The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030797	Brevibacterium linens strain RS16 chromosome, complete genome	4421157	3000543	3023871	4421157	terminase,head	Brevibacterium_phage(88.89%)	26	NA	NA
WP_139908593.1|3000543_3001641_-	hypothetical protein	NA	A0A249XQ84	Brevibacterium_phage	69.0	3.4e-153
WP_139908594.1|3001649_3002702_-	hypothetical protein	NA	A0A249XNP0	Brevibacterium_phage	70.9	4.3e-145
WP_139908595.1|3002704_3003586_-	hypothetical protein	NA	A0A249XNP2	Brevibacterium_phage	58.7	1.0e-94
WP_139908596.1|3003586_3008755_-	hypothetical protein	NA	A0A249XNT7	Brevibacterium_phage	42.3	7.2e-185
WP_139908597.1|3008806_3009937_-	tape measure protein	NA	U5PSU7	Bacillus_virus	34.4	1.4e-24
WP_139908598.1|3009996_3010416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139908599.1|3010405_3010741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908600.1|3010746_3011421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908601.1|3011515_3012064_-	hypothetical protein	NA	A0A249XNM8	Brevibacterium_phage	39.8	1.0e-25
WP_139908602.1|3012066_3012246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908603.1|3012314_3012674_-	hypothetical protein	NA	A0A249XNM0	Brevibacterium_phage	58.4	1.6e-30
WP_139908604.1|3012713_3013058_-	hypothetical protein	NA	A0A249XNM6	Brevibacterium_phage	58.3	2.3e-23
WP_139908605.1|3013054_3013495_-	hypothetical protein	NA	A0A249XNN1	Brevibacterium_phage	53.0	1.2e-32
WP_139908606.1|3013491_3013857_-	hypothetical protein	NA	A0A249XQ72	Brevibacterium_phage	64.4	1.4e-31
WP_139908607.1|3013935_3015012_-	hypothetical protein	NA	A0A249XNM5	Brevibacterium_phage	68.3	4.3e-140
WP_139908608.1|3015027_3015363_-	DUF2190 family protein	NA	A0A249XNM3	Brevibacterium_phage	68.2	2.9e-34
WP_139908609.1|3015362_3016610_-	hypothetical protein	NA	A0A249XNL5	Brevibacterium_phage	57.8	1.0e-105
WP_139908610.1|3016606_3017659_-|head	phage head morphogenesis protein	head	A0A249XNT1	Brevibacterium_phage	60.5	3.3e-113
WP_139908611.1|3017674_3019228_-	hypothetical protein	NA	A0A249XNL8	Brevibacterium_phage	67.6	1.8e-203
WP_139909829.1|3019245_3020733_-|terminase	phage terminase large subunit	terminase	A0A249XNL6	Brevibacterium_phage	78.8	2.2e-235
WP_139908612.1|3021058_3021829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908613.1|3021821_3022037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908614.1|3022158_3022413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908615.1|3022409_3022670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908616.1|3022666_3023296_-	hypothetical protein	NA	A0A249XQ59	Brevibacterium_phage	51.5	4.4e-52
WP_139908617.1|3023295_3023871_-	hypothetical protein	NA	W8FQ64	Mycobacterium_phage	38.3	2.1e-16
>prophage 2
NZ_CP030797	Brevibacterium linens strain RS16 chromosome, complete genome	4421157	3029031	3040391	4421157	transposase	Gordonia_phage(25.0%)	20	NA	NA
WP_139908630.1|3029031_3029853_-	hypothetical protein	NA	A0A142K8V7	Gordonia_phage	48.2	2.8e-14
WP_139908631.1|3029951_3030143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908632.1|3030139_3030496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908633.1|3030492_3031083_-	hypothetical protein	NA	A0A1B3B1S3	Gordonia_phage	42.0	1.2e-22
WP_139908634.1|3031079_3031346_-	NrdH-redoxin	NA	A0A0N7E4I6	Mycobacterium_phage	36.0	2.6e-06
WP_139908635.1|3031359_3031737_-	hypothetical protein	NA	A0A173G9J6	Propionibacterium_phage	44.6	1.4e-21
WP_139908636.1|3031733_3032081_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_139908637.1|3032077_3032659_-	hypothetical protein	NA	A0A2P1CID8	Actinomyces_phage	56.5	1.3e-39
WP_139909830.1|3032714_3033308_-	DNA (cytosine-5-)-methyltransferase	NA	A0A173G9J3	Propionibacterium_phage	68.1	3.0e-63
WP_139908638.1|3033334_3033721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908639.1|3033704_3034202_-	single-stranded DNA-binding protein	NA	A0A222Z2F1	Arthrobacter_phage	74.2	8.2e-46
WP_139908640.1|3034204_3035062_-	recombinase RecT	NA	A0A1V0E653	Streptomyces_phage	44.0	1.7e-35
WP_139908641.1|3035061_3036447_-	hypothetical protein	NA	I4AZN3	Saccharomonospora_phage	38.9	1.5e-41
WP_139908642.1|3036486_3036684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908643.1|3036802_3037030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908644.1|3037026_3037383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908645.1|3037446_3037701_-	helix-turn-helix transcriptional regulator	NA	A0A1J0MDU5	Mycobacterium_phage	52.2	3.5e-08
WP_139908646.1|3037860_3038499_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_139908647.1|3038540_3038960_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2D1GGF1	Gordonia_phage	39.8	4.0e-17
WP_139908648.1|3038975_3040391_+	recombinase family protein	NA	A0A1J0MCY2	Streptomyces_phage	30.4	5.2e-45
>prophage 3
NZ_CP030797	Brevibacterium linens strain RS16 chromosome, complete genome	4421157	3508999	3557573	4421157	portal,protease,tail,integrase,capsid,head	Gordonia_phage(23.33%)	60	3517387:3517412	3562090:3562115
WP_139908982.1|3508999_3509524_-	hypothetical protein	NA	A0A1W6JRD8	Corynebacterium_phage	29.1	2.0e-13
WP_139908983.1|3509523_3509718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908984.1|3509807_3511097_-|capsid	phage major capsid protein	capsid	A0A1D8ETI2	Propionibacterium_phage	40.8	1.1e-68
WP_139908985.1|3510966_3511887_-|head,protease	HK97 family phage prohead protease	head,protease	A0A097EYK1	Mycobacterium_phage	48.3	1.7e-36
WP_139908986.1|3511828_3513772_-|portal	phage portal protein	portal	A0A2H4P9M7	Arthrobacter_phage	35.4	2.0e-95
WP_139908987.1|3513854_3515384_-	hypothetical protein	NA	A0A0U4JKK7	Arthrobacter_phage	41.2	3.1e-99
WP_139908988.1|3515559_3516060_-	hypothetical protein	NA	A0A0E3T6X9	Gordonia_phage	34.8	9.3e-05
WP_139908989.1|3516248_3516545_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_139908990.1|3516555_3517080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908991.1|3517373_3517673_-	hypothetical protein	NA	NA	NA	NA	NA
3517387:3517412	attL	CCGAGTAGTGCGGTGATCGCGGCGCG	NA	NA	NA	NA
WP_139908992.1|3517669_3517951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908993.1|3518071_3518473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908994.1|3518469_3518736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908995.1|3518732_3518990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908996.1|3519128_3519503_-	hypothetical protein	NA	A0A249XNQ5	Brevibacterium_phage	35.2	9.7e-07
WP_139908997.1|3519495_3519699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139908998.1|3519806_3520319_-	single-stranded DNA-binding protein	NA	A0A160DEY6	Gordonia_phage	66.7	1.7e-41
WP_139908999.1|3520321_3520696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909000.1|3521591_3521999_-	hypothetical protein	NA	A0A2L0HJX4	Mycobacterium_phage	41.9	6.6e-09
WP_139909001.1|3522299_3523817_-	DNA cytosine methyltransferase	NA	A0A076G9A5	Mycobacterium_phage	55.2	2.4e-149
WP_139909002.1|3523810_3524071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909003.1|3524063_3524438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909004.1|3524434_3524626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909005.1|3524622_3524955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909006.1|3525079_3525853_-	hypothetical protein	NA	A0A159B6K8	Gordonia_phage	48.9	8.0e-48
WP_139909007.1|3525845_3526058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909008.1|3526060_3527101_-	hypothetical protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	23.1	1.0e-13
WP_139909009.1|3527093_3527288_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_139909010.1|3527284_3527584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909011.1|3527580_3527766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909012.1|3527765_3527963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909013.1|3528218_3528962_-	phage repressor protein/antirepressor Ant	NA	A7IY79	Corynebacterium_phage	37.5	2.8e-37
WP_139909014.1|3529020_3529332_-	helix-turn-helix domain-containing protein	NA	A0A160DIE6	Gordonia_phage	55.4	1.4e-19
WP_139909015.1|3529437_3530157_+	helix-turn-helix domain-containing protein	NA	A0A160DCX5	Gordonia_phage	51.2	1.2e-13
WP_139909016.1|3530379_3530637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139909017.1|3530649_3530967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139909018.1|3531067_3531421_+	helix-turn-helix transcriptional regulator	NA	A0A222ZFQ3	Arthrobacter_phage	31.2	1.7e-08
WP_139909019.1|3531413_3532619_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4B2E0	Arthrobacter_phage	38.7	2.4e-54
WP_139909020.1|3533224_3535255_-	hypothetical protein	NA	A0A1P8CWN9	Bacillus_phage	30.6	6.6e-17
WP_139909021.1|3535356_3536412_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1U9WRQ3	Mycobacterium_phage	39.9	4.3e-20
WP_139909022.1|3536411_3536705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909023.1|3537453_3538473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909024.1|3538488_3539613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909025.1|3539619_3540618_-	hypothetical protein	NA	A0A291LH57	Streptomyces_phage	31.0	3.0e-10
WP_139909026.1|3540532_3546787_-|tail	phage tail tape measure protein	tail	A0A249XNT7	Brevibacterium_phage	52.0	0.0e+00
WP_139909027.1|3547301_3547949_-	hypothetical protein	NA	A0A249XNU1	Brevibacterium_phage	63.0	1.7e-67
WP_139909028.1|3548091_3548619_-	hypothetical protein	NA	A0A249XNM8	Brevibacterium_phage	54.9	1.8e-43
WP_139909029.1|3548621_3548825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909030.1|3548885_3549374_-	HNH endonuclease	NA	T2AAH7	Mycobacterium_phage	46.7	3.6e-30
WP_139909031.1|3549437_3549824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909032.1|3549813_3550200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909033.1|3550200_3550554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909034.1|3550586_3551144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909035.1|3551168_3552125_-|capsid	phage major capsid protein	capsid	A0A2P1CKI0	Microbacterium_phage	63.9	7.7e-109
WP_139909036.1|3552148_3552673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909037.1|3552704_3553652_-	hypothetical protein	NA	A0A1C9EHV4	Gordonia_phage	33.5	1.2e-32
WP_139909038.1|3553605_3555111_-|portal	phage portal protein	portal	D7NW49	Streptomyces_phage	47.6	1.8e-115
WP_139909039.1|3555119_3556709_-	hypothetical protein	NA	D7NW48	Streptomyces_phage	55.3	5.7e-157
WP_139909040.1|3556698_3557145_-	hypothetical protein	NA	A0A1C9EHY3	Gordonia_phage	54.5	3.8e-26
WP_139909877.1|3557393_3557573_-	hypothetical protein	NA	A0A142K681	Streptomyces_phage	60.0	3.9e-14
3562090:3562115	attR	CCGAGTAGTGCGGTGATCGCGGCGCG	NA	NA	NA	NA
>prophage 4
NZ_CP030797	Brevibacterium linens strain RS16 chromosome, complete genome	4421157	3563520	3573745	4421157		Mycobacterium_phage(22.22%)	16	NA	NA
WP_139909050.1|3563520_3564084_-	hypothetical protein	NA	A0A142F2L8	Mycobacterium_phage	37.4	2.9e-31
WP_139909051.1|3564161_3564680_-	single-stranded DNA-binding protein	NA	A0A0U4B2E8	Arthrobacter_phage	75.2	1.7e-46
WP_139909052.1|3565130_3565925_-	hypothetical protein	NA	A0A218M3B5	Acidovorax_phage	48.3	2.6e-65
WP_139909053.1|3566226_3566460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909054.1|3566452_3566890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909055.1|3567045_3568281_-	AAA family ATPase	NA	A0A1P8VV42	Rathayibacter_phage	34.7	1.3e-60
WP_139909056.1|3568277_3569030_-	hypothetical protein	NA	A0A142K8V7	Gordonia_phage	51.3	4.8e-29
WP_139909057.1|3569030_3569459_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_139909058.1|3569455_3569668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909059.1|3569664_3569904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909060.1|3570231_3570513_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	31.1	6.8e-05
WP_139909061.1|3570521_3570914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909062.1|3571237_3571732_-	hypothetical protein	NA	G9FH01	Rhodococcus_phage	51.4	7.7e-36
WP_139909063.1|3571770_3572460_-	YqaJ viral recombinase family protein	NA	A0A2L0HJW4	Mycobacterium_phage	40.1	9.4e-40
WP_139909064.1|3572456_3572684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139909065.1|3573379_3573745_-	hypothetical protein	NA	A0A249XNQ5	Brevibacterium_phage	41.1	5.3e-10
