_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2138958_2139159_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2139209_2140415_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2140429_2141080_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2141057_2142299_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2142298_2142481_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2142492_2144226_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2144222_2144717_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2144842_2145193_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2145253_2145556_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2145775_2146195_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2146407_2146893_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2146889_2147504_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2147506_2147851_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2148012_2148447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2148376_2148634_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2148766_2149390_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001061457.1|2150395_2151256_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2151272_2151662_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2151658_2152552_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2152551_2153034_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2153035_2153854_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2153850_2154075_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2154071_2155229_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2155225_2155780_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2155808_2156033_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071529734.1|2155971_2156157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020636.1|2156130_2156826_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2157640_2158012_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2158069_2158897_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2159033_2159573_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2159643_2159874_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2159870_2160386_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2160382_2161000_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2160996_2161830_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2161833_2162403_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2162427_2162670_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_023972910.1|2162671_2163661_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	99.7	3.3e-195
WP_000598920.1|2163952_2164750_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2165121_2165412_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2166059_2166533_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2168156:2168171	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 7
NZ_CP041026	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 chromosome, complete genome	4968488	2252527	2263033	4968488		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2252527_2253841_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2253867_2254947_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2254951_2255725_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2255721_2256714_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2256719_2257271_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2257271_2258150_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2258197_2259097_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2259096_2260182_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2260558_2261452_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2261629_2263033_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 8
NZ_CP041026	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 chromosome, complete genome	4968488	2331341	2340512	4968488	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2331341_2333375_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2333615_2334074_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2334245_2334776_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2334832_2335300_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2335346_2336066_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2336062_2337748_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2337970_2338702_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2338761_2338869_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2338849_2339581_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2339564_2340512_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 9
NZ_CP041026	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 chromosome, complete genome	4968488	2359919	2426307	4968488	holin,tail,lysis	Salmonella_phage(25.0%)	59	NA	NA
WP_000989296.1|2359919_2360615_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_041112656.1|2360768_2361653_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2361829_2362549_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2362545_2362791_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2362995_2364237_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2364230_2365466_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2365540_2366551_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2366566_2368087_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2368220_2369219_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_023972823.1|2369717_2370740_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_031306778.1|2370889_2372032_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2372046_2372715_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2373044_2373902_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2373890_2374280_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2374284_2375652_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2375868_2376756_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2376788_2378111_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2378154_2380146_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2380490_2381960_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2382149_2383013_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2383133_2384183_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2384261_2385119_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2385183_2386872_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2386888_2387827_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2387826_2388957_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2389325_2390507_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2390571_2391237_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2391238_2391361_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2391748_2392003_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2392326_2392899_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2393111_2394098_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2394127_2394847_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2395260_2395833_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2396158_2397715_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2397821_2399627_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2399636_2400731_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2400730_2401756_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2401757_2403347_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2403350_2403695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2404085_2405276_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2405303_2405999_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2406150_2407911_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2408035_2408320_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2408428_2409049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2409076_2410084_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2410263_2410491_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2410522_2412283_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2412563_2413067_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2413094_2413385_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2415608_2416052_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_023972660.1|2416429_2416957_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	4.1e-11
WP_023972659.1|2416959_2418201_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2418793_2419123_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2419419_2420751_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2420779_2421148_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_116024798.1|2421162_2422152_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	96.7	1.3e-188
WP_023972657.1|2422480_2424847_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2425015_2425219_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2425515_2426307_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 10
NZ_CP041026	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 chromosome, complete genome	4968488	2765186	2866622	4968488	terminase,lysis,integrase,transposase,tail,tRNA,capsid,head,protease,holin,portal	Salmonella_phage(35.0%)	109	2791330:2791345	2861711:2861726
WP_000940032.1|2765186_2765918_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2766036_2766840_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2766984_2767863_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2768044_2769088_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2769091_2769910_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2769920_2770934_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2770934_2771921_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2771911_2772550_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2772675_2773953_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2773947_2775087_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2775282_2776536_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2776860_2778051_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2778232_2779777_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2780137_2781469_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2781551_2783696_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2783751_2785212_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2785260_2785599_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2785675_2787013_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2787009_2787774_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2787775_2789206_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000970045.1|2789855_2793743_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2791330:2791345	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
WP_001747289.1|2793764_2793998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2793998_2795543_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2795593_2796145_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2796169_2796805_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2796808_2798170_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2798180_2799074_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2799189_2800038_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2800076_2800994_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2801015_2802212_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2802327_2803254_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2803291_2803552_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2803663_2804044_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2804043_2804775_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2804786_2805515_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2805526_2806432_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2806428_2807109_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2807382_2808357_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2808373_2810173_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2810577_2812071_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2812549_2812687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2813399_2813564_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2814143_2814209_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2814271_2814484_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2814590_2814818_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2814914_2815493_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2815482_2816307_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_140222643.1|2816303_2818676_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2818729_2818972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2819010_2822373_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2822434_2823082_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2822979_2823717_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2823723_2824422_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2824431_2824761_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2824763_2827859_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2827830_2828169_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2828165_2828561_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2828611_2829358_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2829365_2829767_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2829875_2831006_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2831054_2831633_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2831660_2832044_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2832054_2832414_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2832471_2833500_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2833554_2833902_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2833914_2835411_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2835400_2836981_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2836977_2837181_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2837164_2839096_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2839067_2839613_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2839899_2840301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2840536_2840989_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2841006_2841459_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_140222655.1|2841442_2841772_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	6.4e-55
WP_001110783.1|2842047_2842734_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2842948_2843137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2843643_2844207_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_072095218.1|2844297_2844483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097241.1|2844479_2845157_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2845153_2845294_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2845290_2845902_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_001241017.1|2845904_2846111_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_000929791.1|2846110_2846713_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2846747_2846996_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2847112_2847346_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2847588_2848221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2848328_2849027_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|2849040_2849736_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_023972743.1|2849732_2850593_-	replication protein	NA	K7PGT1	Enterobacteria_phage	48.5	1.5e-47
WP_010835408.1|2850684_2851059_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2851018_2851261_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_023972744.1|2851360_2851756_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	2.5e-37
WP_001111772.1|2851814_2852654_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2852646_2853033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2853032_2853695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2854151_2854310_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2854331_2854682_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_077248255.1|2857694_2858852_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2858894_2859134_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2859174_2859459_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2859436_2860666_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2861163_2861643_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2861639_2862596_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2861711:2861726	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
WP_001168374.1|2862595_2863246_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2863277_2863853_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2863849_2864014_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001521719.1|2864013_2864193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000989177.1|2864277_2865900_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2865884_2866622_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP041026	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 chromosome, complete genome	4968488	3421356	3457727	4968488	lysis,terminase,integrase,tail,tRNA,capsid,head,portal,holin,plate	Escherichia_phage(31.82%)	48	3416693:3416708	3459789:3459804
3416693:3416708	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_001264394.1|3421356_3422370_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3422597_3422813_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3423048_3424794_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3424943_3426791_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3426914_3427421_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_023135249.1|3427779_3427998_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	100.0	4.3e-39
WP_023972616.1|3428065_3429235_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	94.8	1.4e-205
WP_023972617.1|3429231_3429717_-|tail	phage tail protein	tail	O80317	Escherichia_phage	93.8	3.8e-80
WP_023972618.1|3429732_3432174_-|tail	phage tail tape measure protein	tail	Q37848	Escherichia_phage	87.2	0.0e+00
WP_000763323.1|3432166_3432286_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	100.0	1.4e-15
WP_023972619.1|3432318_3432654_-|tail	phage tail assembly protein	tail	Q37846	Escherichia_phage	97.3	1.5e-51
WP_001550210.1|3432716_3433238_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	100.0	1.7e-94
WP_015406361.1|3433253_3434441_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.7	2.6e-223
WP_023972620.1|3434575_3434977_-|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	81.8	4.1e-56
WP_015406363.1|3434983_3436624_-|tail	bacteriophage tail fiber protein	tail	Q37842	Escherichia_phage	61.1	4.6e-101
WP_023972621.1|3436630_3437164_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	93.1	7.9e-95
WP_001550204.1|3437156_3438065_-|plate	baseplate assembly protein	plate	Q37840	Escherichia_phage	95.7	6.8e-155
WP_023972622.1|3438071_3438419_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	95.7	8.8e-55
WP_023972623.1|3438415_3439057_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.2	2.5e-111
WP_023140001.1|3439125_3439575_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	96.0	2.5e-70
WP_023972624.1|3439567_3440035_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	98.1	1.0e-82
WP_001384078.1|3439997_3440171_-	hypothetical protein	NA	O80311	Escherichia_phage	98.2	6.2e-25
WP_023972625.1|3440142_3440556_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	94.2	5.2e-62
WP_023972626.1|3440552_3441050_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	96.4	2.2e-91
WP_000134660.1|3441036_3441333_-|holin	holin	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
WP_023972627.1|3441336_3441540_-|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	97.0	3.0e-31
WP_023972628.1|3441539_3442046_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	98.2	4.7e-89
WP_023972629.1|3442139_3442889_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	97.6	7.6e-128
WP_001247243.1|3442892_3443960_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
WP_023972630.1|3444036_3444924_-|capsid	capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	89.0	8.1e-129
WP_023972631.1|3445055_3446825_+|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	98.6	0.0e+00
WP_023972632.1|3446824_3447571_+	hypothetical protein	NA	O80303	Escherichia_phage	95.2	8.1e-138
WP_023972633.1|3447567_3448590_+|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	99.1	3.6e-197
WP_071790650.1|3448610_3448811_+	hypothetical protein	NA	A0A0M5M1G4	Salmonella_phage	83.7	2.4e-12
WP_001524880.1|3448724_3448907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139155284.1|3449267_3449390_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_001524927.1|3450031_3450763_-	hypothetical protein	NA	Q37850	Escherichia_phage	94.2	4.3e-128
WP_023972634.1|3450844_3451285_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	100.0	1.9e-70
WP_077910960.1|3451403_3453650_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.9	0.0e+00
WP_000213329.1|3453745_3454267_-	hypothetical protein	NA	Q6K1F4	Salmonella_virus	100.0	1.2e-92
WP_023972636.1|3454263_3454488_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	98.6	4.2e-34
WP_001246237.1|3454487_3454715_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
WP_000085639.1|3454784_3454985_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	98.5	2.3e-31
WP_000920168.1|3454971_3455199_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	2.1e-36
WP_023972637.1|3455206_3455716_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	97.6	1.4e-88
WP_023972638.1|3455736_3456012_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.4	4.5e-38
WP_023972639.1|3456144_3456720_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	65.4	6.8e-68
WP_023972640.1|3456719_3457727_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.5	3.1e-193
3459789:3459804	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
>prophage 12
NZ_CP041026	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 chromosome, complete genome	4968488	4318385	4412519	4968488	terminase,integrase,lysis,tail,tRNA,capsid,head,protease,holin,plate,portal	Escherichia_phage(39.13%)	107	4351293:4351339	4382616:4382662
WP_000560974.1|4318385_4318823_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000080770.1|4318819_4319809_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259011.1|4319823_4320270_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558166.1|4320266_4320578_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_001127703.1|4320663_4321593_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001159630.1|4321810_4322122_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|4322122_4322413_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|4322459_4323389_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|4323385_4324021_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|4324017_4324920_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_010989087.1|4324932_4327983_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	2.7e-06
WP_001059744.1|4328177_4329014_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710966.1|4329281_4330313_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000828052.1|4330495_4331596_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527676.1|4331950_4332274_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|4332273_4332933_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010989088.1|4333015_4333582_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619478.1|4333670_4333985_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009249.1|4333981_4335130_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179685.1|4335256_4336084_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211463.1|4336226_4337486_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000143970.1|4337482_4338952_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|4339239_4340076_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013290.1|4340228_4341077_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063541.1|4341073_4342108_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|4342726_4343410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566800.1|4343567_4344875_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|4344867_4345383_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812819.1|4345401_4346385_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000122635.1|4346713_4347334_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	1.4e-63
WP_014343930.1|4347340_4348093_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133444.1|4348104_4348500_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|4348550_4349924_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|4349920_4350619_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|4350769_4351270_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4351293:4351339	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|4351455_4352436_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|4352505_4352799_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|4352935_4353208_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217677.1|4353377_4353878_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000288879.1|4353941_4354166_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
WP_001277964.1|4354165_4354468_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	97.0	2.5e-45
WP_001113272.1|4354467_4354692_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	8.5e-35
WP_000027666.1|4354688_4354964_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
WP_000216280.1|4354953_4357242_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.0	0.0e+00
WP_010835386.1|4357472_4359680_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000038172.1|4360110_4361145_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	1.2e-200
WP_010835387.1|4361144_4362917_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085976.1|4363090_4363945_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	96.5	9.0e-133
WP_001248559.1|4364003_4365077_+|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	100.0	5.1e-202
WP_001682330.1|4365080_4365824_+|terminase	terminase endonuclease subunit	terminase	U5N091	Enterobacteria_phage	97.2	3.3e-123
WP_000988633.1|4365923_4366433_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|4366432_4366636_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|4366639_4366921_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000736607.1|4367432_4367858_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.8e-58
WP_000040673.1|4367845_4368271_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.7e-66
WP_001440152.1|4368242_4368416_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917156.1|4368378_4368846_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_001001780.1|4368838_4369291_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001093737.1|4369357_4369993_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	9.0e-114
WP_000127163.1|4369989_4370337_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121478.1|4370341_4371250_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_001285338.1|4371242_4371854_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	6.4e-117
WP_023167498.1|4371850_4373413_+	phage Tail Collar domain protein	NA	A0A1S6KZZ8	Salmonella_phage	49.4	1.5e-154
WP_022631136.1|4373415_4373949_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
WP_010835343.1|4373953_4374571_-|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
WP_023891855.1|4374540_4375029_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	82.6	2.1e-70
WP_010835363.1|4375248_4375842_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.8e-103
WP_001286720.1|4375901_4377092_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	4.8e-225
WP_001251408.1|4377104_4377623_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031306.1|4377679_4377955_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|4377987_4378107_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069914.1|4378099_4380547_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	97.1	0.0e+00
WP_000978885.1|4380561_4381041_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_000882949.1|4381040_4382204_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_000468308.1|4382285_4382504_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001077320.1|4382740_4383643_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4382616:4382662	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|4383827_4384790_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758711.1|4384993_4385983_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750761.1|4386083_4386839_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777317.1|4387101_4388436_+	MFS transporter	NA	NA	NA	NA	NA
WP_000646499.1|4388446_4389406_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557889.1|4389415_4390456_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001519915.1|4390518_4391241_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000061008.1|4391338_4391503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621104.1|4391518_4391650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173080.1|4391739_4392090_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113085.1|4392103_4393696_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001283048.1|4393783_4394743_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167250.1|4394998_4396534_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_000911134.1|4396527_4397571_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981826.1|4397567_4398569_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090737.1|4398597_4399620_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774147.1|4399648_4400524_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001738619.1|4400606_4400897_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088049.1|4400906_4401671_+	epimerase	NA	NA	NA	NA	NA
WP_001216339.1|4401762_4402530_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802242.1|4402642_4403239_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|4403339_4403768_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796300.1|4403874_4404621_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250625.1|4404717_4405728_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|4405839_4407348_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|4407368_4408214_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|4408612_4408852_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|4409073_4409559_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_023972960.1|4409651_4410581_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|4410647_4411979_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|4411988_4412519_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 13
NZ_CP041026	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 chromosome, complete genome	4968488	4529356	4549776	4968488	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4529356_4530085_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4530281_4530572_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4530820_4531276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4531272_4531878_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4531882_4533628_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4533630_4534263_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4534255_4535371_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4535361_4535721_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4535884_4537432_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4537431_4538361_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4538357_4538720_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4539047_4539770_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4539779_4540823_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4540810_4541020_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4541019_4541973_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|4541972_4544327_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4544423_4544552_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4544511_4544829_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4544880_4545405_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4545404_4546832_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4546821_4547019_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4547015_4547471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4547630_4547945_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4547957_4548563_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4548565_4548853_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4549428_4549776_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP041027	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 plasmid pSA20143792.1, complete sequence	190723	68723	115442	190723	transposase	Escherichia_phage(23.08%)	49	NA	NA
WP_001067855.1|68723_69428_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|69978_70683_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001366550.1|71008_71746_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|71742_71967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|72177_73671_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|73701_74586_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_021038045.1|74802_76017_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	2.5e-19
WP_001255015.1|76044_76350_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804063.1|76616_77816_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470728.1|77894_78572_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|78603_78846_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000480968.1|79151_79988_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|79987_80791_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|80851_81667_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000338945.1|81973_82285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|82458_83244_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|83247_84429_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|84477_84750_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000074431.1|84802_85438_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_001125904.1|85999_86377_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000044823.1|86369_86651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|86625_87300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|87367_87799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000348668.1|87783_88116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000647188.1|88124_88625_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_000936897.1|88628_90056_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000268552.1|90055_90712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464630.1|90767_91385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000505706.1|91385_91592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326171.1|91596_91896_+	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
WP_000467110.1|91986_92475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366823.1|92489_94682_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
WP_001191890.1|94681_94915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001249395.1|94896_95514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326173.1|95681_98654_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_000178857.1|98650_100516_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000332868.1|100526_101111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743449.1|101067_101697_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000122507.1|101706_102153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000869297.1|102162_102540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231464.1|102539_103202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326174.1|103525_103903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|104038_104743_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000606835.1|105555_111042_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_001447736.1|111087_111513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000118520.1|111769_112087_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001221666.1|112083_112617_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_000976514.1|112710_113856_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_000608644.1|114179_115442_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
