The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029840	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 chromosome, complete genome	4870227	975325	984057	4870227	transposase,protease	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|975325_976444_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|976440_978387_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|978516_978738_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|979061_979382_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|979412_981689_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|981880_982339_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_140238273.1|982511_982787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085983316.1|982801_984057_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NZ_CP029840	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 chromosome, complete genome	4870227	1033916	1132659	4870227	terminase,portal,protease,holin,integrase,tail,tRNA,lysis	Salmonella_phage(44.64%)	102	1036825:1036844	1108547:1108566
WP_001154025.1|1033916_1034720_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1034712_1036035_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1036015_1036720_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1036719_1041186_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1036825:1036844	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1041530_1043372_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1043631_1044180_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1044207_1044855_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1044916_1046107_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1046291_1047383_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1047989_1049390_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1049590_1050052_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|1050048_1050282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544849.1|1050368_1051583_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1051827_1053264_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1053341_1054544_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1054738_1056031_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1056075_1056324_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1056364_1056604_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1056646_1057804_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_140238260.1|1057766_1060652_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.5	0.0e+00
WP_001668146.1|1060778_1061078_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1061099_1061258_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_077918792.1|1061250_1061511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1061560_1061971_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1062090_1062330_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1062295_1062670_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_001738833.1|1062754_1063738_+	gifsy-1 prophage PrpO	NA	H6WRX7	Salmonella_phage	99.7	1.6e-162
WP_000800010.1|1063740_1064490_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1064500_1064848_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1064844_1065156_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1065233_1065524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1065815_1066049_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1066160_1066382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1066464_1067067_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001241019.1|1067066_1067273_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_001096552.1|1067275_1067887_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1067883_1068030_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1068019_1068817_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1068883_1069201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1069374_1069500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1069635_1070085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076181665.1|1070445_1071132_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.1	3.9e-131
WP_001574216.1|1071407_1071737_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1071720_1072173_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_031248426.1|1072190_1072670_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	75.0	2.3e-53
WP_000371784.1|1072877_1073411_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1073367_1075506_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1075502_1075709_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1075735_1077253_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1077176_1079258_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1079348_1079672_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1079664_1079964_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1079944_1080511_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1080507_1080909_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1080920_1081670_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1081715_1082114_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1082110_1082440_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_140238274.1|1082519_1085507_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	3.1e-265
WP_000978296.1|1085503_1085836_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1085934_1086432_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1086548_1087082_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1087171_1087867_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1087876_1088614_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1088511_1089216_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000178849.1|1092676_1092919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140238261.1|1092972_1095345_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.3	1.6e-91
WP_000143167.1|1095344_1095926_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1096401_1097370_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1098017_1098644_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1098712_1099012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1098996_1099683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1099953_1100145_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1100571_1103184_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1103391_1104402_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1104567_1105110_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1105106_1106216_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1106314_1108423_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1108435_1110343_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1108547:1108566	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1110357_1111611_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1111615_1113256_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1113252_1113816_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1114071_1114239_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1114338_1114857_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1114925_1116686_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1116871_1117324_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1117395_1118448_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1118804_1119314_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1119530_1120136_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1120122_1122276_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1122294_1122741_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1122864_1124919_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1124954_1125413_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1125507_1126170_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1126340_1126757_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1126801_1127119_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1127176_1128388_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1128602_1129151_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1129176_1129956_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1130004_1130286_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1130282_1130612_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1130698_1131358_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1131978_1132659_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NZ_CP029840	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 chromosome, complete genome	4870227	1920998	1927807	4870227	integrase,tail	Salmonella_phage(33.33%)	11	1915861:1915883	1925576:1925598
1915861:1915883	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1920998_1921880_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1922352_1922541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1922605_1922773_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1923029_1923563_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1923616_1923847_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1924036_1924531_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1924590_1925445_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1925818_1926172_-	YebY family protein	NA	NA	NA	NA	NA
1925576:1925598	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1926188_1927064_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1927064_1927439_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1927576_1927807_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 4
NZ_CP029840	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 chromosome, complete genome	4870227	2003257	2082600	4870227	plate,terminase,portal,protease,head,capsid,holin,integrase,tail,transposase,lysis	Salmonella_phage(85.07%)	105	2009795:2009810	2084223:2084238
WP_000502119.1|2003257_2003716_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2003896_2005102_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2005180_2006668_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2006924_2008328_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2008342_2008750_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2008749_2009118_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2009189_2010674_+	alpha-amylase	NA	NA	NA	NA	NA
2009795:2009810	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2010713_2011139_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2011324_2012530_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2012526_2012760_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2013024_2013411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2013530_2013845_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2014061_2015744_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2015736_2016732_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2016724_2017432_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2017431_2018802_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2018823_2019267_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2019263_2020481_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2020585_2021053_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2021057_2022062_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2022058_2022472_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2022471_2022849_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2022848_2023586_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2023595_2023865_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2023873_2024668_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103975.1|2024949_2025573_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2025611_2025860_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2025934_2026162_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2026471_2027287_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001738345.1|2027265_2028978_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2029142_2029388_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2029404_2030316_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2030491_2031412_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2031400_2031871_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2031851_2033282_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2033355_2034051_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2034142_2034442_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2035090_2036287_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2036547_2036736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2036746_2036959_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2037413_2038682_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2038684_2039104_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2039230_2039392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099112411.1|2039693_2039909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2040022_2040244_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2040456_2041464_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_000760554.1|2041748_2042318_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_020978671.1|2042317_2043880_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.6	4.9e-286
WP_001207832.1|2043866_2044454_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_001738350.1|2044456_2044978_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	99.4	1.5e-93
WP_014343856.1|2045012_2045558_-	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2045529_2045943_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2045947_2046481_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2046480_2047539_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2047535_2048876_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2048909_2050838_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2050922_2051249_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2051245_2051602_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2051601_2053098_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2053087_2053252_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2053255_2053816_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2053812_2054325_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2054296_2054701_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2054697_2055021_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2055023_2055224_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2055274_2056480_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2056494_2057145_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2057122_2058364_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2058363_2058546_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2058557_2060291_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2060287_2060782_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2060907_2061258_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2061318_2061621_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2061840_2062260_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2062472_2062958_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2062954_2063569_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2063571_2063916_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2064077_2064512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2064441_2064699_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2064831_2065455_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202277.1|2065465_2066455_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_001061457.1|2066462_2067323_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2067339_2067729_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2067725_2068619_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2068618_2069101_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2069102_2069921_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2069917_2070142_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2070138_2071296_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2071292_2071847_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2071875_2072100_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071529734.1|2072038_2072224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020636.1|2072197_2072893_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2073707_2074079_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001738355.1|2074136_2074964_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	99.6	2.9e-152
WP_000008351.1|2075100_2075640_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2075710_2075941_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2075937_2076453_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2076449_2077067_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2077063_2077897_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2077900_2078470_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2078494_2078737_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2078738_2079728_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2080019_2080817_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2081188_2081479_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2082126_2082600_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2084223:2084238	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP029840	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 chromosome, complete genome	4870227	2168593	2179099	4870227		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2168593_2169907_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2169933_2171013_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2171017_2171791_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2171787_2172780_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2172785_2173337_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2173337_2174216_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_140238263.1|2174263_2175163_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2175162_2176248_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2176624_2177518_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2177695_2179099_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP029840	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 chromosome, complete genome	4870227	2247407	2256578	4870227	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2247407_2249441_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2249681_2250140_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2250311_2250842_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2250898_2251366_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2251412_2252132_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2252128_2253814_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2254036_2254768_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2254827_2254935_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2254915_2255647_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2255630_2256578_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
NZ_CP029840	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 chromosome, complete genome	4870227	2275985	2342380	4870227	holin,tail,lysis	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2275985_2276681_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2276834_2277719_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2277895_2278615_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2278611_2278857_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001738396.1|2279061_2280303_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2280296_2281532_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2281606_2282617_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535905.1|2282632_2284153_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2284286_2285285_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2285783_2286806_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2286955_2288098_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2288112_2288781_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2289110_2289968_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2289956_2290346_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2290350_2291718_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2291934_2292822_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2292854_2294177_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2294220_2296212_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2296556_2298026_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2298215_2299079_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2299199_2300249_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2300327_2301185_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2301249_2302938_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2302954_2303893_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2303892_2305023_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2305391_2306573_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2306637_2307303_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2307304_2307427_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2307814_2308069_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2308392_2308965_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2309177_2310164_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2310193_2310913_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2311326_2311899_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2312224_2313781_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2313887_2315693_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2315702_2316797_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2316796_2317822_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2317823_2319413_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2319416_2319761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2320151_2321342_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2321369_2322065_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2322216_2323977_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2324101_2324386_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2324494_2325115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2325142_2326150_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2326329_2326557_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2326588_2328349_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2328629_2329133_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2329160_2329451_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2329798_2331628_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2331681_2332125_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2332502_2333030_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2333032_2334274_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2334866_2335196_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2335492_2336824_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2336852_2337221_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_076134203.1|2337235_2338225_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.9	2.2e-191
WP_050195394.1|2338553_2340920_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	89.4	7.6e-73
WP_001113462.1|2341088_2341292_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2341588_2342380_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP029840	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 chromosome, complete genome	4870227	2681132	2782546	4870227	terminase,portal,protease,head,capsid,holin,integrase,tail,tRNA,transposase,lysis	Salmonella_phage(36.07%)	109	2707276:2707291	2777636:2777651
WP_000940032.1|2681132_2681864_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2681982_2682786_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2682930_2683809_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_140238265.1|2683990_2685034_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2685037_2685856_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2685866_2686880_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2686880_2687867_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2687857_2688496_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2688621_2689899_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2689893_2691033_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2691228_2692482_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2692806_2693997_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2694178_2695723_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2696083_2697415_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2697497_2699642_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2699697_2701158_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2701206_2701545_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2701621_2702959_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2702955_2703720_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2703721_2705152_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000970045.1|2705801_2709689_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2707276:2707291	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
WP_001747289.1|2709710_2709944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2709944_2711489_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2711539_2712091_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2712115_2712751_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2712754_2714116_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2714126_2715020_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2715135_2715984_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2716022_2716940_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2716961_2718158_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2718273_2719200_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2719237_2719498_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2719609_2719990_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2719989_2720721_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2720732_2721461_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2721472_2722378_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2722374_2723055_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2723328_2724303_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2724319_2726119_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2726523_2728017_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2728495_2728633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2729345_2729510_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2730089_2730155_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2730217_2730430_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2730536_2730764_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2730860_2731439_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2731428_2732253_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2732249_2734622_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2734675_2734918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2734956_2738319_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2738380_2739028_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_015701343.1|2738925_2739663_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	3.0e-129
WP_001152689.1|2739669_2740368_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2740377_2740707_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2740709_2743805_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2743776_2744115_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2744111_2744507_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2744557_2745304_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2745311_2745713_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2745821_2746952_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2747000_2747579_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2747606_2747990_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2748000_2748360_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2748417_2749446_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2749500_2749848_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2749860_2751357_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_001738454.1|2751346_2752834_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	63.3	5.8e-180
WP_000201415.1|2752922_2753126_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2753109_2755041_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2755012_2755558_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2755844_2756246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2756481_2756934_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2756951_2757404_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2757387_2757717_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_076181665.1|2757992_2758679_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.1	3.9e-131
WP_000657897.1|2758893_2759082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2759588_2760152_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_072095218.1|2760242_2760428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097241.1|2760424_2761102_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2761098_2761239_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2761235_2761847_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_001241017.1|2761849_2762056_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_076192923.1|2762055_2762658_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.0	2.4e-108
WP_014343878.1|2762692_2762941_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2763057_2763291_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2763533_2764166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2764273_2764972_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|2764985_2765681_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_001738749.1|2765677_2766514_-	replication protein	NA	K7PGT1	Enterobacteria_phage	48.5	4.6e-49
WP_010835408.1|2766605_2766980_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2766939_2767182_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|2767281_2767677_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|2767735_2768575_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2768567_2768954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2768953_2769616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2770072_2770231_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2770252_2770603_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_140238266.1|2770729_2773657_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.1	0.0e+00
WP_014344386.1|2773619_2774777_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2774819_2775059_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2775099_2775384_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2775361_2776591_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2777088_2777568_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2777564_2778521_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2777636:2777651	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
WP_001168374.1|2778520_2779171_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2779202_2779778_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2779774_2779939_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001521719.1|2779938_2780118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000083343.1|2781808_2782546_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP029840	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 chromosome, complete genome	4870227	2815034	2914733	4870227	terminase,portal,head,capsid,integrase,tail,tRNA	Cronobacter_phage(64.58%)	97	2890929:2890944	2918961:2918976
WP_000469804.1|2815034_2815802_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2815846_2816395_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2816413_2816662_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2816975_2818337_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2818502_2819294_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2819313_2820600_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2820720_2821326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2821360_2821951_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2822073_2822952_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2823037_2824699_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2824847_2825186_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2825351_2825642_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2825631_2826108_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2826257_2826740_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237670.1|2827353_2838828_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533858.1|2838892_2840302_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2840298_2842479_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2842486_2843650_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001738745.1|2844182_2844992_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_001738744.1|2845145_2846204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001738743.1|2846422_2846632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001738742.1|2846808_2847141_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	50.9	2.2e-23
WP_001738741.1|2847246_2848947_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	77.4	4.1e-222
WP_001738740.1|2848949_2849495_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.6	7.9e-66
WP_001738739.1|2849466_2850192_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	54.4	1.2e-64
WP_001738738.1|2850181_2850622_-|tail	phage tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	29.8	4.3e-06
WP_001738737.1|2850623_2852675_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	82.6	9.7e-133
WP_001738736.1|2852685_2853273_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	7.6e-91
WP_001738734.1|2853265_2854450_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	80.7	5.5e-181
WP_000004502.1|2854446_2854776_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	68.8	9.3e-38
WP_001738733.1|2854772_2856833_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.6	6.2e-273
WP_001738732.1|2857020_2857278_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	57.3	4.9e-18
WP_024137079.1|2857264_2857453_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	75.8	2.0e-21
WP_001738731.1|2857382_2857763_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	64.0	2.4e-29
WP_000175561.1|2857762_2858104_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	94.1	6.9e-52
WP_001738730.1|2858090_2858393_-	Holin from bacteriophage origin	NA	A0A0M5M1H1	Salmonella_phage	55.3	1.4e-19
WP_000044253.1|2858403_2858859_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.8	5.9e-59
WP_001738729.1|2858855_2859983_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	81.6	2.4e-173
WP_001738727.1|2859979_2860687_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.6	3.7e-100
WP_001738725.1|2860683_2861190_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	68.7	6.2e-65
WP_020978745.1|2861186_2861675_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.1e-63
WP_001738722.1|2861735_2862437_-|terminase	terminase endonuclease subunit from bacteriophage origin	terminase	F1BUM0	Cronobacter_phage	69.0	1.3e-89
WP_001738720.1|2862440_2863463_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.8	3.0e-159
WP_001738719.1|2863524_2864328_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.8	1.3e-80
WP_001738718.1|2864489_2866265_+	Terminase ATPase subunit from bacteriophage origin	NA	F1BUM5	Cronobacter_phage	83.4	1.5e-291
WP_001738716.1|2866261_2867323_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.3	5.5e-164
WP_012602735.1|2867319_2867643_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	93.3	4.7e-50
WP_001739154.1|2867616_2867835_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	47.2	3.6e-06
WP_031247519.1|2867950_2869966_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001738714.1|2869967_2870180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001738712.1|2870176_2871046_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	81.0	1.9e-130
WP_001738711.1|2871036_2871270_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_001738709.1|2871337_2871739_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	65.4	1.6e-47
WP_001738708.1|2871738_2872167_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	58.2	4.9e-31
WP_001738705.1|2872361_2872865_-	phage protein	NA	F1BUN6	Cronobacter_phage	72.5	4.5e-60
WP_024137081.1|2872902_2873106_-	hypothetical protein	NA	F1BUN7	Cronobacter_phage	57.4	9.2e-12
WP_024137082.1|2873251_2873818_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	59.1	3.7e-66
WP_001738703.1|2873817_2874849_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	84.9	1.6e-173
WP_001738702.1|2874851_2875829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124715.1|2876169_2877366_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.9	1.4e-107
WP_001238818.1|2877369_2879067_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_000628291.1|2879053_2879287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200483.1|2879273_2879822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562051.1|2879824_2880085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071737793.1|2880389_2880575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210082.1|2880538_2881105_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	4.1e-57
WP_000984209.1|2881121_2881364_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_000149860.1|2881360_2882098_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
WP_015701354.1|2882898_2883450_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_001216603.1|2883446_2883674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795388.1|2883670_2883991_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783717.1|2884005_2886339_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.7	0.0e+00
WP_001542208.1|2886830_2887895_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_001542209.1|2887908_2888076_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_010989063.1|2888122_2888716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|2889105_2890299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161781.1|2890633_2891461_-	hypothetical protein	NA	NA	NA	NA	NA
2890929:2890944	attL	ACAAACATATATTCTT	NA	NA	NA	NA
WP_000701821.1|2891911_2892127_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520307.1|2892162_2894232_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_001520831.1|2894734_2896018_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010989064.1|2896062_2896881_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_010989065.1|2897034_2897391_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000749979.1|2897485_2897770_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_000480483.1|2897882_2898404_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000973738.1|2898400_2898775_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001098984.1|2898771_2899752_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001033832.1|2899762_2900776_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000889012.1|2901070_2902273_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000776032.1|2902346_2902982_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_001682344.1|2903005_2903569_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000811366.1|2903568_2904411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819716.1|2904540_2906082_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000021514.1|2906304_2907984_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000088556.1|2909100_2909976_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_001521074.1|2910141_2912016_+	membrane protein	NA	NA	NA	NA	NA
WP_010989066.1|2912275_2913559_-	membrane protein	NA	NA	NA	NA	NA
WP_001738699.1|2914136_2914733_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	90.8	7.7e-99
2918961:2918976	attR	AAGAATATATGTTTGT	NA	NA	NA	NA
>prophage 10
NZ_CP029840	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 chromosome, complete genome	4870227	4431419	4451839	4870227	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4431419_4432148_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4432344_4432635_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4432883_4433339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4433335_4433941_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4433945_4435691_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4435693_4436326_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4436318_4437434_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4437424_4437784_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4437947_4439495_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4439494_4440424_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4440420_4440783_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4441110_4441833_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4441842_4442886_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4442873_4443083_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4443082_4444036_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|4444035_4446390_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4446486_4446615_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4446574_4446892_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4446943_4447468_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4447467_4448895_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4448884_4449082_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4449078_4449534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4449693_4450008_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4450020_4450626_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4450628_4450916_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4451491_4451839_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP029841	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence	145369	0	12622	145369		Enterobacteria_phage(100.0%)	12	NA	NA
WP_001526823.1|2600_2801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000979451.1|2949_3252_+	transcriptional regulator PefB	NA	NA	NA	NA	NA
WP_000748205.1|3526_4045_+	major pilin PefA	NA	NA	NA	NA	NA
WP_000007893.1|4272_6681_+	outer membrane usher protein PefC	NA	NA	NA	NA	NA
WP_001038510.1|6673_7366_+	fimbrial chaperone PefD	NA	NA	NA	NA	NA
WP_010999940.1|7380_7938_+	membrane protein	NA	NA	NA	NA	NA
WP_014343944.1|8190_9066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000004313.1|9497_9710_+	transcriptional regulator PefI	NA	NA	NA	NA	NA
WP_001526811.1|9694_10045_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000178592.1|10289_10943_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010999938.1|11075_11975_+	YjiK family protein	NA	NA	NA	NA	NA
WP_000725062.1|12064_12622_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	38.5	4.5e-24
>prophage 2
NZ_CP029841	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence	145369	18251	18992	145369		Xanthomonas_phage(100.0%)	1	NA	NA
WP_000177629.1|18251_18992_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	3.9e-07
>prophage 3
NZ_CP029841	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence	145369	36844	37264	145369		Salmonella_phage(100.0%)	1	NA	NA
WP_001229397.1|36844_37264_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	88.9	2.2e-68
>prophage 4
NZ_CP029841	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence	145369	43733	43955	145369		Vibrio_virus(100.0%)	1	NA	NA
WP_001278699.1|43733_43955_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	42.3	1.0e-08
>prophage 5
NZ_CP029841	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence	145369	54188	58118	145369		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_000117513.1|54188_56186_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.0	5.5e-16
WP_000131520.1|56254_56497_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000741240.1|56551_57070_-	single-stranded DNA-binding protein SSB2	NA	A0A0A0P1Q9	Enterobacteria_phage	82.5	6.8e-51
WP_015059457.1|57100_57229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015983.1|57794_58118_-	hypothetical protein	NA	G8C7V1	Escherichia_phage	56.5	2.0e-13
>prophage 6
NZ_CP029841	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence	145369	61310	67847	145369	transposase	Salmonella_phage(40.0%)	8	NA	NA
WP_000088645.1|61310_61991_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000091632.1|62135_62324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|62372_62729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|62721_63192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|63702_64125_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|64124_65399_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_140238275.1|65480_66392_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.6	1.5e-82
WP_000608644.1|66584_67847_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 7
NZ_CP029841	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence	145369	79667	127868	145369	transposase,integrase	Escherichia_phage(23.08%)	59	77940:77956	135945:135961
77940:77956	attL	GCATATTGATATGTCCG	NA	NA	NA	NA
WP_001067855.1|79667_80372_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001317507.1|80780_81254_-	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_000845048.1|81409_82423_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|82625_82976_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|83151_83712_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|83715_86682_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_000844627.1|86739_86982_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000470728.1|87013_87691_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|87769_88969_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|89000_89885_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|90022_90415_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000203199.1|92241_92886_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	28.3	9.8e-07
WP_000864791.1|93180_93801_+	ParA family protein	NA	A2I303	Vibrio_virus	33.8	1.1e-18
WP_000051063.1|93852_94083_+	partitioning protein	NA	NA	NA	NA	NA
WP_032197329.1|94245_94410_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_012262102.1|94414_94594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072040294.1|94596_94821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040121203.1|94844_95441_+	YcxB family protein	NA	NA	NA	NA	NA
WP_106372024.1|95492_95918_-	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
WP_001074380.1|95988_96432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435061.1|96435_97278_-	replication initiation protein	NA	NA	NA	NA	NA
WP_021526660.1|97298_98138_-	replication initiation protein	NA	NA	NA	NA	NA
WP_001532157.1|98076_98307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121743.1|99370_99622_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000220560.1|99611_99893_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
WP_001181906.1|100038_100362_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	46.1	2.7e-13
WP_000356542.1|100409_100655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180117.1|100644_100860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866654.1|100952_101282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021526659.1|101324_101504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000160399.1|101735_102008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000757693.1|102333_102879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001505431.1|102881_104048_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001446885.1|104400_104919_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000125172.1|104848_105061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953529.1|105093_105741_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000916182.1|105718_106015_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_001328100.1|106033_108787_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_000744210.1|108797_109556_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_000835348.1|109556_109784_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_000513459.1|109793_110927_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_058330412.1|111171_111885_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000783372.1|111889_112819_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000139139.1|112815_114021_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_001058465.1|114022_115054_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_001505433.1|115056_116892_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_012301136.1|116888_117302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001576896.1|117298_117601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024169915.1|117606_117864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427676.1|117958_119164_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|119578_120520_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|120551_121118_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|121174_121510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|121693_122110_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001247118.1|122195_123311_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001135407.1|123569_124058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541566.1|124712_125453_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_001240331.1|125659_126220_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.7	1.3e-31
WP_000098783.1|126203_127868_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
135945:135961	attR	GCATATTGATATGTCCG	NA	NA	NA	NA
>prophage 8
NZ_CP029841	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence	145369	131727	131892	145369		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|131727_131892_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 9
NZ_CP029841	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence	145369	137314	137665	145369		Escherichia_phage(100.0%)	1	NA	NA
WP_001541541.1|137314_137665_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 10
NZ_CP029841	Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence	145369	140734	141517	145369	integrase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_000082169.1|140734_141517_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
