The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029454	Bacillus cereus strain FORC087 chromosome, complete genome	5271204	254297	262245	5271204		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|254297_254582_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|254620_256255_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_000743906.1|256661_258200_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_000833096.1|258585_259911_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_087964884.1|260054_260756_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	1.6e-39
WP_000719210.1|260739_262245_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.0	7.8e-31
>prophage 2
NZ_CP029454	Bacillus cereus strain FORC087 chromosome, complete genome	5271204	306808	315184	5271204		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|306808_308116_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|308204_308924_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|308916_309171_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666787.1|309167_309851_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_016111304.1|309834_312054_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.0	2.6e-163
WP_000879032.1|312038_313454_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.2	4.3e-55
WP_001262439.1|313559_314600_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088596.1|314596_315184_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	4.5e-27
>prophage 3
NZ_CP029454	Bacillus cereus strain FORC087 chromosome, complete genome	5271204	1824318	1832470	5271204		Bacillus_phage(66.67%)	7	NA	NA
WP_000755525.1|1824318_1825599_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
WP_087968019.1|1825698_1826463_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453861.1|1826703_1828464_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	2.4e-273
WP_000612414.1|1828550_1829228_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_001231621.1|1829224_1830298_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.1e-187
WP_000818979.1|1830587_1831307_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_087968017.1|1831597_1832470_+	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	44.8	1.3e-65
>prophage 4
NZ_CP029454	Bacillus cereus strain FORC087 chromosome, complete genome	5271204	2454221	2526194	5271204	integrase,tail,terminase,head,capsid,protease,bacteriocin,holin,portal	Bacillus_phage(73.33%)	81	2466846:2466866	2531612:2531632
WP_001071364.1|2454221_2454542_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_098290865.1|2455031_2455517_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_061139255.1|2455826_2456498_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_061139254.1|2456566_2457676_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	78.8	4.9e-147
WP_139894484.1|2458322_2459531_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	44.9	1.2e-79
WP_071740166.1|2459527_2459713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425256.1|2459973_2460324_-	helix-turn-helix transcriptional regulator	NA	A0A288WFW4	Bacillus_phage	39.7	7.4e-17
WP_061139252.1|2460507_2460804_+	helix-turn-helix transcriptional regulator	NA	A0A288WG89	Bacillus_phage	46.5	1.1e-08
WP_000522024.1|2461019_2461286_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	90.6	1.6e-35
WP_139894485.1|2461660_2462407_+	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	81.2	1.9e-78
WP_139894486.1|2462345_2463221_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	45.5	2.9e-62
WP_139894487.1|2463236_2463431_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	85.9	1.1e-25
WP_139894488.1|2463447_2463726_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.3	8.7e-13
WP_139894489.1|2463718_2464078_+	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	52.5	2.4e-31
WP_089171096.1|2464096_2464264_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	66.0	2.3e-13
WP_139894490.1|2464289_2464541_+	helix-turn-helix domain containing protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	3.8e-07
WP_139894491.1|2464560_2465016_+	nucleotide pyrophosphohydrolase	NA	A0A0U4IBD0	Bacillus_phage	50.9	1.2e-22
WP_139894492.1|2465229_2465955_-	exosporium leader peptide-containing protein	NA	A0A288WFW9	Bacillus_phage	39.8	1.9e-19
WP_139894493.1|2466136_2466496_-	septum formation initiator family protein	NA	NA	NA	NA	NA
2466846:2466866	attL	AACAAAAACGTTATTTGAATA	NA	NA	NA	NA
WP_065212698.1|2467017_2467212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139894494.1|2467740_2467986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894495.1|2469247_2469463_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	85.9	6.3e-27
WP_139894496.1|2469694_2469892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894497.1|2470206_2470671_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	81.8	4.6e-67
WP_139894498.1|2471702_2473241_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_139894724.1|2473267_2473390_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_098522156.1|2473697_2474171_+	ArpU family transcriptional regulator	NA	A0A1B1P7X5	Bacillus_phage	96.2	4.1e-79
WP_098522155.1|2474167_2474710_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	98.9	1.0e-94
WP_098522154.1|2475051_2475900_-	DUF346 domain-containing protein	NA	NA	NA	NA	NA
WP_139894499.1|2476253_2476451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894500.1|2476443_2476827_+	hypothetical protein	NA	A0A1B1P7Q2	Bacillus_phage	70.3	3.5e-20
WP_048567684.1|2476827_2477040_+	hypothetical protein	NA	H0USV9	Bacillus_phage	98.6	2.1e-30
WP_048567683.1|2477176_2477431_+	hypothetical protein	NA	H0USW0	Bacillus_phage	90.5	1.3e-39
WP_086403181.1|2477420_2477798_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	84.8	3.4e-60
WP_086691942.1|2477927_2478431_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J8E3	uncultured_Caudovirales_phage	98.8	1.1e-87
WP_139894501.1|2478432_2480127_+|terminase	terminase large subunit	terminase	H0USW3	Bacillus_phage	97.2	3.1e-310
WP_139894502.1|2480315_2481569_+|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	97.1	4.1e-235
WP_139894503.1|2481555_2482266_+|protease	Clp protease ClpP	protease	A0A2H4JC29	uncultured_Caudovirales_phage	96.6	8.2e-124
WP_139894504.1|2482303_2483476_+|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	91.3	3.5e-196
WP_139894505.1|2483496_2483793_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	97.9	3.0e-43
WP_139894506.1|2483770_2484094_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	94.4	7.0e-54
WP_139894507.1|2484086_2484521_+	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	95.1	3.7e-74
WP_098522148.1|2484517_2484877_+	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	95.8	6.1e-59
WP_097820525.1|2484877_2485483_+|tail	phage tail protein	tail	A0A0S2GLI0	Bacillus_phage	94.5	2.9e-93
WP_075717239.1|2485531_2485849_+	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	93.3	3.5e-50
WP_139894508.1|2486070_2487387_+|tail	phage tail tape measure protein	tail	A0A0S2GLG8	Bacillus_phage	92.9	9.8e-163
WP_139894509.1|2487567_2490186_+|tail	phage tail tape measure protein	tail	A0A2H4J380	uncultured_Caudovirales_phage	93.2	5.3e-253
WP_098770087.1|2490200_2491682_+|tail	phage tail protein	tail	H0USX4	Bacillus_phage	92.1	2.2e-275
WP_139894510.1|2491678_2495710_+	hypothetical protein	NA	W8CYT7	Bacillus_phage	88.8	0.0e+00
WP_000390479.1|2495837_2496062_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	8.5e-27
WP_139894511.1|2496137_2496563_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	93.6	8.5e-68
WP_139894512.1|2496562_2497384_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	85.6	6.4e-144
WP_033667424.1|2498112_2498376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894513.1|2498611_2499397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000626123.1|2499941_2501624_+	RNAseH domain-containing protein	NA	NA	NA	NA	NA
WP_000732183.1|2501831_2502599_+	DUF3959 family protein	NA	NA	NA	NA	NA
WP_000905571.1|2502738_2503155_+	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_000878372.1|2503275_2503479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416828.1|2503807_2504020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565683.1|2504228_2505233_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000282680.1|2505378_2505783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000062127.1|2505943_2507179_+	cytochrome P450	NA	NA	NA	NA	NA
WP_071686438.1|2507240_2507423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106392.1|2507446_2508730_+	MFS transporter	NA	NA	NA	NA	NA
WP_001069249.1|2508719_2509352_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.1	1.6e-25
WP_000046095.1|2509422_2509578_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_000289122.1|2509680_2510178_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000168014.1|2510318_2511533_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000954437.1|2511641_2512220_+	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_000766385.1|2512395_2513247_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_139894514.1|2513698_2515486_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000743768.1|2515720_2517847_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_030025712.1|2517923_2518454_+	signal peptidase I	NA	NA	NA	NA	NA
WP_000932142.1|2518713_2519901_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	24.6	2.4e-06
WP_000864394.1|2519980_2520661_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_001038208.1|2521070_2521619_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_139894515.1|2521629_2523330_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	29.0	4.0e-15
WP_000556377.1|2523322_2524123_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2524259_2524367_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_139894516.1|2524468_2525728_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	1.6e-24
WP_083320215.1|2525861_2526194_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	49.5	1.2e-16
2531612:2531632	attR	AACAAAAACGTTATTTGAATA	NA	NA	NA	NA
>prophage 5
NZ_CP029454	Bacillus cereus strain FORC087 chromosome, complete genome	5271204	2532971	2539620	5271204		Bacillus_phage(42.86%)	10	NA	NA
WP_001139345.1|2532971_2533187_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	83.8	3.4e-25
WP_000369348.1|2533423_2533555_+	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	79.1	2.9e-11
WP_000097509.1|2533919_2534720_+	C1 family peptidase	NA	A0A2K9L1Z4	Tupanvirus	37.2	1.0e-37
WP_002005147.1|2534739_2534952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002061469.1|2535016_2535217_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	90.9	1.0e-15
WP_139894518.1|2535354_2536236_-	protein kinase	NA	NA	NA	NA	NA
WP_000372690.1|2536363_2536873_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	36.0	1.4e-16
WP_000411453.1|2536990_2537521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163828.1|2537533_2538208_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.7	2.8e-28
WP_087966411.1|2538204_2539620_+	HAMP domain-containing histidine kinase	NA	A0A1V0SKH0	Klosneuvirus	23.1	8.2e-06
>prophage 6
NZ_CP029454	Bacillus cereus strain FORC087 chromosome, complete genome	5271204	3528472	3538993	5271204	bacteriocin	Bacillus_phage(45.45%)	14	NA	NA
WP_000413738.1|3528472_3529093_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_087967682.1|3529185_3529989_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000031383.1|3529989_3530532_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102627.1|3530524_3530848_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000392443.1|3531220_3531451_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	77.6	1.7e-25
WP_087967680.1|3531512_3532415_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	48.1	2.0e-74
WP_087967678.1|3532690_3533533_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	45.5	9.7e-31
WP_139894728.1|3533689_3534676_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	43.3	4.9e-34
WP_087967674.1|3534914_3535301_-	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	70.6	2.2e-46
WP_048567460.1|3535709_3536597_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	66.6	7.4e-98
WP_001189064.1|3536749_3536944_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	71.0	5.9e-16
WP_048567458.1|3536955_3537714_-	antirepressor	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	69.8	5.4e-97
WP_000283431.1|3537916_3538129_-	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_033683142.1|3538333_3538993_+	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	8.7e-35
>prophage 7
NZ_CP029454	Bacillus cereus strain FORC087 chromosome, complete genome	5271204	3611632	3712814	5271204	integrase,tail,terminase,head,capsid,protease,portal,holin,tRNA,coat	Bacillus_phage(54.35%)	104	3641675:3641691	3687577:3687593
WP_001288799.1|3611632_3612175_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_000870461.1|3612302_3612734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005389.1|3612737_3614267_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000190155.1|3614697_3615564_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_000625417.1|3615550_3617308_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_087967635.1|3617497_3618421_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_000404341.1|3618479_3618740_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_001221095.1|3618889_3619684_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000204911.1|3619846_3621409_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_001115373.1|3621890_3622316_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	68.9	2.7e-45
WP_087967633.1|3622581_3623205_-	topoisomerase I	NA	NA	NA	NA	NA
WP_000990688.1|3624055_3625294_-	competence/damage-inducible protein CinA	NA	NA	NA	NA	NA
WP_001052967.1|3625314_3625893_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000137476.1|3625957_3626869_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|3626890_3627676_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_000114450.1|3627814_3628063_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_000759606.1|3628138_3628852_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_139894622.1|3628952_3630239_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.9	2.9e-10
WP_000772405.1|3630239_3631514_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.1	1.2e-56
WP_000008857.1|3631723_3632683_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001085254.1|3632683_3633742_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000456908.1|3633734_3635267_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.6	2.8e-12
WP_000725771.1|3635384_3636470_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000114182.1|3636562_3637288_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071686378.1|3637734_3637884_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_001118776.1|3637825_3640207_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_000605020.1|3640419_3640623_-	ribonuclease	NA	NA	NA	NA	NA
WP_000139806.1|3640619_3641369_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_000823096.1|3641470_3643141_-	ribonuclease J	NA	NA	NA	NA	NA
3641675:3641691	attL	TGAAATGATTTCTGGAC	NA	NA	NA	NA
WP_000564763.1|3643877_3644756_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000692451.1|3644767_3646000_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000414846.1|3646023_3647070_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_139894623.1|3647220_3647475_-	dipicolinate synthase	NA	NA	NA	NA	NA
WP_098963450.1|3647770_3648046_+	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
WP_139894624.1|3648087_3648450_+	DUF3958 family protein	NA	NA	NA	NA	NA
WP_001108706.1|3649961_3650387_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_016118526.1|3651138_3651645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894625.1|3651843_3652653_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	90.0	6.9e-151
WP_139894626.1|3652652_3653078_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	95.7	2.4e-70
WP_098794702.1|3653164_3653926_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_098794703.1|3654071_3654437_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	57.4	1.4e-34
WP_139894627.1|3654453_3658773_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	63.7	0.0e+00
WP_139894628.1|3658769_3660239_-|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	77.9	8.8e-229
WP_139894629.1|3660280_3663907_-	DUF2207 domain-containing protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	85.5	4.0e-182
WP_000415912.1|3664140_3664503_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	2.4e-42
WP_001004907.1|3664507_3665095_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	82.1	5.1e-87
WP_065845257.1|3665095_3665431_-	hypothetical protein	NA	D2XR22	Bacillus_phage	90.8	1.5e-51
WP_065845256.1|3665427_3665772_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	78.8	3.1e-44
WP_139894630.1|3665773_3666127_-|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	91.4	2.8e-56
WP_000450783.1|3666128_3666422_-	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	87.6	3.8e-43
WP_097877224.1|3666427_3667579_-|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	96.1	1.3e-208
WP_139894631.1|3667582_3668326_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	84.2	5.4e-110
WP_065845253.1|3668325_3669471_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	82.2	1.1e-181
WP_086389440.1|3669479_3671147_-|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	90.3	4.2e-304
WP_000301142.1|3671143_3671455_-|terminase	terminase	terminase	D2XR14	Bacillus_phage	98.1	7.9e-47
WP_139894632.1|3671578_3671914_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	95.5	1.7e-55
WP_139894633.1|3671910_3672315_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	52.5	5.1e-30
WP_139894634.1|3672595_3673471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139894635.1|3673537_3673726_-	ATPase	NA	NA	NA	NA	NA
WP_139894636.1|3674158_3674812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000434821.1|3675420_3675621_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	2.4e-20
WP_050822079.1|3675741_3676284_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	5.0e-89
WP_050822080.1|3676283_3676748_-	ArpU family transcriptional regulator	NA	D2XR57	Bacillus_phage	92.9	3.0e-74
WP_050822081.1|3677030_3677330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015945882.1|3677730_3678399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281634.1|3678295_3678574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139894637.1|3678623_3678845_-	hypothetical protein	NA	A0A1U9WQL9	Geobacillus_phage	54.3	3.1e-13
WP_139894638.1|3679531_3679909_+	DUF1093 domain-containing protein	NA	A0A0K2CYS5	Paenibacillus_phage	41.5	3.3e-15
WP_139894639.1|3680050_3680236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137000112.1|3680250_3680436_-	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	62.3	4.3e-16
WP_000512857.1|3680474_3680666_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	61.9	1.1e-14
WP_139894640.1|3680738_3681101_-	cell division protein SepF	NA	D2XR47	Bacillus_phage	90.0	2.4e-55
WP_000926798.1|3681075_3681264_-	hypothetical protein	NA	D2XR45	Bacillus_phage	85.5	9.7e-16
WP_139894641.1|3681271_3682594_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	95.5	1.8e-236
WP_139894642.1|3682590_3683541_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	58.1	4.6e-69
WP_043937853.1|3683821_3684106_-	hypothetical protein	NA	D2XR42	Bacillus_phage	54.3	4.3e-23
WP_139894643.1|3684288_3684510_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_000537278.1|3684523_3685111_-	hypothetical protein	NA	D2XR41	Bacillus_phage	69.2	8.4e-74
WP_097854400.1|3685201_3685450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058839516.1|3685505_3685697_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000172329.1|3685865_3686276_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	53.8	1.1e-32
WP_097999623.1|3686288_3686723_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	77.8	6.7e-60
WP_139894644.1|3686763_3687396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894645.1|3687722_3688469_+	hypothetical protein	NA	A0A1C8E993	Bacillus_phage	65.1	2.7e-53
3687577:3687593	attR	TGAAATGATTTCTGGAC	NA	NA	NA	NA
WP_139894646.1|3688533_3689457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894647.1|3689542_3691090_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.6	2.7e-143
WP_000954735.1|3691544_3692447_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_087967427.1|3692617_3692869_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000592989.1|3693003_3694245_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	4.4e-56
WP_087967425.1|3694331_3695231_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000076737.1|3695385_3697524_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001229392.1|3697684_3697954_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_000766704.1|3698054_3699026_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	32.7	2.5e-06
WP_087967423.1|3699069_3699993_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000776437.1|3700079_3700436_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000582367.1|3700451_3700733_-	DUF503 family protein	NA	NA	NA	NA	NA
WP_000036343.1|3700729_3702790_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.9	3.8e-20
WP_001286524.1|3702794_3703106_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000071127.1|3703106_3703379_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000102604.1|3703390_3704497_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000359096.1|3704514_3704985_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_087967422.1|3705321_3709623_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	39.6	4.1e-24
WP_000814299.1|3709747_3711448_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001090243.1|3711557_3712814_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 8
NZ_CP029454	Bacillus cereus strain FORC087 chromosome, complete genome	5271204	4366720	4374405	5271204		Staphylococcus_phage(16.67%)	9	NA	NA
WP_000221066.1|4366720_4367644_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
WP_049107067.1|4367769_4368705_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	1.2e-21
WP_000018029.1|4368706_4369399_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.4e-06
WP_001014310.1|4369741_4369936_+	YwbE family protein	NA	NA	NA	NA	NA
WP_087875794.1|4369974_4371174_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	3.6e-71
WP_000587818.1|4371468_4371792_+	heme oxygenase	NA	NA	NA	NA	NA
WP_001086123.1|4371864_4372629_-	class B sortase	NA	NA	NA	NA	NA
WP_044306745.1|4372661_4373432_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	7.6e-14
WP_001036848.1|4373421_4374405_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.1e-17
>prophage 1
NZ_CP029455	Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence	512032	177833	234428	512032	portal,terminase,protease,transposase	Bacillus_phage(43.33%)	61	NA	NA
WP_098488162.1|177833_178232_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	69.7	1.4e-51
WP_139894854.1|178243_179356_+	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	47.5	1.1e-79
WP_087966401.1|180330_180705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087966399.1|181120_181444_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087966397.1|181712_182003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087966395.1|182022_182457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087966393.1|182548_183130_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_087966391.1|183653_184538_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_087966389.1|185273_186071_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HRV8	Bacillus_phage	39.8	9.2e-31
WP_087966387.1|186119_186380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075312952.1|186466_186688_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	45.2	1.4e-10
WP_087966385.1|186977_187298_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	62.3	1.2e-29
WP_087966383.1|187313_188480_+	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	79.6	1.3e-179
WP_087966402.1|188502_189078_+	hypothetical protein	NA	W8CZ47	Bacillus_phage	75.5	1.7e-82
WP_087966381.1|190100_191915_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	35.4	1.4e-42
WP_087966378.1|192505_193012_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_139894856.1|193254_194187_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_087965305.1|194956_195850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080495052.1|196020_196497_+	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	43.3	1.8e-29
WP_087965304.1|197210_198539_+	nucleotide sugar dehydrogenase	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	29.9	1.5e-38
WP_087965302.1|198547_199705_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	33.1	5.8e-42
WP_087965300.1|199711_200635_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.0	3.2e-27
WP_087965298.1|200609_201851_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2P1ELT3	Moumouvirus	38.1	2.6e-16
WP_098284853.1|201862_202744_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_074593164.1|202747_203437_+	WbqC family protein	NA	NA	NA	NA	NA
WP_071732404.1|203443_204121_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_087965311.1|204132_205068_+	endonuclease	NA	NA	NA	NA	NA
WP_087965294.1|205200_206574_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_087965292.1|206681_207956_+	MFS transporter	NA	NA	NA	NA	NA
WP_087965290.1|208124_208592_-	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_087965288.1|208945_210592_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	23.8	2.3e-07
WP_087965286.1|210802_211150_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	33.6	2.5e-09
WP_000577226.1|211519_211927_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000787540.1|211916_212330_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_087965284.1|212853_213339_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_087965282.1|214320_216063_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.5	3.5e-06
WP_001167049.1|216229_216445_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	70.1	1.7e-19
WP_084065910.1|216514_216934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000482313.1|217628_218033_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_087965280.1|218884_219178_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000834513.1|220269_220914_-	helix-turn-helix domain-containing protein	NA	A0A2H4J245	uncultured_Caudovirales_phage	34.3	1.1e-29
WP_000549412.1|221051_221258_+	transcriptional regulator	NA	W8CYN7	Bacillus_phage	51.7	1.8e-10
WP_000231991.1|221776_222061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000096618.1|222139_222904_+	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	49.2	3.6e-56
WP_000251926.1|222938_223670_+	ATP-binding protein	NA	U5PWH5	Bacillus_phage	37.0	1.7e-31
WP_098842613.1|223860_224475_+	hypothetical protein	NA	X2JKZ4	Bacillus_phage	28.2	1.1e-07
WP_000765291.1|224479_224656_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_000931946.1|224733_225105_+	hypothetical protein	NA	A0A0M4R397	Bacillus_phage	42.9	1.0e-16
WP_139894858.1|225387_225888_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0A7AQW8	Bacillus_phage	60.4	2.2e-46
WP_087965276.1|226119_226305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087965274.1|226322_226814_+	hypothetical protein	NA	A0A1B0XTP0	Freshwater_phage	22.8	2.4e-05
WP_087965272.1|226994_228251_+|terminase	phage terminase large subunit	terminase	A0A2H4J7G6	uncultured_Caudovirales_phage	51.3	1.3e-111
WP_000229504.1|228344_229685_+|portal	phage portal protein	portal	A0A222YY66	Streptomyces_phage	28.6	2.9e-45
WP_086391823.1|229713_230904_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	30.1	1.9e-35
WP_001060157.1|230924_231905_+	hypothetical protein	NA	H7BVA6	unidentified_phage	41.6	1.6e-69
WP_000691127.1|231921_232086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087965267.1|232099_232633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000392020.1|232661_232988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033668458.1|232989_233406_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_000208342.1|233402_233819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000118565.1|233831_234428_+	hypothetical protein	NA	A0A1S5S9Y8	Streptococcus_phage	30.3	1.0e-13
>prophage 2
NZ_CP029455	Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence	512032	289960	368553	512032	protease,transposase	Bacillus_phage(28.57%)	58	NA	NA
WP_139894882.1|289960_291082_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.5	4.0e-173
WP_139894884.1|291254_291929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000219733.1|292812_293109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139894886.1|294472_295474_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	28.2	1.3e-21
WP_139894888.1|295562_296843_-	MFS transporter	NA	NA	NA	NA	NA
WP_139894890.1|297007_297223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894892.1|297337_298363_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_016135862.1|298794_299793_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_016089984.1|299871_301335_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_139894894.1|301489_303424_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_139894896.1|303546_304443_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_139894897.1|304572_305418_+	class II aldolase	NA	NA	NA	NA	NA
WP_098568360.1|305523_306315_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_064472536.1|306496_307381_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_139894898.1|308502_308931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097813728.1|309313_310249_+	DUF3994 domain-containing protein	NA	NA	NA	NA	NA
WP_097813729.1|310559_310919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098568371.1|311102_311348_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139894899.1|311540_312299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097813731.1|312318_312909_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_000760020.1|313119_313545_+	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_000675540.1|315569_316169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206464.1|316329_316557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894900.1|317596_318670_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	41.5	5.3e-74
WP_000709206.1|318666_318792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098568401.1|318943_319333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000473786.1|320120_320555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000503058.1|320774_321044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097814511.1|321460_321949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161901.1|322321_322696_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	47.9	5.4e-26
WP_000063578.1|322738_323080_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_139894901.1|323076_324369_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.7	2.9e-103
WP_000527914.1|325883_328124_+	hypothetical protein	NA	G1FGA4	Mycobacterium_phage	45.1	1.3e-10
WP_139894902.1|328256_330206_+	DUF3472 domain-containing protein	NA	NA	NA	NA	NA
WP_069604118.1|330530_331079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894903.1|332943_334056_-	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	47.0	2.0e-79
WP_016513590.1|334067_334466_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	4.0e-51
WP_074593111.1|334743_335871_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_097863248.1|335867_336971_-	endospore germination permease	NA	NA	NA	NA	NA
WP_087965806.1|336972_338466_-	spore germination protein	NA	NA	NA	NA	NA
WP_001204221.1|339293_340337_-	Fic family protein	NA	NA	NA	NA	NA
WP_139894904.1|341726_343103_+	chitin-binding protein	NA	G1FGA4	Mycobacterium_phage	39.2	1.3e-08
WP_139894905.1|343280_344696_-	phosphatidylinositol-specific phospholipase C domain-containing protein	NA	NA	NA	NA	NA
WP_139894906.1|345106_345676_-	methyltransferase	NA	NA	NA	NA	NA
WP_087965816.1|346677_347445_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	8.6e-34
WP_139894907.1|347434_349417_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_139894908.1|349498_350170_+	response regulator	NA	NA	NA	NA	NA
WP_139894909.1|350166_351189_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_087965824.1|351623_352856_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	9.6e-19
WP_139894910.1|352860_353553_-	response regulator	NA	NA	NA	NA	NA
WP_139848321.1|354254_355055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097855914.1|355076_355790_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	6.1e-34
WP_139894911.1|355786_358255_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_139848341.1|358251_358407_+	S-layer protein	NA	NA	NA	NA	NA
WP_139894912.1|361326_364017_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.9	1.3e-33
WP_139894913.1|364608_366018_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_139848312.1|365992_366970_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_139894914.1|367431_368553_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.0	2.0e-172
>prophage 3
NZ_CP029455	Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence	512032	402519	444538	512032	integrase,coat,transposase	Bacillus_phage(63.64%)	42	414646:414666	448295:448315
WP_087965550.1|402519_403578_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_087965549.1|403602_404739_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_087965547.1|404891_405995_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_087965546.1|405954_406212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087965544.1|406208_406442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087965542.1|406452_406557_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_087965540.1|406925_407375_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_139894925.1|407423_407552_-	helix-turn-helix domain-containing protein	NA	S6AND0	Bacillus_phage	78.4	5.4e-10
WP_069604262.1|407873_408665_-	ADP-ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	37.7	1.6e-27
WP_046960447.1|408893_409319_-	DUF4879 domain-containing protein	NA	NA	NA	NA	NA
WP_048538634.1|409977_410523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048538635.1|410527_411127_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_139894926.1|411311_412748_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000791800.1|413904_414264_+	DUF3796 domain-containing protein	NA	NA	NA	NA	NA
WP_001128819.1|414253_414454_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
414646:414666	attL	ATCAAGCTAACAAAACAAAAT	NA	NA	NA	NA
WP_071729452.1|414751_415222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139848288.1|415223_415421_-	helix-turn-helix domain-containing protein	NA	A0A1B1IRF4	uncultured_Mediterranean_phage	48.4	2.8e-05
WP_087965585.1|415626_415743_+	DUF5065 family protein	NA	NA	NA	NA	NA
WP_087965532.1|415944_416124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824729.1|416870_417368_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_087965530.1|417466_418525_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.6	1.8e-29
WP_087965528.1|418521_419235_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.3	3.7e-39
WP_065705848.1|420080_420425_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_139894927.1|421215_423072_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_139894928.1|423170_423536_+	YxeA family protein	NA	NA	NA	NA	NA
WP_065705841.1|425767_426529_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.9e-33
WP_087954697.1|426571_426919_-	YxeA family protein	NA	NA	NA	NA	NA
WP_087965519.1|427212_428109_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_087965517.1|428130_428256_-	fibronectin	NA	NA	NA	NA	NA
WP_087965515.1|428658_429210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705835.1|429496_429748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139848281.1|430017_431433_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_139848279.1|431432_432494_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_065705829.1|432508_432946_-	DUF441 family protein	NA	NA	NA	NA	NA
WP_139848340.1|432960_433827_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_087965507.1|433840_434689_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_139848277.1|435896_437447_+	mosquitocidal toxin protein	NA	Q38196	Clostridium_botulinum_phage	39.2	1.4e-06
WP_139848275.1|437766_438846_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	36.4	1.9e-31
WP_139848273.1|438842_439556_-	response regulator	NA	W8CYM9	Bacillus_phage	38.3	5.1e-41
WP_139894929.1|439941_442140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087965498.1|442808_443027_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	66.2	3.5e-17
WP_087965496.1|443365_444538_-|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	24.4	4.0e-06
448295:448315	attR	ATCAAGCTAACAAAACAAAAT	NA	NA	NA	NA
>prophage 1
NZ_CP029456	Bacillus cereus strain FORC087 plasmid pFORC087.2, complete sequence	80835	28484	72508	80835	integrase,protease,bacteriocin,transposase	Bacillus_phage(28.57%)	42	24415:24431	62550:62566
24415:24431	attL	TAATAAAGGATTTTCCT	NA	NA	NA	NA
WP_139894974.1|28484_29918_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_139894975.1|30238_31165_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P793	Bacillus_phage	45.3	1.4e-70
WP_139894976.1|31249_31459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074569871.1|32224_33229_-	Replicase RepFR55	NA	NA	NA	NA	NA
WP_139894977.1|33719_34874_+	helix-turn-helix domain-containing protein	NA	A0A1B1P895	Bacillus_phage	23.2	3.6e-20
WP_023523901.1|35355_35739_-	helix-turn-helix transcriptional regulator	NA	A0A1J0MG99	Staphylococcus_phage	39.4	6.8e-08
WP_000881199.1|35876_36113_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_139895014.1|36401_38819_+	Cys-Gln thioester bond-forming surface protein	NA	NA	NA	NA	NA
WP_139894978.1|38854_39040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074569874.1|39346_39586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894979.1|39618_42420_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_139894980.1|42425_43268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894981.1|43272_43485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894982.1|43496_43751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894983.1|43764_44742_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_000281809.1|44751_45003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894984.1|45030_45582_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_139894985.1|45541_48112_+	recombinase RmuC	NA	A0A1S5SF64	Streptococcus_phage	28.6	1.1e-85
WP_139894986.1|48170_48680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894987.1|48676_51319_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_139894988.1|51375_51774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894989.1|51801_52929_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2D0ZM66	Rhodococcus_phage	41.4	3.3e-18
WP_139894990.1|52953_53538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894991.1|53556_53877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086391941.1|53902_54199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894992.1|54325_54646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894993.1|54677_54890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139894994.1|55169_56327_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_139894995.1|56536_57457_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_139894996.1|58079_59156_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_139894997.1|60333_61287_+	collagen-like protein	NA	NA	NA	NA	NA
WP_139894998.1|62451_62961_+	DUF4367 domain-containing protein	NA	NA	NA	NA	NA
62550:62566	attR	TAATAAAGGATTTTCCT	NA	NA	NA	NA
WP_139894999.1|63208_64252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139895000.1|64310_64715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098512216.1|65580_66783_+	replication initiation protein	NA	E5FFJ0	Burkholderia_phage	25.6	2.0e-13
WP_139895001.1|66905_67310_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_139895002.1|67913_69107_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_139895003.1|69103_69784_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.3	1.2e-34
WP_000054384.1|69780_70980_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_139895004.1|71114_71780_+	DUF1282 family protein	NA	NA	NA	NA	NA
WP_001993458.1|71970_72198_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_139895005.1|72280_72508_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
>prophage 1
NZ_CP029457	Bacillus cereus strain FORC087 plasmid pFORC087.3, complete sequence	68982	0	18458	68982	holin,tail	Bacillus_phage(61.54%)	21	NA	NA
WP_000907420.1|0_1482_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	87.4	1.0e-261
WP_139895017.1|1478_5840_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	58.5	0.0e+00
WP_058839882.1|5855_6230_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	91.9	4.7e-62
WP_000373885.1|6264_6690_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	96.5	1.4e-70
WP_000540645.1|6689_7508_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	88.6	1.0e-146
WP_000780751.1|7701_7980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098204998.1|8020_8362_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_139895018.1|8358_9624_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	47.9	1.6e-106
WP_000264499.1|9734_9959_-	helix-turn-helix domain-containing protein	NA	A0A1B1P883	Bacillus_phage	82.4	3.7e-30
WP_139895019.1|10271_11570_+	cell division protein FtsK	NA	B3RH36	Bacillus_virus	45.0	7.5e-107
WP_080019657.1|11493_12084_+	hypothetical protein	NA	B3RH37	Bacillus_virus	62.2	4.1e-68
WP_139895020.1|12103_12592_+	hypothetical protein	NA	A6XML4	Bacillus_virus	53.8	6.7e-16
WP_139895021.1|12780_12960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139895022.1|13208_13796_+	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	34.8	6.6e-10
WP_097863165.1|13904_14405_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000820696.1|14467_15406_-	hypothetical protein	NA	V9QKZ6	Oenococcus_phage	37.6	9.5e-11
WP_087965683.1|15783_16137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087965681.1|16300_16612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087965679.1|16709_17060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087965677.1|17260_17635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018642.1|17636_18458_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	44.2	4.4e-52
>prophage 2
NZ_CP029457	Bacillus cereus strain FORC087 plasmid pFORC087.3, complete sequence	68982	39520	65081	68982	portal,terminase,head,tail	Bacillus_phage(78.57%)	40	NA	NA
WP_139895030.1|39520_40747_+	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	77.9	7.0e-179
WP_097821268.1|41211_41568_-	helix-turn-helix transcriptional regulator	NA	A0A288WFW4	Bacillus_phage	40.5	3.1e-15
WP_000693791.1|41760_41955_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_139895031.1|42640_42796_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_139895032.1|42792_43008_-	KTSC domain-containing protein	NA	D2IZW7	Enterococcus_phage	46.4	2.2e-08
WP_058839902.1|43201_43402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139895033.1|43597_44230_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	41.2	2.5e-31
WP_000472843.1|44421_44643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139895034.1|44643_45378_+	DnaD domain protein	NA	A0A1B1P8C4	Bacillus_phage	53.5	4.2e-54
WP_139895043.1|45361_46120_+	ATP-binding protein	NA	U5PWH5	Bacillus_phage	40.3	4.3e-38
WP_139895044.1|46316_46763_+	hypothetical protein	NA	U5PVF9	Bacillus_phage	48.9	3.2e-33
WP_139895035.1|46785_47049_+	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	62.1	2.3e-15
WP_002153818.1|47005_47251_+	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	85.9	4.1e-30
WP_097862704.1|47247_47511_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	60.2	4.4e-22
WP_097862703.1|47524_47938_+	hypothetical protein	NA	A0A1C8E9A7	Bacillus_phage	42.9	6.3e-07
WP_000375383.1|47946_48081_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_139895036.1|48077_48524_+	dUTP diphosphatase	NA	A0A0U3SLD3	Bacillus_phage	87.8	1.3e-66
WP_139895037.1|49094_49850_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0K2CYZ1	Paenibacillus_phage	51.0	3.2e-65
WP_139895038.1|50140_50440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139895039.1|50569_51199_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	60.1	1.7e-48
WP_098205031.1|51337_51724_+	ArpU family transcriptional regulator	NA	A0A1B1P853	Bacillus_phage	45.6	2.0e-23
WP_061660538.1|51784_52123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387493.1|53214_53439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067903.1|53572_53779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018890.1|54202_54778_+	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	41.4	8.1e-29
WP_098601474.1|54911_55226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000265600.1|55377_55599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082682419.1|55617_55815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139895040.1|56196_56955_+	hypothetical protein	NA	D2XPX8	Bacillus_virus	60.3	1.3e-55
WP_098661337.1|56951_58181_+|terminase	PBSX family phage terminase large subunit	terminase	A0A059T7K2	Staphylococcus_phage	61.9	1.5e-144
WP_098522480.1|58193_59618_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	92.9	1.5e-257
WP_098522491.1|59691_60459_+|head	phage head protein	head	A0A0S2MVF0	Bacillus_phage	92.9	1.5e-134
WP_071728189.1|60531_61263_+	DUF4355 domain-containing protein	NA	A0A0A7AQU8	Bacillus_phage	63.1	6.4e-71
WP_000116908.1|61380_62226_+	hypothetical protein	NA	A0A0S2MVF8	Bacillus_phage	88.2	4.1e-138
WP_098005732.1|62269_62581_+	hypothetical protein	NA	A0A0A7AQX9	Bacillus_phage	90.0	8.8e-46
WP_139895041.1|62577_62922_+|head,tail	head-tail adaptor protein	head,tail	A0A0A7AR32	Bacillus_phage	87.7	2.5e-54
WP_097862690.1|62896_63304_+	HK97 gp10 family phage protein	NA	A0A0S2MVE4	Bacillus_phage	95.6	1.7e-65
WP_097862689.1|63309_63672_+	hypothetical protein	NA	A0A0S2MV90	Bacillus_phage	95.0	1.9e-60
WP_139895042.1|64344_64773_+	hypothetical protein	NA	A0A0S2MV94	Bacillus_phage	80.3	4.7e-58
WP_139895045.1|64877_65081_+	hypothetical protein	NA	A0A0S2MV68	Bacillus_phage	89.6	8.3e-29
