The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	0	2532	5302688		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000035654.1|180_2532_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 2
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	8864	9563	5302688		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|8864_9563_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 3
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	22266	23991	5302688		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425657.1|22266_23991_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 4
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	49964	51008	5302688		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|49964_51008_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 5
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	55253	55805	5302688		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|55253_55805_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 6
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	64432	65857	5302688		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|64432_65857_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 7
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	73507	79975	5302688		Mamastrovirus(33.33%)	5	NA	NA
WP_001189601.1|73507_75058_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001349940.1|75104_77495_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|77700_78237_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|78277_78940_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|79048_79975_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 8
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	83237	84140	5302688		Sodalis_phage(100.0%)	1	NA	NA
WP_000339945.1|83237_84140_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 9
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	94046	100852	5302688	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174639.1|94046_95465_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937432.1|95503_96430_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|96466_96922_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|97099_97804_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|97818_98349_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001386587.1|98422_100852_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	8.7e-40
>prophage 10
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	106095	106893	5302688		Planktothrix_phage(100.0%)	1	NA	NA
WP_001386588.1|106095_106893_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.1e-14
>prophage 11
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	112804	113149	5302688		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|112804_113149_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 12
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	117078	118503	5302688	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753945.1|117078_118503_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 13
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	130387	194353	5302688	tRNA,plate,protease,transposase	Flavobacterium_phage(11.11%)	53	NA	NA
WP_001295562.1|130387_131146_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|131158_132016_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001346129.1|132027_133380_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|133409_135842_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|135963_136449_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|136452_137478_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|137582_138038_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|138041_138830_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|138829_139978_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|139974_140571_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|140607_144090_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|144102_145062_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|145160_147302_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|147358_147748_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|147812_149111_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|149159_149420_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|149406_149607_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|149772_150318_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|150314_150737_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239154.1|150750_151461_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|151710_152691_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260716.1|153770_155489_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|155600_156308_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|156304_156709_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|156826_157642_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|157681_158335_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|158327_159359_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|159546_160119_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997043.1|166016_166820_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_000648601.1|166816_167731_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|167971_168772_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211710.1|168849_169620_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|169667_171026_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052751.1|171097_171853_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|171886_172609_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917888.1|172605_173073_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|173137_173869_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|174404_175190_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|175326_175806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|175815_176730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284200.1|176773_177256_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|177279_178632_-	membrane protein	NA	NA	NA	NA	NA
WP_122987046.1|178642_182077_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240544.1|182185_183601_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088873.1|183605_184349_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614396.1|184345_187105_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	9.4e-83
WP_000343303.1|187113_187875_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246421.1|187879_189211_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|189213_189738_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|189734_191015_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|191039_192122_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393853.1|192085_193936_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611748.1|193939_194353_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 14
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	198069	200211	5302688		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103304.1|198069_200211_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	3.7e-26
>prophage 15
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	211127	215046	5302688		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|211127_211706_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|211911_212679_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|212649_213390_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615974.1|213545_213824_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|213826_214087_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543895.1|214272_215046_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 16
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	220097	221264	5302688		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001316884.1|220097_221264_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.1e-31
>prophage 17
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	225941	231719	5302688		Streptococcus_phage(50.0%)	4	NA	NA
WP_000749877.1|225941_226997_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.2e-117
WP_001285288.1|227284_228388_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893256.1|228399_229653_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.3e-95
WP_001273869.1|231167_231719_-	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	3.2e-30
>prophage 18
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	238717	247681	5302688	integrase,transposase	Escherichia_phage(50.0%)	7	NA	NA
WP_000891726.1|238717_240559_+	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.5	1.9e-18
WP_000019440.1|241137_242118_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_072171102.1|242162_242483_+	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	56.6	5.2e-17
WP_032145704.1|242563_243898_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001111349.1|244127_244538_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121356.1|244516_245473_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667068.1|245482_247681_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 19
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	267270	270399	5302688	transposase	Escherichia_phage(50.0%)	3	NA	NA
WP_000019427.1|267270_268251_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
WP_000474077.1|268728_268965_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046293.1|269073_270399_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
>prophage 20
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	275974	286450	5302688	holin	Catovirus(33.33%)	5	NA	NA
WP_001159102.1|275974_277645_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089077.1|277658_279131_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001295527.1|279144_279732_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|279860_281894_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001386603.1|282466_286450_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.0	9.3e-124
>prophage 21
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	298443	302981	5302688		Bacillus_virus(50.0%)	4	NA	NA
WP_000447335.1|298443_299928_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818900.1|299920_300892_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750340.1|300888_301845_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692600.1|301931_302981_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	41.9	8.3e-72
>prophage 22
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	311359	317143	5302688		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000010284.1|311359_313246_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
WP_000076233.1|313671_314931_+	cytosine permease	NA	NA	NA	NA	NA
WP_001295686.1|314920_316204_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_000952476.1|316243_317143_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	5.5e-16
>prophage 23
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	321684	325964	5302688		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177912.1|321684_324759_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.9	0.0e+00
WP_000805913.1|324881_325964_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.2	1.8e-191
>prophage 24
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	331374	333335	5302688		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|331374_332325_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|332321_333335_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 25
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	336515	337625	5302688		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|336515_337625_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 26
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	342922	343690	5302688		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939364.1|342922_343690_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	2.5e-25
>prophage 27
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	350565	351723	5302688		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830737.1|350565_351723_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	6.7e-06
>prophage 28
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	359138	360254	5302688		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|359138_360254_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 29
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	364597	374569	5302688		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|364597_365509_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219342.1|365633_366542_+	fructokinase	NA	NA	NA	NA	NA
WP_001306939.1|366684_367869_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698907.1|367994_371138_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221332.1|371134_372337_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	1.8e-06
WP_000113933.1|372526_373216_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|373273_374569_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 30
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	381521	390502	5302688	tRNA	uncultured_Mediterranean_phage(60.0%)	9	NA	NA
WP_000667319.1|381521_382649_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|382671_383004_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|383031_384879_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|384889_385861_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|385989_386337_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|386513_387398_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000543535.1|388386_388836_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150468.1|388839_389943_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	2.6e-52
WP_001021161.1|390031_390502_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 31
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	414208	419255	5302688	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|414208_414832_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|414957_416232_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|416419_418774_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|418982_419255_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 32
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	422383	423079	5302688		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817251.1|422383_423079_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	2.1e-87
>prophage 33
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	426402	429949	5302688		Bacillus_phage(100.0%)	2	NA	NA
WP_001235599.1|426402_428175_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	8.8e-50
WP_001256174.1|428167_429949_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
>prophage 34
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	438784	441934	5302688		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|438784_441934_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 35
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	448942	457504	5302688		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|448942_449494_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122008.1|449622_451554_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|451606_451936_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|451935_452541_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|452650_454525_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_000261613.1|454645_455350_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250088.1|455585_456548_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801832.1|456544_457504_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
>prophage 36
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	465748	468708	5302688		Escherichia_phage(50.0%)	2	NA	NA
WP_001386622.1|465748_466090_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	73.6	8.7e-39
WP_000078268.1|466203_468708_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.8e-115
>prophage 37
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	473247	473925	5302688		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|473247_473925_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 38
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	477061	485996	5302688		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_001110573.1|477061_477748_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561899.1|477744_480159_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014672.1|480588_484878_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	2.1e-20
WP_000877768.1|484917_485286_+	immunity protein	NA	NA	NA	NA	NA
WP_001306947.1|485285_485996_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.2e-19
>prophage 39
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	491252	493034	5302688		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096878.1|491252_493034_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 40
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	499224	500370	5302688		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|499224_500370_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 41
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	511848	514979	5302688	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912345.1|511848_513234_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143543.1|513269_513791_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|513898_514111_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|514112_514979_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 42
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	531313	541444	5302688		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_001289062.1|531313_536176_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	4.0e-20
WP_001160804.1|536195_536657_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103238.1|536684_538586_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	1.3e-27
WP_000253826.1|539322_540771_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770953.1|540760_541444_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 43
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	544589	547733	5302688		Leptospira_phage(100.0%)	1	NA	NA
WP_000574006.1|544589_547733_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.0	2.4e-58
>prophage 44
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	561860	567903	5302688		Tupanvirus(50.0%)	3	NA	NA
WP_000077698.1|561860_565742_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	2.0e-62
WP_000096715.1|565957_567091_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|567087_567903_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 45
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	582449	584272	5302688		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502952.1|582449_583079_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029812.1|583051_584272_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
>prophage 46
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	587339	589454	5302688		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|587339_588905_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|589025_589454_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 47
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	604879	605526	5302688		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|604879_605089_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|605142_605526_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 48
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	610341	612780	5302688		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|610341_611553_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231428.1|611691_612780_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 49
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	619790	622373	5302688	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|619790_622373_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 50
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	629311	632844	5302688		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367852.1|629311_630982_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.5	5.2e-76
WP_001207503.1|631065_632001_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|632118_632844_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 51
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	640739	641819	5302688		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|640739_641819_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 52
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	645915	647580	5302688		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|645915_647580_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 53
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	652206	656020	5302688	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|652206_654153_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|654355_656020_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 54
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	660169	660934	5302688		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773303.1|660169_660934_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	32.4	2.0e-06
>prophage 55
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	667589	680310	5302688		Bacillus_phage(25.0%)	8	NA	NA
WP_000186103.1|667589_668267_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_001356143.1|668263_670948_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_001344323.1|670940_671513_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087961.1|671521_673570_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	28.6	3.4e-37
WP_000741112.1|673592_675266_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|675265_675355_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|675667_675874_+	YbfA family protein	NA	NA	NA	NA	NA
WP_000015024.1|676116_680310_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.3e-26
>prophage 56
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	684773	687715	5302688		Hokovirus(50.0%)	2	NA	NA
WP_000628038.1|684773_686192_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	5.2e-61
WP_001032694.1|686233_687715_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 57
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	691093	691885	5302688		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114035.1|691093_691885_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 58
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	725227	728747	5302688		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|725227_725947_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|725943_726885_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|726998_727379_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|727694_728747_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 59
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	733103	739677	5302688		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|733103_734120_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096881.1|734380_735853_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001147439.1|735920_736709_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|736837_736987_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101987.1|737153_737927_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604032.1|737926_738616_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891676.1|738618_739677_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.0e-20
>prophage 60
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	749480	795889	5302688	tail,head,integrase,lysis,capsid,portal	Enterobacteria_phage(55.56%)	59	747758:747773	770909:770924
747758:747773	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533642.1|749480_750551_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|750528_750747_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|750786_750954_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000120064.1|751196_751799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|752009_752231_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001386642.1|752329_752611_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548541.1|752621_752813_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
WP_000682318.1|752785_752968_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186833.1|752964_753645_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|753641_754427_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|754432_754729_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|754804_755011_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|755608_756298_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|756403_756634_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|756703_757243_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001386644.1|757329_758259_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	6.8e-110
WP_000788812.1|758255_758957_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145901.1|758953_759256_+	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_000948436.1|759501_760296_+	recombinase	NA	A0A2K9V406	Faecalibacterium_phage	28.9	7.5e-09
WP_000338663.1|760407_760647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990013.1|760965_761475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072147432.1|761571_761673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053034.1|761669_762125_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_000224912.1|762124_762295_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_000774504.1|762287_762578_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000971074.1|762932_763073_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|763158_763542_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737263.1|763730_764813_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_000839596.1|765401_765617_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135297.1|765616_766114_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000092234.1|766110_766548_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001028465.1|766752_767274_+	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000079508.1|767623_768034_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|768090_768324_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|768712_769258_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000198149.1|771153_771360_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
770909:770924	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_001316944.1|771356_772958_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000123216.1|772938_774258_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
WP_001299443.1|774267_774600_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063238.1|774655_775681_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_000158875.1|775722_776118_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|776129_776483_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|776494_777073_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|777069_777465_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001390429.1|777472_778213_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000479200.1|778228_778651_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_000459457.1|778632_779067_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840297.1|779059_781621_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.8	0.0e+00
WP_000847379.1|781617_781947_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152576.1|781946_782645_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_000140717.1|782650_783394_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_000090917.1|783330_783963_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515639.1|784023_787521_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_001233090.1|787591_788191_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_001387657.1|788255_791330_+	membrane protein	NA	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_000885623.1|791329_791914_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	9.2e-105
WP_000586343.1|791987_793319_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
WP_000767389.1|794064_794541_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001307065.1|794599_795889_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 61
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	802377	803286	5302688		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|802377_803286_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 62
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	814597	829409	5302688		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996091.1|814597_816334_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_001296990.1|816326_817322_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|817324_817996_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|818224_819589_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145128.1|819820_820303_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_001340191.1|820422_822573_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386540.1|822600_823563_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443512.1|823703_824789_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|825017_825278_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|825542_825809_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990161.1|825882_826560_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	3.1e-19
WP_000430039.1|826601_828884_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_001387658.1|829148_829409_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 63
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	832949	838174	5302688		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|832949_833672_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|833668_834328_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|834466_835213_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|835616_836120_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001119538.1|836418_837306_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|837540_837606_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|837658_838174_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 64
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	843171	844764	5302688		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|843171_844764_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 65
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	848656	852787	5302688		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209373.1|848656_851089_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001307076.1|851094_851994_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001351540.1|852124_852787_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.2	1.6e-25
>prophage 66
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	856014	857886	5302688		Planktothrix_phage(100.0%)	1	NA	NA
WP_001296993.1|856014_857886_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 67
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	869221	870424	5302688		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001386670.1|869221_870424_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.8	2.4e-99
>prophage 68
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	878990	888141	5302688		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|878990_879248_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|879407_879695_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189120.1|879678_880401_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|880461_881364_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|881451_881928_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|882279_883392_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000995994.1|883486_884620_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_001093858.1|884629_885583_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|885579_886425_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|886484_886973_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|887013_888141_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 69
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	891478	894216	5302688		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|891478_892207_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|892424_892940_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|893065_893389_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|893385_894216_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 70
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	897803	899522	5302688		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815352.1|897803_899522_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	8.9e-31
>prophage 71
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	908819	932578	5302688	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188193.1|908819_910766_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000410785.1|910838_911063_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|911385_911706_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|911736_914013_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|914697_914916_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|915200_915905_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202188.1|915946_917668_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001043601.1|917668_919435_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537418.1|919557_920523_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|921067_921562_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077049.1|921696_925764_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|925918_926530_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067740.1|926540_927884_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_000886683.1|927974_929267_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850310.1|929505_931950_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|931960_932578_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 72
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	938887	942102	5302688		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|938887_939628_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292812.1|939819_942102_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
>prophage 73
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	946199	947288	5302688		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|946199_947288_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 74
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	952374	956915	5302688		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|952374_952659_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705766.1|952865_955130_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|955166_956915_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 75
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	971620	972169	5302688		Rhodobacter_phage(100.0%)	1	NA	NA
WP_001295932.1|971620_972169_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 76
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	975718	984032	5302688	tRNA	Enterobacteria_phage(25.0%)	5	NA	NA
WP_000977920.1|975718_976807_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|977408_978809_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|978977_980180_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193859.1|980445_983058_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001090514.1|983264_984032_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
>prophage 77
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	999953	1001861	5302688		Tupanvirus(100.0%)	1	NA	NA
WP_000053089.1|999953_1001861_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
>prophage 78
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1014460	1016515	5302688		Bacillus_phage(100.0%)	1	NA	NA
WP_000420536.1|1014460_1016515_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 79
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1020748	1021408	5302688	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1020748_1021408_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 80
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1040673	1052929	5302688		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|1040673_1040886_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1040896_1041085_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001323678.1|1041059_1041290_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1041279_1041453_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818465.1|1041501_1042575_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001386712.1|1042646_1045391_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_001264919.1|1045473_1046502_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1046474_1047167_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001386714.1|1047296_1048469_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062101.1|1048468_1051015_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_000209869.1|1051011_1051611_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|1051703_1052009_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420631.1|1052008_1052929_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
>prophage 81
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1056839	1119957	5302688	tail,terminase,integrase,bacteriocin,lysis,capsid,holin,portal	Escherichia_phage(90.41%)	74	1054364:1054379	1089703:1089718
1054364:1054379	attL	CTGAACTTTTTGCTCA	NA	NA	NA	NA
WP_001401545.1|1056839_1058150_-|integrase	site-specific integrase	integrase	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
WP_001208772.1|1058202_1058487_-	excisionase family protein	NA	A0A0P0ZGY2	Escherichia_phage	100.0	7.0e-50
WP_000497812.1|1058532_1058784_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000994793.1|1059147_1059528_-	DUF1627 domain-containing protein	NA	A0A0P0ZFT6	Escherichia_phage	100.0	1.2e-52
WP_001291843.1|1059563_1059776_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000163448.1|1059735_1060362_-	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_000809302.1|1060358_1060790_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211520.1|1060845_1061475_-	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000203837.1|1061724_1062009_-	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
WP_000206786.1|1062364_1063261_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
WP_001014298.1|1063263_1063455_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000034212.1|1063456_1063864_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_000206047.1|1063860_1064586_-	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_001159715.1|1064736_1065132_-	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000080417.1|1065208_1066030_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001071603.1|1066093_1066441_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000344637.1|1066515_1067103_-	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_000187063.1|1067102_1067792_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000459721.1|1067788_1068739_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000995345.1|1068755_1069037_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934197.1|1069057_1069339_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000917252.1|1069350_1069563_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_113690331.1|1069633_1070419_-	hypothetical protein	NA	A0A0P0ZGC2	Escherichia_phage	96.2	2.6e-139
WP_001064714.1|1071036_1071990_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|1071986_1073456_-	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|1073550_1074264_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|1074359_1074563_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001369601.1|1074733_1074928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|1075094_1075472_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913116.1|1075465_1076986_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001260358.1|1076975_1077947_+	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000402092.1|1077946_1078396_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|1078403_1078967_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000144767.1|1078963_1079158_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|1079150_1079585_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001356551.1|1079833_1079986_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|1080368_1081328_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1081339_1081609_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874432.1|1082094_1084032_+	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	100.0	0.0e+00
WP_000143458.1|1084168_1084348_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1084388_1084634_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072899.1|1084711_1084927_+|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_000087461.1|1084931_1085465_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001056885.1|1085739_1086309_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|1086308_1086458_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|1086465_1086930_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|1086961_1087255_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1087404_1087608_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086069.1|1087663_1088470_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000143988.1|1088450_1090157_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
1089703:1089718	attR	CTGAACTTTTTGCTCA	NA	NA	NA	NA
WP_000787518.1|1090156_1092301_+|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	100.0	0.0e+00
WP_000345015.1|1092458_1093466_+	hypothetical protein	NA	A0A0P0ZGF7	Escherichia_phage	100.0	2.3e-180
WP_000214467.1|1093489_1094704_+|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
WP_001140445.1|1094758_1095148_+	hypothetical protein	NA	A0A0P0ZFT7	Escherichia_phage	100.0	3.8e-62
WP_001290743.1|1095198_1095660_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829202.1|1095643_1096207_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_000207922.1|1096206_1096857_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_000117976.1|1096853_1099445_+|tail	tail fiber protein	tail	A0A0P0ZGL7	Escherichia_phage	100.0	6.1e-209
WP_000513231.1|1099531_1100044_+	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_024199968.1|1100277_1101903_+	hypothetical protein	NA	A0A0P0ZG99	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|1101899_1103168_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|1103182_1103461_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|1103466_1104084_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835361.1|1104174_1104909_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_000078907.1|1105139_1105280_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035557.1|1105336_1105738_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000509482.1|1105832_1106489_+	hypothetical protein	NA	A0A0P0ZGF6	Escherichia_phage	100.0	5.1e-104
WP_000455649.1|1106491_1106938_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540391.1|1106947_1107199_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012452.1|1107209_1108475_+	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
WP_000331688.1|1108544_1116926_+	hypothetical protein	NA	A0A0P0ZGX9	Escherichia_phage	100.0	0.0e+00
WP_001273658.1|1117857_1118031_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001326838.1|1118113_1119442_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001028096.1|1119462_1119957_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 82
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1134733	1135657	5302688		Cronobacter_phage(100.0%)	1	NA	NA
WP_001307105.1|1134733_1135657_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 83
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1142476	1148380	5302688	integrase,transposase	Bacillus_phage(33.33%)	5	1143497:1143511	1161205:1161219
WP_000409841.1|1142476_1143835_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
1143497:1143511	attL	GTGGTGAATATCATT	NA	NA	NA	NA
WP_085948466.1|1143875_1145038_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000627404.1|1145140_1145632_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000611858.1|1145628_1146615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279857.1|1147162_1148380_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.7	6.5e-44
1161205:1161219	attR	AATGATATTCACCAC	NA	NA	NA	NA
>prophage 84
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1154327	1161672	5302688		Stx2-converting_phage(50.0%)	5	NA	NA
WP_000233439.1|1154327_1156688_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.0	1.5e-33
WP_000035067.1|1156705_1156894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612626.1|1158137_1158485_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|1158481_1158886_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001223341.1|1159581_1161672_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	3.4e-08
>prophage 85
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1170540	1171521	5302688	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019460.1|1170540_1171521_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.0e-184
>prophage 86
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1177086	1179207	5302688		Bacillus_phage(100.0%)	1	NA	NA
WP_001183600.1|1177086_1179207_+	microcin export transporter peptidase/ATP-binding subunit MchF	NA	W8CYL7	Bacillus_phage	27.4	1.3e-34
>prophage 87
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1207003	1215934	5302688	protease	Acinetobacter_phage(33.33%)	10	NA	NA
WP_001182410.1|1207003_1208083_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	1.8e-37
WP_001040056.1|1208084_1208858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|1208850_1209993_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035169.1|1210002_1211061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254140.1|1211383_1211965_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054792.1|1211964_1213122_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007452.1|1213144_1213600_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|1213622_1214663_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|1214711_1215290_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|1215358_1215934_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
>prophage 88
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1228049	1233132	5302688	transposase	Stx2-converting_phage(40.0%)	8	NA	NA
WP_001309734.1|1228049_1228484_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|1228480_1228831_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000080172.1|1228861_1230475_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_001241709.1|1230722_1231544_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.8	8.8e-45
WP_001164966.1|1231543_1231789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000855049.1|1231882_1232356_+	antirestriction protein	NA	NA	NA	NA	NA
WP_001186756.1|1232371_1232848_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692357.1|1232910_1233132_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 89
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1239085	1239919	5302688		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1239085_1239919_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 90
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1244052	1244586	5302688		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|1244052_1244586_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 91
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1253894	1254815	5302688		Morganella_phage(100.0%)	1	NA	NA
WP_000183365.1|1253894_1254815_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	6.6e-57
>prophage 92
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1259477	1259723	5302688		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1259477_1259723_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 93
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1275603	1276545	5302688		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|1275603_1276545_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 94
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1288903	1290085	5302688		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|1288903_1289638_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|1289848_1290085_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 95
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1293357	1295000	5302688		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|1293357_1293999_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267971.1|1293995_1295000_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 96
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1307314	1307572	5302688		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1307314_1307572_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 97
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1314861	1318584	5302688		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|1314861_1315563_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251389.1|1315562_1316807_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|1316835_1317747_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|1317762_1318584_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 98
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1322030	1385797	5302688	tail,head,terminase,integrase,lysis,tRNA,capsid,holin,portal	Enterobacteria_phage(44.44%)	74	1314174:1314188	1354158:1354172
1314174:1314188	attL	GCCAGCCAGTTCACG	NA	NA	NA	NA
WP_000074983.1|1322030_1323149_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|1323117_1323387_-	excisionase	NA	NA	NA	NA	NA
WP_000102130.1|1323448_1325887_-	exonuclease	NA	A0A088CD28	Shigella_phage	45.0	2.9e-112
WP_000199475.1|1325979_1326168_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|1326164_1326353_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_012601410.1|1326847_1327114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394541.1|1327102_1327441_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_000379548.1|1327452_1327605_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_014966210.1|1327874_1328165_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000100896.1|1328164_1328356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824162.1|1328373_1328874_-	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_001048458.1|1328981_1329257_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|1329240_1329666_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|1329688_1330651_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000416574.1|1330691_1331114_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	76.1	1.6e-53
WP_001275731.1|1331110_1331605_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.8	1.9e-66
WP_000034251.1|1331591_1332278_+	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	68.2	1.3e-38
WP_001289900.1|1332274_1333024_+	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	89.1	1.8e-108
WP_000224227.1|1333946_1334210_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000403778.1|1334341_1334698_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_001224662.1|1334791_1334974_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000813254.1|1336064_1336220_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001341382.1|1336387_1336666_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265094.1|1336667_1337717_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	5.9e-110
WP_000904113.1|1337729_1338104_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762898.1|1338100_1338922_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	1.3e-80
WP_000917749.1|1339148_1339346_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935531.1|1339496_1340546_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	96.5	6.1e-200
WP_021519714.1|1341335_1343189_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	90.8	0.0e+00
WP_000284510.1|1343339_1343555_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731195.1|1343559_1344366_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	95.1	2.5e-145
WP_001092864.1|1344408_1344942_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	3.3e-101
WP_001082546.1|1345240_1345708_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.4e-78
WP_000347013.1|1346058_1346199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|1346331_1346517_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000235436.1|1346918_1347428_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001402639.1|1347399_1349328_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000259002.1|1349311_1349518_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012601424.1|1349514_1351107_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	8.4e-185
WP_001254006.1|1351096_1352602_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
WP_000256795.1|1352638_1352986_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522644.1|1353043_1354072_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	7.3e-113
WP_001390684.1|1354124_1354493_+	hypothetical protein	NA	NA	NA	NA	NA
1354158:1354172	attR	CGTGAACTGGCTGGC	NA	NA	NA	NA
WP_001204567.1|1354485_1354839_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000975003.1|1354854_1355430_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_000683079.1|1355426_1355822_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235035.1|1355829_1356582_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	6.0e-133
WP_000479049.1|1356595_1357018_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	3.7e-71
WP_000533440.1|1357044_1357458_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081807.1|1357438_1360051_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	90.3	0.0e+00
WP_000847306.1|1360047_1360377_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001335877.1|1360376_1361075_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000194711.1|1361085_1361829_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.7e-149
WP_123001620.1|1361774_1362407_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	1.4e-103
WP_000515046.1|1362647_1366121_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.9	0.0e+00
WP_001233150.1|1366188_1366788_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	98.0	9.7e-110
WP_000279201.1|1366852_1369645_+|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	5.2e-12
WP_000885609.1|1369644_1370226_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	3.8e-103
WP_000799406.1|1370457_1371321_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1371304_1372441_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359463.1|1372690_1373920_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1374065_1375187_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|1375262_1376723_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1376722_1377394_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1377561_1378932_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1378935_1379577_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1379612_1380719_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476089.1|1380772_1381234_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248697.1|1381243_1381897_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444474.1|1382068_1383319_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|1383421_1383745_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|1384277_1384388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1384440_1384845_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1385065_1385797_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 99
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1391665	1393987	5302688		Escherichia_phage(100.0%)	1	NA	NA
WP_001390463.1|1391665_1393987_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	2.3e-90
>prophage 100
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1402522	1404210	5302688		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|1402522_1402942_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|1402941_1404210_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 101
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1430880	1433632	5302688		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|1430880_1432560_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|1432684_1433632_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 102
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1436768	1440776	5302688		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|1436768_1437851_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456571.1|1437850_1438684_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|1438680_1439073_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|1439076_1439886_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|1439921_1440776_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 103
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1443877	1444108	5302688		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|1443877_1444108_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 104
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1455362	1465373	5302688		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|1455362_1456901_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|1456897_1457608_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|1457607_1458285_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|1459009_1459852_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|1459901_1460360_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|1460472_1461378_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|1461469_1462483_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1462684_1463593_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1463736_1464150_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|1464755_1465373_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 105
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1474787	1476802	5302688		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|1474787_1475801_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|1475797_1476802_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 106
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1484737	1549471	5302688	tail,head,protease,terminase,integrase,capsid,holin,portal	Enterobacteria_phage(42.31%)	75	1480553:1480567	1501492:1501506
1480553:1480567	attL	AAACAAGAACACGGT	NA	NA	NA	NA
WP_000113686.1|1484737_1485868_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	4.4e-103
WP_000113189.1|1485845_1486094_-	excisionase	NA	NA	NA	NA	NA
WP_000048530.1|1486158_1488630_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
WP_001090200.1|1488722_1488914_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1488910_1489099_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_012601410.1|1489593_1489860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394541.1|1489848_1490187_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_000379548.1|1490198_1490351_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000233320.1|1490647_1491067_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|1491146_1491401_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693888.1|1491397_1491823_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|1491845_1492808_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151211.1|1492848_1493274_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000150294.1|1493448_1494114_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|1494294_1494507_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|1494674_1494947_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265083.1|1494948_1495995_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
WP_000904106.1|1496007_1496382_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.8e-36
WP_000762880.1|1496378_1497200_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917746.1|1497426_1497624_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
WP_000935536.1|1497774_1498824_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_001438304.1|1499622_1499754_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000871291.1|1500034_1500370_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874307.1|1500630_1502484_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
1501492:1501506	attR	AAACAAGAACACGGT	NA	NA	NA	NA
WP_000284510.1|1502634_1502850_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731197.1|1502854_1503661_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
WP_001092853.1|1503703_1504237_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
WP_032159578.1|1504791_1504878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001228710.1|1505099_1505306_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	2.9e-29
WP_001390467.1|1505334_1505487_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
WP_000343118.1|1505565_1505853_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
WP_000240372.1|1506306_1506711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867569.1|1507111_1507660_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_088888698.1|1507589_1509560_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_000259002.1|1509543_1509750_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001387697.1|1509746_1511339_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_001253926.1|1511328_1512834_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	3.0e-99
WP_000256823.1|1512870_1513218_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522596.1|1513275_1514304_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000201506.1|1514355_1514724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204198.1|1514716_1515070_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000974999.1|1515084_1515660_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
WP_000683079.1|1515656_1516052_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235040.1|1516059_1516812_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.7e-132
WP_000479095.1|1516825_1517257_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|1517283_1517697_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082359.1|1517677_1520251_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_000847379.1|1520247_1520577_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152522.1|1520576_1521275_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140761.1|1521279_1522023_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.8e-145
WP_000090879.1|1521959_1522562_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|1522635_1522974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515776.1|1523040_1526520_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001228314.1|1526587_1527187_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000216502.1|1527338_1530173_+|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	59.1	5.7e-83
WP_000885576.1|1530172_1530757_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_000240999.1|1530811_1531480_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000926528.1|1531536_1531806_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_001079509.1|1532579_1533086_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1533131_1533632_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1533717_1533897_-	general stress protein	NA	NA	NA	NA	NA
WP_000443069.1|1534277_1535084_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1535083_1536277_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001344826.1|1536288_1537647_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|1537650_1539246_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194599.1|1539245_1540808_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001386774.1|1540899_1540944_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1541081_1541963_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1541959_1542580_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1542680_1543553_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1543592_1544183_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559283.1|1544179_1544938_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_000422045.1|1545157_1546207_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1546242_1546494_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|1546873_1549471_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 107
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1554394	1554985	5302688		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|1554394_1554985_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 108
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1562800	1568460	5302688		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|1562800_1564735_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_000437858.1|1564802_1565930_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|1566074_1566863_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968850.1|1567232_1567586_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573412.1|1567653_1568460_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 109
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1581374	1582640	5302688		Klosneuvirus(100.0%)	1	NA	NA
WP_000069260.1|1581374_1582640_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	5.9e-24
>prophage 110
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1596644	1597727	5302688		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|1596644_1597727_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 111
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1614346	1614862	5302688		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945013.1|1614346_1614862_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.8e-24
>prophage 112
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1621188	1628458	5302688	tRNA	Bacillus_phage(20.0%)	7	NA	NA
WP_000628065.1|1621188_1622421_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1622675_1623659_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|1623933_1624107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123720.1|1624136_1625510_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	5.6e-52
WP_000081419.1|1625638_1626574_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001082294.1|1626749_1627184_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|1627324_1628458_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 113
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1633418	1634408	5302688		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|1633418_1634408_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 114
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1665693	1669596	5302688		Klosneuvirus(100.0%)	1	NA	NA
WP_000139567.1|1665693_1669596_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 115
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1673535	1674484	5302688		Escherichia_phage(50.0%)	2	NA	NA
WP_001307188.1|1673535_1674066_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|1674310_1674484_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 116
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1686286	1696438	5302688	transposase	Escherichia_phage(25.0%)	9	NA	NA
WP_000826404.1|1686286_1687495_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	2.7e-207
WP_001326689.1|1687534_1688749_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429141.1|1688801_1689338_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001301045.1|1689410_1691372_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
WP_000494244.1|1691463_1691694_-	YncJ family protein	NA	NA	NA	NA	NA
WP_001270286.1|1692115_1692532_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760615.1|1692610_1694017_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047456.1|1694261_1695407_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220411.1|1695424_1696438_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 117
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1699819	1700629	5302688		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|1699819_1700629_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 118
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1704894	1706997	5302688		Salmonella_phage(100.0%)	1	NA	NA
WP_000689350.1|1704894_1706997_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	8.1e-135
>prophage 119
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1711903	1718321	5302688		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103201.1|1711903_1714012_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	8.1e-26
WP_000014727.1|1714079_1718321_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
>prophage 120
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1724124	1725669	5302688		Escherichia_phage(100.0%)	1	NA	NA
WP_000702559.1|1724124_1725669_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 121
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1732554	1732845	5302688		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|1732554_1732845_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 122
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1738857	1740299	5302688		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|1738857_1739142_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|1739288_1740299_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 123
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1743573	1745479	5302688		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285553.1|1743573_1744500_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-13
WP_000193523.1|1744492_1745479_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.9e-18
>prophage 124
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1749795	1753602	5302688		Klosneuvirus(50.0%)	2	NA	NA
WP_001307211.1|1749795_1752195_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426265.1|1752219_1753602_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 125
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1758876	1769638	5302688	transposase	Powai_lake_megavirus(33.33%)	6	NA	NA
WP_001391918.1|1758876_1761672_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	5.7e-19
WP_000832430.1|1761716_1764089_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001296749.1|1764126_1765812_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.5	1.7e-10
WP_120795387.1|1766014_1766137_+	protein YneP	NA	NA	NA	NA	NA
WP_001295683.1|1766102_1767260_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_000019427.1|1768657_1769638_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
>prophage 126
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1783571	1784972	5302688		Escherichia_phage(100.0%)	1	NA	NA
WP_001083595.1|1783571_1784972_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
>prophage 127
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1792396	1793932	5302688		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194894.1|1792396_1793932_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	4.0e-22
>prophage 128
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1801813	1803232	5302688		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|1801813_1803232_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 129
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1810976	1813106	5302688		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|1810976_1811360_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|1811391_1811610_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|1811666_1813106_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
>prophage 130
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1820611	1821502	5302688		Bacillus_phage(100.0%)	1	NA	NA
WP_000592826.1|1820611_1821502_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 131
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1826868	1902226	5302688	tail,terminase,integrase,lysis,capsid,holin,portal	Shigella_phage(40.26%)	90	1877717:1877734	1905767:1905784
WP_000214712.1|1826868_1827072_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527751.1|1827107_1828568_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000151243.1|1828656_1830024_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000836057.1|1830081_1831101_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|1831112_1832327_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1832532_1832859_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1832993_1833335_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1833369_1833930_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1833932_1834643_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1834750_1835056_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041536.1|1835254_1837681_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
WP_001342404.1|1837741_1840165_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000213043.1|1840175_1840289_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_000184488.1|1840696_1841332_+	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	81.0	2.8e-91
WP_000763355.1|1841379_1841601_+	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	98.6	2.9e-35
WP_000020909.1|1841597_1841882_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	98.9	6.1e-46
WP_001290012.1|1841868_1842705_+	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	87.7	6.1e-126
WP_000628768.1|1843218_1843722_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	98.2	2.6e-95
WP_000481378.1|1843723_1843999_-	hypothetical protein	NA	A0A088CD78	Shigella_phage	89.3	4.0e-18
WP_000331660.1|1844122_1852474_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.8	0.0e+00
WP_000012439.1|1852542_1853808_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
WP_000540395.1|1853818_1854070_-	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	97.5	7.9e-13
WP_000455643.1|1854079_1854526_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	100.0	4.0e-76
WP_000509022.1|1854528_1855185_-	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	7.4e-103
WP_001387532.1|1855276_1855678_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	98.5	5.0e-70
WP_000078908.1|1855734_1855875_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	97.8	2.0e-18
WP_000836186.1|1856109_1856847_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	80.8	1.2e-109
WP_001390575.1|1856926_1857544_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	6.3e-120
WP_000455633.1|1857549_1857828_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_000038927.1|1857842_1859111_-	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	94.3	1.6e-218
WP_001146337.1|1859107_1860733_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	96.7	0.0e+00
WP_000276176.1|1861073_1861301_-	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
WP_000537686.1|1861313_1861859_-	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
WP_000117962.1|1861941_1863849_-|tail	tail fiber protein	tail	V5USF3	Shigella_phage	66.0	4.2e-82
WP_000207910.1|1863845_1864496_-	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
WP_000829400.1|1864495_1865059_-	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_001290749.1|1865042_1865504_-	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	99.3	6.9e-71
WP_001140435.1|1865554_1865944_-	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
WP_000214480.1|1865998_1867213_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	99.0	1.8e-232
WP_000344999.1|1867235_1868243_-	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	93.4	1.2e-168
WP_000787512.1|1868400_1870545_-|portal	portal protein	portal	A0A088CE71	Shigella_phage	99.6	0.0e+00
WP_001387707.1|1870544_1872251_-|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
WP_001086085.1|1872231_1873047_-|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
WP_000934362.1|1873649_1874231_+	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
WP_077627825.1|1874364_1874550_-|lysis	lysis protein	lysis	A0A0P0ZDR7	Stx2-converting_phage	96.7	2.8e-23
WP_000675931.1|1874771_1874885_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_000087450.1|1875105_1875639_-	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
WP_000284506.1|1875643_1875859_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290236.1|1875935_1876181_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000142783.1|1876206_1876389_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_000874468.1|1876527_1878438_-	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	74.8	6.4e-280
1877717:1877734	attL	AACAGCACATTTTTCGGG	NA	NA	NA	NA
WP_001204886.1|1879203_1879638_-	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
WP_000992060.1|1879630_1879825_-	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001008115.1|1879824_1880187_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
WP_000002252.1|1880183_1880474_-	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
WP_001254268.1|1880497_1880689_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
WP_001076834.1|1880685_1881096_-	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_000211990.1|1881150_1881822_-	hypothetical protein	NA	A0A088CD42	Shigella_phage	82.6	9.0e-96
WP_000042397.1|1882528_1882846_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000818160.1|1882896_1883382_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119356.1|1883400_1883580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887482.1|1883789_1884002_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
WP_001278450.1|1884190_1884295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206792.1|1884410_1884995_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001118163.1|1885051_1885447_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
WP_000450864.1|1885462_1886233_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
WP_000790392.1|1886258_1886999_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
WP_001390256.1|1887005_1888088_-	hypothetical protein	NA	V5URT9	Shigella_phage	96.4	2.8e-200
WP_000438870.1|1888108_1888327_-	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_000438525.1|1888341_1888638_-	hypothetical protein	NA	A0A088CBI6	Shigella_phage	98.0	3.4e-47
WP_000437871.1|1888776_1888977_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_001274758.1|1889077_1889791_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
WP_001074607.1|1889837_1890380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528776.1|1890367_1891144_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000198438.1|1891638_1892022_+	antitermination protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_000211196.1|1892025_1892739_+	hypothetical protein	NA	A0A088CC14	Shigella_phage	98.7	1.8e-126
WP_001005963.1|1892770_1893130_+	hypothetical protein	NA	A0A088CBI5	Shigella_phage	72.6	2.3e-37
WP_000189936.1|1893098_1893308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560214.1|1893764_1893986_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
WP_000660961.1|1894069_1894456_+	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
WP_001271588.1|1894563_1896636_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.4	0.0e+00
WP_000995032.1|1896632_1896929_+	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_000100829.1|1896934_1897720_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_000186868.1|1897716_1898397_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	1.5e-130
WP_000497813.1|1898444_1898696_+	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_097517905.1|1898655_1899102_+	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	73.1	7.2e-41
WP_001387389.1|1898957_1900121_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_000254426.1|1900158_1900713_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.7	1.4e-62
WP_000526492.1|1900714_1901569_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1901611_1902226_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
1905767:1905784	attR	AACAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 132
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1919987	1921289	5302688		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|1919987_1921289_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 133
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1931184	1932996	5302688		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945924.1|1931184_1932996_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 134
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1952783	1954058	5302688	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001339629.1|1952783_1954058_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 135
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1960969	1962468	5302688		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|1960969_1961491_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250661.1|1961571_1962468_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
>prophage 136
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1971270	1980062	5302688		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|1971270_1972086_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|1972213_1972795_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|1972940_1974110_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|1974275_1974365_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|1974663_1975689_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|1975685_1976618_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|1976730_1977942_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098911.1|1978232_1979381_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_000493947.1|1979420_1980062_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 137
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1985566	1987833	5302688		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587560.1|1985566_1986379_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069992.1|1986382_1987168_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001349911.1|1987164_1987833_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 138
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	1996123	2001207	5302688		environmental_halophage(33.33%)	5	NA	NA
WP_000144575.1|1996123_1997344_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000908012.1|1997340_1998612_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948855.1|1998586_1999333_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_001297388.1|1999342_2000830_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|2000838_2001207_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 139
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2019799	2076008	5302688	tail,plate,head,terminase,integrase,tRNA,capsid,holin,portal	Enterobacteria_phage(76.47%)	68	2025624:2025640	2076632:2076648
WP_000553693.1|2019799_2021500_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.1e-32
WP_000069375.1|2021556_2023935_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|2024267_2025101_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082240.1|2025257_2026304_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	1.6e-83
2025624:2025640	attL	GAGCTGGCGCGCAAATT	NA	NA	NA	NA
WP_001270810.1|2026435_2026627_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175592.1|2026630_2028067_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001326034.1|2028129_2028843_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|2029089_2029554_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|2029631_2030381_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154183.1|2030380_2030932_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956518.1|2030994_2031975_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_000416308.1|2032164_2032560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247218.1|2032570_2033506_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.5	4.8e-79
WP_000094527.1|2033594_2033906_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_000163908.1|2033997_2034276_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000917807.1|2034290_2034629_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
WP_000159452.1|2034639_2034927_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	2.7e-33
WP_000514277.1|2034938_2035181_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021658.1|2035177_2035291_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.4e-09
WP_001038613.1|2035379_2035700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985715.1|2035689_2035893_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	3.4e-30
WP_000153687.1|2035889_2036135_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	87.7	8.4e-36
WP_000104300.1|2036131_2036431_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
WP_000013476.1|2036753_2036984_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	93.4	5.0e-30
WP_000564228.1|2037056_2037446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272076.1|2037442_2040283_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
WP_000686540.1|2040359_2041319_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
WP_000211292.1|2041323_2041638_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000201251.1|2041657_2042089_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000224219.1|2042090_2042354_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
WP_000087812.1|2042865_2043912_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613796.1|2043911_2045663_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_001262665.1|2045817_2046654_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.8e-149
WP_001055094.1|2046677_2047730_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_000632318.1|2047775_2048576_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063103.1|2048677_2049172_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864897.1|2049171_2049372_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|2049374_2049698_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072317.1|2049694_2050087_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
WP_000780558.1|2050083_2050491_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
WP_000202135.1|2050629_2052510_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
WP_000921128.1|2052533_2053001_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
WP_000356370.1|2052993_2053629_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
WP_001271909.1|2053625_2054207_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000213447.1|2054203_2054554_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111965.1|2054557_2055454_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_000071739.1|2055446_2055977_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108557.1|2055979_2058112_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	1.2e-130
WP_000144016.1|2058111_2058690_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_000954195.1|2058733_2059306_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979946.1|2059462_2059951_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_001390260.1|2059963_2062771_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_001391627.1|2062757_2062886_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	95.2	1.5e-15
WP_000665305.1|2062921_2063287_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_000290443.1|2063341_2063854_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_000005414.1|2063853_2065038_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
WP_000132828.1|2065195_2066305_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	3.7e-195
WP_000965749.1|2066396_2067479_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000488099.1|2067798_2068059_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2068249_2068390_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|2068691_2068991_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|2068995_2071383_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|2071397_2072381_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2072663_2072708_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2072830_2073187_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2073239_2073437_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2073533_2074076_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144190.1|2074079_2076008_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
2076632:2076648	attR	AATTTGCGCGCCAGCTC	NA	NA	NA	NA
>prophage 140
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2087307	2089569	5302688		Tupanvirus(100.0%)	1	NA	NA
WP_000077825.1|2087307_2089569_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	2.3e-143
>prophage 141
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2095696	2096524	5302688		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|2095696_2096524_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 142
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2104000	2105221	5302688		Klosneuvirus(100.0%)	1	NA	NA
WP_000082041.1|2104000_2105221_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.5e-27
>prophage 143
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2111984	2112638	5302688		Planktothrix_phage(100.0%)	1	NA	NA
WP_000882826.1|2111984_2112638_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	9.9e-15
>prophage 144
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2117754	2121397	5302688	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000019440.1|2117754_2118735_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_001235793.1|2119435_2121397_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.5	1.1e-40
>prophage 145
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2126323	2130408	5302688		Tupanvirus(50.0%)	4	NA	NA
WP_001120535.1|2126323_2126965_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_000438813.1|2127057_2128416_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|2128532_2129291_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723710.1|2129427_2130408_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
>prophage 146
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2139221	2140076	5302688		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|2139221_2140076_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 147
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2143394	2147971	5302688		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|2143394_2144678_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616411.1|2144824_2146300_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|2146480_2147971_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 148
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2153925	2156104	5302688	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000826413.1|2153925_2155134_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	8.6e-206
WP_001349736.1|2155141_2156104_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	1.8e-41
>prophage 149
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2164477	2172584	5302688	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|2164477_2166163_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290564.1|2166367_2166949_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220965.1|2166988_2167684_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|2167741_2169652_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|2169783_2170128_+	RidA family protein	NA	NA	NA	NA	NA
WP_001300615.1|2170490_2170850_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2170969_2171149_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|2171222_2172584_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 150
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2176446	2178003	5302688		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|2176446_2178003_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 151
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2183643	2183853	5302688		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2183643_2183853_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 152
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2188111	2281616	5302688	tail,head,protease,terminase,integrase,lysis,tRNA,capsid,holin,portal,transposase	Enterobacteria_phage(45.59%)	107	2207984:2207999	2284794:2284809
WP_000984517.1|2188111_2188993_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|2189184_2191233_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|2191252_2191951_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2192047_2192545_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207283.1|2192674_2193958_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|2193926_2196560_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|2196639_2198079_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2198196_2198433_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2198537_2198729_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812712.1|2198729_2199386_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_000976472.1|2199781_2200123_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|2200135_2201008_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|2201011_2201386_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2201524_2201755_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|2201856_2202513_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2202536_2203199_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936951.1|2203195_2205256_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|2205464_2206124_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2206450_2206807_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2206873_2207164_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173474.1|2207297_2208476_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
2207984:2207999	attL	CTACCGTGAATCCTGG	NA	NA	NA	NA
WP_000800512.1|2208531_2209173_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|2209209_2211021_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301720.1|2211255_2212731_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001056706.1|2213068_2213938_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091176.1|2214065_2215508_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2215638_2216610_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2216729_2218052_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|2218067_2219000_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2219078_2219834_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|2219830_2220616_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2220762_2221773_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2221781_2222393_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|2222531_2222597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|2222667_2223270_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2223271_2223793_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2223827_2224568_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077221229.1|2224596_2225049_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|2225041_2226814_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891610.1|2227123_2227690_+	hydrolase	NA	NA	NA	NA	NA
WP_001217553.1|2228044_2228293_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000885566.1|2228408_2228993_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	4.3e-102
WP_000216489.1|2228992_2232163_-	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	59.1	1.3e-83
WP_001580506.1|2232314_2232914_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	1.0e-106
WP_000515636.1|2232981_2236461_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_000090891.1|2236521_2237154_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|2237090_2237834_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152493.1|2237838_2238537_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.8e-132
WP_000847379.1|2238536_2238866_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840228.1|2238862_2241424_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.6	0.0e+00
WP_000459468.1|2241416_2241851_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.7e-63
WP_000479153.1|2241832_2242255_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001401350.1|2242270_2243011_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_000683112.1|2243018_2243414_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_000975015.1|2243410_2243989_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	90.6	4.9e-74
WP_001204567.1|2244004_2244358_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_001390684.1|2244350_2244719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522645.1|2244771_2245800_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	1.1e-113
WP_000256796.1|2245857_2246205_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_001254006.1|2246241_2247747_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
WP_000831738.1|2247736_2249329_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	4.2e-184
WP_000259002.1|2249325_2249532_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001390579.1|2249515_2251444_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
WP_000867568.1|2251415_2251964_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_015674556.1|2252358_2252544_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	81.4	4.1e-19
WP_000347013.1|2252676_2252817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082546.1|2253167_2253635_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.4e-78
WP_001092883.1|2253933_2254467_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_000731267.1|2254517_2254862_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
WP_000284510.1|2254866_2255082_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001289722.1|2255157_2255427_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	8.2e-08
WP_000142785.1|2255452_2255647_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	9.4e-22
WP_000874454.1|2255782_2257744_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.2	3.9e-240
WP_000301785.1|2258510_2259224_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917745.1|2259358_2259556_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	3.4e-27
WP_000355468.1|2259822_2260998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150292.1|2261000_2262215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205470.1|2262194_2262551_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_001358491.1|2262568_2263558_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001072669.1|2263565_2264381_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_000767110.1|2264543_2264939_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210143.1|2264935_2265262_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000066917.1|2265258_2265912_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001387484.1|2265911_2266406_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000061508.1|2266402_2267221_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_000620687.1|2267217_2267442_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_001087340.1|2267438_2268584_-	peptidase	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_000526669.1|2268580_2269138_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
WP_001191669.1|2269130_2269391_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001387485.1|2269488_2270181_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
WP_000179185.1|2270883_2271246_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
WP_000081306.1|2271311_2272136_+	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
WP_000008178.1|2272263_2272800_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_001242713.1|2272790_2273153_+	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000111289.1|2273149_2273353_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_000476207.1|2273345_2273585_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	9.1e-35
WP_000065512.1|2273581_2274130_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
WP_000628772.1|2274643_2275402_+	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
WP_000457723.1|2275486_2275729_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001030156.1|2275732_2275879_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000528718.1|2275887_2276124_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_000362003.1|2276179_2277490_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	95.4	3.0e-244
WP_044713004.1|2277471_2278242_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252979.1|2278294_2278690_+	membrane protein	NA	NA	NA	NA	NA
WP_000019588.1|2278730_2279474_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564745.1|2279470_2280442_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000399648.1|2280635_2281616_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
2284794:2284809	attR	CCAGGATTCACGGTAG	NA	NA	NA	NA
>prophage 153
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2287369	2289103	5302688	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025327.1|2287369_2289103_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
>prophage 154
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2294355	2299999	5302688		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|2294355_2294745_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|2294759_2295809_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|2295811_2296672_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483221.1|2296690_2298292_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001370571.1|2298337_2299999_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
>prophage 155
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2310085	2311600	5302688		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|2310085_2311600_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 156
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2323592	2324345	5302688		Bacillus_virus(100.0%)	1	NA	NA
WP_001272980.1|2323592_2324345_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 157
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2335729	2336985	5302688	transposase	uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_000334575.1|2335729_2336227_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	64.5	3.8e-51
WP_001336494.1|2336108_2336438_-	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	86.6	8.1e-42
WP_015674555.1|2336460_2336985_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
>prophage 158
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2357094	2363229	5302688	transposase	Burkholderia_phage(50.0%)	5	NA	NA
WP_000786004.1|2357094_2357565_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157246.1|2357545_2358964_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
WP_000365556.1|2359030_2359726_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	26.9	3.6e-07
WP_001386868.1|2359765_2360131_-	permease	NA	NA	NA	NA	NA
WP_001254922.1|2362077_2363229_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	9.8e-42
>prophage 159
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2366424	2368454	5302688		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000826790.1|2366424_2367783_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	2.3e-05
WP_001340597.1|2367782_2368454_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
>prophage 160
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2373643	2398299	5302688	integrase	Bacillus_phage(40.0%)	8	2366620:2366634	2377281:2377295
2366620:2366634	attL	GCTGGCGATATCAAT	NA	NA	NA	NA
WP_000480163.1|2373643_2374906_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.2e-72
WP_000703041.1|2375099_2376404_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286294.1|2376431_2377712_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
2377281:2377295	attR	GCTGGCGATATCAAT	NA	NA	NA	NA
WP_000654453.1|2377704_2379507_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	7.9e-22
WP_000098404.1|2379493_2381296_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.8	8.5e-32
WP_000140405.1|2381462_2382422_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623021.1|2382612_2388720_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
WP_000369490.1|2388807_2398299_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
>prophage 161
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2434473	2436786	5302688	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_001000402.1|2434473_2436009_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.1	1.5e-258
WP_000609174.1|2436058_2436406_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|2436402_2436786_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
>prophage 162
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2446508	2450350	5302688	transposase	Yersinia_phage(25.0%)	8	NA	NA
WP_001234530.1|2446508_2447330_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860076.1|2447411_2447891_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001186773.1|2447906_2448383_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2448445_2448667_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285585.1|2448740_2449109_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|2449567_2449762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|2449774_2449888_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_032082634.1|2450176_2450350_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	54.2	1.1e-10
>prophage 163
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2454287	2455454	5302688		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830163.1|2454287_2455454_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	9.4e-226
>prophage 164
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2463099	2463999	5302688		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|2463099_2463999_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 165
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2471354	2475102	5302688		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
WP_000704855.1|2471354_2472521_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	2.2e-110
WP_000043483.1|2472768_2474175_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000672882.1|2474295_2475102_-	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	31.0	8.5e-16
>prophage 166
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2482207	2487917	5302688		uncultured_Mediterranean_phage(25.0%)	5	NA	NA
WP_001034031.1|2482207_2483248_-	N-acetylneuraminate synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	35.7	1.5e-33
WP_000727834.1|2483252_2483873_-	acetyltransferase	NA	NA	NA	NA	NA
WP_000183060.1|2484233_2485127_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|2485369_2486365_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001116116.1|2486522_2487917_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	4.4e-20
>prophage 167
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2493638	2500608	5302688		Bacillus_phage(25.0%)	6	NA	NA
WP_001387746.1|2493638_2495009_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.3e-32
WP_000079283.1|2495377_2496814_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.0	3.7e-46
WP_000699673.1|2496816_2498040_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479829.1|2498036_2498516_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043594.1|2498518_2499484_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.1e-86
WP_000048190.1|2499486_2500608_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 168
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2504852	2515328	5302688		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|2504852_2505692_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137113.1|2505869_2508032_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	29.8	5.4e-17
WP_000482901.1|2508034_2508478_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|2508483_2509623_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001300971.1|2510281_2511865_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252335.1|2512138_2513992_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|2514013_2514595_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|2514686_2515328_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 169
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2519992	2521345	5302688		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469759.1|2519992_2521345_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 170
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2534786	2541660	5302688	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675144.1|2534786_2536190_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137873.1|2536186_2536909_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|2537099_2537432_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2537640_2537937_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2537938_2538235_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2538337_2539699_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|2540028_2540346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2540760_2541660_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 171
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2550877	2554434	5302688		Serratia_phage(50.0%)	4	NA	NA
WP_000712169.1|2550877_2551882_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	2.4e-12
WP_000012008.1|2551878_2552844_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|2552817_2553564_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|2553615_2554434_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
>prophage 172
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2565860	2567894	5302688	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|2565860_2567894_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 173
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2580459	2589901	5302688		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|2580459_2581596_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001351453.1|2581592_2583593_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|2583717_2584179_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2584219_2584690_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2584736_2585456_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2585452_2587138_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2587359_2588091_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2588150_2588258_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2588238_2588970_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569326.1|2588974_2589901_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 174
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2610216	2611737	5302688		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|2610216_2611737_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 175
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2615431	2619217	5302688		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|2615431_2616100_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|2616357_2617194_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|2617225_2619217_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 176
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2623286	2624144	5302688		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|2623286_2624144_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 177
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2638639	2642940	5302688		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848202.1|2638639_2640106_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.1	4.3e-42
WP_000198822.1|2640223_2641210_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000594599.1|2641248_2641962_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241012.1|2642373_2642940_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 178
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2648694	2656342	5302688		Vibrio_phage(50.0%)	7	NA	NA
WP_000194867.1|2648694_2650284_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|2650287_2650632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|2650964_2652155_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|2652182_2652878_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578076.1|2653026_2654787_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|2654911_2655196_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|2655334_2656342_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 179
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2668040	2668658	5302688		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|2668040_2668658_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 180
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2677425	2683203	5302688		Bacillus_phage(25.0%)	5	NA	NA
WP_000422224.1|2677425_2679069_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	2.5e-14
WP_000884942.1|2679144_2679795_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000710363.1|2679794_2680859_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406087.1|2680932_2681988_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865570.1|2682099_2683203_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.9	1.2e-118
>prophage 181
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2687480	2690330	5302688		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|2687480_2690330_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 182
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2700030	2715286	5302688	transposase	Escherichia_phage(28.57%)	9	NA	NA
WP_001281210.1|2700030_2702658_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	1.4e-91
WP_000990754.1|2702804_2703527_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001386944.1|2703654_2707389_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	27.1	9.0e-20
WP_001075170.1|2708084_2710370_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|2710458_2711589_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|2711588_2711843_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|2711896_2712547_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000019460.1|2712800_2713781_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.0e-184
WP_000779084.1|2714209_2715286_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 183
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2721179	2722082	5302688	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140553.1|2721179_2722082_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	9.6e-69
>prophage 184
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2725234	2730238	5302688		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|2725234_2725837_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001386945.1|2726144_2727284_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.3	1.9e-29
WP_000461657.1|2727287_2728256_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860259.1|2728255_2730238_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 185
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2764655	2767883	5302688		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|2764655_2765255_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|2765313_2767146_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203399.1|2767232_2767883_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
>prophage 186
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2778442	2780315	5302688		Sodalis_phage(50.0%)	2	NA	NA
WP_000156113.1|2778442_2779345_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
WP_001293612.1|2779541_2780315_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 187
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2784526	2786044	5302688		Mollivirus(100.0%)	1	NA	NA
WP_000334218.1|2784526_2786044_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.0e-86
>prophage 188
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2790629	2855661	5302688	head,protease,integrase,terminase,tRNA,portal,transposase	Enterobacteria_phage(44.44%)	67	2820434:2820450	2858114:2858130
WP_001283590.1|2790629_2791442_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|2791441_2792455_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699126.1|2792520_2793657_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.6e-23
WP_000615821.1|2793755_2794751_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|2794747_2795926_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2796209_2797430_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683791.1|2797588_2799595_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2799715_2799994_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|2800027_2800576_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2800575_2801385_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043820.1|2801384_2802209_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2802212_2803298_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|2803332_2804265_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730807.1|2804430_2804982_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000399648.1|2805175_2806156_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001323815.1|2806382_2807240_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|2807241_2807766_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|2807762_2808233_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000678664.1|2808229_2808736_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|2808752_2809505_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112829.1|2809524_2812167_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2812248_2812812_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2813486_2813972_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426166.1|2814174_2816319_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531990.1|2816318_2817629_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|2817808_2818093_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2818464_2819805_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937848.1|2820170_2821229_+	hypothetical protein	NA	NA	NA	NA	NA
2820434:2820450	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000776768.1|2821410_2822166_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2822459_2823392_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958672.1|2823703_2824861_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.3e-221
WP_000178979.1|2825089_2827000_+	acyltransferase	NA	C6ZR20	Salmonella_phage	32.6	4.7e-57
WP_000129924.1|2827070_2829050_-	hypothetical protein	NA	A5VW57	Enterobacteria_phage	93.5	6.2e-60
WP_000835342.1|2829150_2830029_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.1	5.8e-95
WP_000865490.1|2830261_2830402_-	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
WP_001283829.1|2830507_2830759_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	93.9	1.5e-35
WP_000820795.1|2830755_2831070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749286.1|2831095_2831581_+	lipoprotein	NA	NA	NA	NA	NA
WP_001387755.1|2831595_2833440_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	73.8	4.0e-247
WP_000246924.1|2833439_2834906_-	DNA transfer protein	NA	B6SCW4	Bacteriophage	62.0	8.4e-139
WP_000964882.1|2834915_2835608_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000614045.1|2835610_2836066_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	5.7e-86
WP_000785547.1|2836065_2836914_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.5	3.4e-100
WP_001122379.1|2836913_2838332_-	Packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.9	3.9e-274
WP_000246749.1|2838340_2838823_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	99.4	8.4e-88
WP_000375637.1|2838797_2838983_-	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_001133485.1|2839025_2840297_-|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	1.2e-239
WP_000426730.1|2840308_2841193_-	hypothetical protein	NA	Q716H1	Shigella_phage	99.0	2.0e-143
WP_000852331.1|2841206_2843333_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.2	0.0e+00
WP_000200769.1|2843335_2844748_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	9.8e-278
WP_000113732.1|2844744_2845185_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000807788.1|2845187_2845430_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000638547.1|2846476_2846608_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2846592_2846745_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000031367.1|2847001_2847607_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000951329.1|2847606_2847990_+	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	1.2e-65
WP_001111297.1|2848013_2848310_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	98.0	1.9e-50
WP_000855556.1|2848320_2848611_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	99.0	2.4e-45
WP_001214454.1|2848607_2848775_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_000034245.1|2848771_2849443_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	73.2	3.0e-83
WP_000951713.1|2849805_2850015_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000208008.1|2850011_2850641_+	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	58.6	1.1e-55
WP_001277767.1|2850737_2850917_+	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_001163428.1|2851048_2851249_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001197025.1|2851778_2853026_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|2853097_2854012_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|2854227_2855661_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
2858114:2858130	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 189
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2862302	2869879	5302688		Hokovirus(50.0%)	4	NA	NA
WP_001307321.1|2862302_2865896_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001296867.1|2865951_2867097_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|2867170_2868115_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283505.1|2868184_2869879_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.4	2.3e-23
>prophage 190
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2873570	2874491	5302688		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|2873570_2874491_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 191
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2878309	2880659	5302688	transposase	Clostridioides_phage(50.0%)	2	NA	NA
WP_001295458.1|2878309_2879044_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_000019460.1|2879678_2880659_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.0e-184
>prophage 192
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2905937	2921307	5302688		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|2905937_2907953_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001297862.1|2908023_2909010_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254843.1|2909239_2910001_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|2910185_2911157_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|2911540_2911798_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623131.1|2911842_2913570_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.3	2.8e-16
WP_000522247.1|2913610_2914120_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096625.1|2914161_2915013_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|2915117_2915486_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|2915488_2916400_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021040.1|2916533_2917631_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852685.1|2917620_2918496_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|2918495_2919329_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290223.1|2919328_2920345_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517431.1|2920515_2921307_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 193
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2924785	2929721	5302688		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001390282.1|2924785_2926090_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|2926145_2927045_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|2927140_2927716_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001300381.1|2927776_2928226_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|2928212_2928638_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|2928851_2929721_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 194
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2948475	2949426	5302688		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|2948475_2949426_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 195
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2967474	2968188	5302688		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2967474_2968188_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 196
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2989480	2993482	5302688		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|2989480_2990770_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|2990855_2991482_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|2991806_2992844_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|2992843_2993482_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 197
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	2999916	3006211	5302688		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|2999916_3000090_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|3000403_3000919_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_000755173.1|3000934_3001474_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138282.1|3001566_3003144_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|3003212_3004679_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937933.1|3004840_3006211_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
>prophage 198
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3015040	3015472	5302688		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|3015040_3015472_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 199
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3025357	3031814	5302688		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133582.1|3025357_3026641_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|3026818_3027019_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|3027030_3027366_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|3027367_3029218_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384411.1|3029234_3029750_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|3029845_3030169_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|3030185_3030572_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|3030599_3031814_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 200
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3046950	3048462	5302688		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493461.1|3046950_3048462_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 201
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3054220	3065528	5302688		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|3054220_3055474_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|3055801_3056992_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|3057036_3057375_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|3057435_3058770_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215888.1|3058759_3059473_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|3059637_3061065_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970109.1|3061640_3065528_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	7.7e-131
>prophage 202
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3069647	3069908	5302688		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|3069647_3069908_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 203
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3073366	3077109	5302688		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|3073366_3074047_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|3074319_3075294_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|3075309_3077109_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 204
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3082880	3089138	5302688	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|3082880_3084215_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001386989.1|3084423_3085305_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189206.1|3085407_3085995_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3086049_3086433_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3086737_3087427_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997411.1|3087474_3088512_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3088718_3089138_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 205
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3094431	3095730	5302688		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|3094431_3095730_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 206
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3101595	3104169	5302688		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|3101595_3104169_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 207
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3110075	3111146	5302688		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168054.1|3110075_3111146_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
>prophage 208
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3124780	3127287	5302688	integrase	Staphylococcus_phage(50.0%)	2	3121586:3121598	3127399:3127411
3121586:3121598	attL	TTATTCTAATTTT	NA	NA	NA	NA
WP_000162574.1|3124780_3125263_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000113815.1|3126045_3127287_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	4.5e-101
3127399:3127411	attR	TTATTCTAATTTT	NA	NA	NA	NA
>prophage 209
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3137711	3140647	5302688	transposase	Vibrio_phage(33.33%)	5	NA	NA
WP_001367084.1|3137711_3137951_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
WP_001283984.1|3138116_3138416_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_085947772.1|3138436_3139649_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001120794.1|3140154_3140274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524581.1|3140428_3140647_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	68.0	6.0e-09
>prophage 210
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3150098	3154223	5302688		Klosneuvirus(50.0%)	4	NA	NA
WP_000097641.1|3150098_3151379_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_001325764.1|3151689_3153090_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|3153110_3153773_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|3153773_3154223_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 211
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3158158	3163454	5302688		Oenococcus_phage(20.0%)	5	NA	NA
WP_000028864.1|3158158_3158404_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080944.1|3158400_3158811_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_000246520.1|3158783_3160928_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	2.4e-195
WP_000777969.1|3160937_3161897_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|3162251_3163454_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 212
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3176538	3182098	5302688	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|3176538_3176724_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047179.1|3176958_3179589_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|3179716_3180217_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|3180459_3181521_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|3181600_3182098_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 213
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3187564	3188530	5302688		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287446.1|3187564_3188530_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 214
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3196103	3197117	5302688		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000989159.1|3196103_3197117_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 215
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3217463	3224603	5302688		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3217463_3220025_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141316.1|3220130_3220787_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
WP_001297141.1|3220837_3221605_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3221800_3222709_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3222705_3223968_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3223964_3224603_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 216
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3229818	3233534	5302688		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|3229818_3230811_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|3230873_3232013_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3232152_3232779_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3232772_3233534_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 217
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3236646	3238679	5302688		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|3236646_3237252_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090348.1|3237251_3238679_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	2.2e-30
>prophage 218
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3263572	3264358	5302688		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|3263572_3264358_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 219
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3269258	3274178	5302688		Vibrio_phage(33.33%)	4	NA	NA
WP_001199977.1|3269258_3269930_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288227.1|3270068_3270209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000036723.1|3271154_3272453_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|3272540_3274178_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 220
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3278210	3282325	5302688		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046785.1|3278210_3279512_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
WP_000186450.1|3279568_3282325_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 221
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3289859	3290708	5302688		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|3289859_3290708_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 222
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3295566	3296322	5302688		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|3295566_3296322_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 223
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3307848	3323233	5302688	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001300698.1|3307848_3309054_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
WP_000184254.1|3309053_3309497_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|3309547_3310354_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|3310430_3311528_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|3312105_3313359_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|3313590_3314922_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775955.1|3314983_3316810_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_001286001.1|3316809_3320352_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	22.0	1.4e-09
WP_001138213.1|3320344_3323233_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.2e-67
>prophage 224
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3328710	3335483	5302688		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|3328710_3329505_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|3329511_3330387_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|3330537_3332784_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|3332796_3333327_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|3334011_3334701_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|3334769_3335483_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 225
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3345114	3347609	5302688		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|3345114_3346533_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603508.1|3346847_3347609_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
>prophage 226
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3370487	3371243	5302688		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|3370487_3371243_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 227
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3395522	3410914	5302688	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280215.1|3395522_3396923_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|3396940_3398257_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|3398292_3399660_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|3399695_3400184_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001345944.1|3400183_3402103_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001387029.1|3402538_3403987_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|3403988_3404114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|3404110_3404182_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192813.1|3404236_3404785_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|3404827_3406345_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|3406354_3407453_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813220.1|3407543_3409277_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715208.1|3409282_3409993_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|3410017_3410914_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 228
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3414720	3420088	5302688		Pandoravirus(50.0%)	3	NA	NA
WP_001387034.1|3414720_3416154_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	4.4e-31
WP_000951964.1|3416210_3416954_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195023.1|3417214_3420088_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
>prophage 229
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3428616	3429849	5302688		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3428616_3429849_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 230
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3447855	3448533	5302688		Bacillus_virus(100.0%)	1	NA	NA
WP_000956868.1|3447855_3448533_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	6.4e-09
>prophage 231
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3462109	3539059	5302688	plate,protease,integrase,tRNA,transposase	Escherichia_phage(18.75%)	56	3477728:3477746	3540732:3540750
WP_001062128.1|3462109_3463264_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3463699_3465094_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_000858396.1|3465170_3465668_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3465762_3466470_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|3466549_3467281_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3467293_3468244_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3468352_3468916_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3468915_3469332_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001349546.1|3469507_3470488_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3470505_3471210_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3471227_3471794_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3471790_3472081_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|3472088_3472682_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239939.1|3472674_3473811_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|3473965_3474973_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|3475089_3476136_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3476311_3477031_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3477214_3477541_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3477540_3478260_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
3477728:3477746	attL	GCCATATGGAATACGCCCC	NA	NA	NA	NA
WP_001297399.1|3478420_3479473_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3479500_3479776_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|3479840_3480920_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3481121_3482378_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000839766.1|3482427_3484563_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|3484960_3485668_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218809.1|3486046_3487309_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_071530044.1|3488806_3489022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000286652.1|3490292_3493142_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
WP_001273465.1|3493167_3494148_+	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
WP_000126413.1|3494157_3496545_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000105162.1|3496554_3498183_+	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
WP_000081335.1|3498185_3501056_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001091149.1|3501144_3501438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000747051.1|3501507_3501858_+|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
WP_001254936.1|3501777_3502929_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
WP_001189118.1|3504091_3505600_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001045650.1|3506327_3510446_+|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
WP_001309734.1|3511417_3511852_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|3511848_3512199_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000080172.1|3512229_3513843_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_000019440.1|3514026_3515007_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_077577697.1|3515374_3515737_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
WP_000555380.1|3515776_3516910_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000359994.1|3518224_3519379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001391950.1|3519857_3520076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000029846.1|3523589_3526139_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.8	4.6e-92
WP_000914956.1|3526142_3529547_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_001028113.1|3529552_3530143_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001154665.1|3530481_3531894_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000152746.1|3531912_3532464_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_001033155.1|3532471_3533548_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001390299.1|3533551_3533851_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_000005080.1|3533860_3534328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000198270.1|3534338_3536321_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	35.6	2.2e-12
WP_001173975.1|3536333_3537266_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001390300.1|3537256_3539059_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
3540732:3540750	attR	GCCATATGGAATACGCCCC	NA	NA	NA	NA
>prophage 232
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3548718	3549963	5302688		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000897032.1|3548718_3549963_-	chromosome segregation ATPase	NA	Q9MC01	Enterobacteria_phage	60.6	8.1e-66
>prophage 233
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3568406	3570800	5302688		Yersinia_phage(33.33%)	4	NA	NA
WP_001234603.1|3568406_3569225_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.0	6.7e-45
WP_000855081.1|3569526_3570000_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.6	9.7e-12
WP_001388380.1|3570015_3570492_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692350.1|3570578_3570800_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 234
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3604134	3605307	5302688		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|3604134_3605307_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 235
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3628799	3629684	5302688		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|3628799_3629684_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 236
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3635527	3646350	5302688		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013149.1|3635527_3636355_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691598.1|3636554_3637481_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|3637531_3637789_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|3637831_3640051_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|3640161_3641574_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965703.1|3641648_3642386_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|3642618_3644877_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000183494.1|3645422_3645905_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|3645957_3646350_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 237
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3650177	3661139	5302688		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|3650177_3652070_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|3652098_3652680_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|3652679_3653507_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3653531_3653954_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3653954_3654584_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|3654788_3656270_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|3656417_3657089_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442859.1|3657094_3658255_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188373.1|3658292_3659108_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|3659223_3659997_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|3660054_3660225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|3660485_3661139_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 238
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3670654	3672088	5302688		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3670654_3672088_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 239
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3677225	3678464	5302688	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708500.1|3677225_3678464_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 240
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3684848	3701031	5302688	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|3684848_3685862_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|3686098_3686314_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|3686424_3688170_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|3688364_3690206_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|3690283_3690790_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065895.1|3691043_3691808_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018000.1|3692084_3692708_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094682.1|3692861_3694382_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000627213.1|3694688_3696179_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450589.1|3696220_3696553_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212470.1|3696771_3697755_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082869.1|3697938_3701031_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	2.6e-158
>prophage 241
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3713452	3714418	5302688		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|3713452_3714418_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 242
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3740485	3742780	5302688		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|3740485_3742780_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 243
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3752378	3753524	5302688		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|3752378_3753524_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 244
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3776531	3784324	5302688		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809253.1|3776531_3777392_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
WP_000249157.1|3777455_3779492_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246855.1|3779449_3779845_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|3779864_3780455_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|3780464_3781040_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147579.1|3781153_3782194_-	permease	NA	NA	NA	NA	NA
WP_001298741.1|3782266_3782902_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|3783029_3783548_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|3783527_3783971_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189314.1|3784021_3784324_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 245
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3790151	3792041	5302688		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3790151_3792041_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 246
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3797522	3804161	5302688		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|3797522_3800195_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|3800219_3801707_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|3801734_3802187_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207685.1|3802817_3804161_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 247
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3808241	3811114	5302688	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|3808241_3809090_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|3809179_3811114_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 248
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3817742	3819220	5302688		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|3817742_3818714_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|3818941_3819220_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 249
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3823288	3838082	5302688		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|3823288_3824098_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922861.1|3824307_3825285_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|3825298_3826285_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|3826305_3826872_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|3826868_3827444_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|3827412_3827970_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|3827976_3828702_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|3828749_3830183_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|3830205_3830493_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|3830610_3831102_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|3831147_3832002_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|3831998_3832271_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620387.1|3832483_3833116_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047103.1|3833112_3833841_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001299134.1|3833837_3834491_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|3834720_3837057_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001176896.1|3837152_3838082_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 250
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3847778	3849269	5302688		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|3847778_3849269_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 251
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3852973	3853471	5302688	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3852973_3853471_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 252
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3857437	3859962	5302688	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|3857437_3858805_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497724.1|3858894_3859962_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 253
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3876458	3877502	5302688		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3876458_3877502_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 254
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3888067	3888952	5302688		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258898.1|3888067_3888952_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 255
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3895456	3899610	5302688		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|3895456_3896482_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_000019655.1|3896549_3897731_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001299298.1|3897740_3898844_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078322.1|3898851_3899610_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-19
>prophage 256
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3910113	3911585	5302688	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|3910113_3910623_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004454.1|3910637_3911585_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 257
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3931462	3937036	5302688		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|3931462_3932647_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|3932717_3934832_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|3934928_3935399_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|3935495_3935870_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|3935995_3936283_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820720.1|3936290_3936650_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209689.1|3936649_3937036_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
>prophage 258
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3942606	3952147	5302688		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|3942606_3944520_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057405.1|3944519_3945542_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|3945535_3945754_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|3945807_3946677_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|3946731_3947136_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|3947437_3948070_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|3948120_3950211_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963784.1|3950277_3951498_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|3951583_3952147_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 259
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3976374	3977211	5302688		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|3976374_3977211_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 260
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	3994189	3998699	5302688		Bacillus_phage(66.67%)	5	NA	NA
WP_001265681.1|3994189_3995812_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_000493756.1|3995928_3996246_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000650975.1|3996304_3996601_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001253694.1|3996630_3997983_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|3997979_3998699_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 261
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4005262	4006141	5302688		Sodalis_phage(100.0%)	1	NA	NA
WP_000039059.1|4005262_4006141_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	2.7e-68
>prophage 262
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4012110	4014504	5302688		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|4012110_4014504_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 263
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4018883	4020110	5302688		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105505.1|4018883_4020110_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.8	4.4e-133
>prophage 264
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4029338	4031786	5302688		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|4029338_4031786_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 265
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4051796	4053607	5302688		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073609.1|4051796_4052540_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	8.3e-10
WP_000907790.1|4052536_4053607_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 266
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4057147	4058630	5302688		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|4057147_4057861_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|4057862_4058630_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 267
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4064363	4067182	5302688		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|4064363_4065218_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|4065462_4066521_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|4066513_4067182_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 268
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4070185	4074317	5302688		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|4070185_4070812_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106527.1|4070885_4073084_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	5.0e-119
WP_000130621.1|4073185_4073431_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|4073651_4074317_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 269
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4082210	4088093	5302688		Bacillus_virus(50.0%)	5	NA	NA
WP_000173630.1|4082210_4083017_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
WP_001190062.1|4083022_4083424_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593555.1|4083543_4083903_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001216257.1|4084233_4085358_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000149085.1|4085357_4088093_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 270
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4095778	4097856	5302688		Bacillus_phage(100.0%)	2	NA	NA
WP_001211179.1|4095778_4097179_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_001188930.1|4097175_4097856_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 271
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4102950	4106407	5302688		Listeria_phage(50.0%)	3	NA	NA
WP_000287501.1|4102950_4103688_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_000843494.1|4103721_4103919_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001353604.1|4103959_4106407_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.3	1.3e-83
>prophage 272
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4113579	4116908	5302688		Bacillus_phage(66.67%)	4	NA	NA
WP_000697968.1|4113579_4114260_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000555736.1|4114252_4115734_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000790485.1|4115978_4116410_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000647571.1|4116557_4116908_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
>prophage 273
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4120943	4123369	5302688	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_001309734.1|4120943_4121378_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|4121374_4121725_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000080172.1|4121755_4123369_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
>prophage 274
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4136505	4138548	5302688		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|4136505_4138548_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 275
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4141893	4144028	5302688		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|4141893_4142247_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_001347664.1|4142300_4143590_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	2.1e-173
WP_000065786.1|4143602_4144028_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
>prophage 276
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4148920	4149568	5302688		Bacillus_virus(100.0%)	1	NA	NA
WP_001307446.1|4148920_4149568_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 277
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4188638	4190623	5302688		Bacillus_virus(50.0%)	2	NA	NA
WP_000107024.1|4188638_4189643_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|4189639_4190623_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 278
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4206203	4208537	5302688		Escherichia_phage(100.0%)	1	NA	NA
WP_000013914.1|4206203_4208537_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.0	2.7e-70
>prophage 279
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4212191	4212404	5302688		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|4212191_4212404_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 280
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4216628	4217624	5302688		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|4216628_4217624_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 281
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4222942	4224484	5302688		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|4222942_4224484_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 282
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4245742	4247587	5302688		Tupanvirus(100.0%)	1	NA	NA
WP_000582465.1|4245742_4247587_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.6	1.8e-16
>prophage 283
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4255599	4256433	5302688		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001346013.1|4255599_4256433_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
>prophage 284
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4278558	4289287	5302688		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|4278558_4278810_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|4278951_4279383_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001299251.1|4279627_4281172_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|4281181_4282465_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483860.1|4282468_4283428_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982078.1|4283414_4284449_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_000646014.1|4284687_4285713_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213855.1|4285722_4286919_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	7.1e-35
WP_001307464.1|4287193_4288066_-	protein YibB	NA	NA	NA	NA	NA
WP_000587764.1|4288354_4289287_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 285
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4301218	4305781	5302688		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|4301218_4301698_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114546.1|4301736_4302546_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.5	1.5e-25
WP_001051798.1|4302643_4302811_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|4302831_4303068_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001298959.1|4303284_4303953_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050117.1|4304124_4305345_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	5.0e-44
WP_001298007.1|4305325_4305781_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 286
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4309154	4346825	5302688	tRNA,transposase,integrase	Escherichia_phage(25.0%)	32	4333719:4333778	4338972:4339792
WP_001297374.1|4309154_4309979_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
WP_000924289.1|4310270_4310888_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000870052.1|4310884_4312567_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	2.5e-22
WP_001295237.1|4312824_4313448_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|4313502_4313778_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|4313796_4315905_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_001070193.1|4315911_4316601_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_000678443.1|4316606_4318688_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000468836.1|4318853_4320059_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|4320338_4321730_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_001307467.1|4321850_4323560_+	AsmA family protein	NA	NA	NA	NA	NA
WP_000702903.1|4323612_4325931_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_000834439.1|4325940_4327323_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_001218908.1|4328009_4329194_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_000656307.1|4330043_4330133_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|4330199_4333166_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_001137316.1|4333168_4333723_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
4333719:4333778	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|4333781_4334486_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000259029.1|4334519_4335299_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_000679427.1|4335292_4335640_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000703418.1|4335869_4336343_-	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000845048.1|4336500_4337514_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|4337716_4338067_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|4338263_4338968_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|4339014_4339416_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|4339565_4340426_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
4338972:4339792	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCATATCAAGCGACTTCTCCTATCCCCTGGGAACACATCAATCTCACCGGAGAATATCGCTGGCCAAAGCCTTAGCGTAGGATTCCGCCCCTTCCCGCAAACGACCCCAAACAGGAAACGCAGCTGAAACGGGAAGCTCAACACCCACTGACGCATGGGTTGTTCAGGCAGTACTTCATCAACCAGCAAGGCGGCACTTTCGGCCATCCGCCGCGCCCCACAGCTCGGGCAGAAACCGCGACGCTTACAGCTGAAAGCGACCAGGTGCTCGGCGTGGCAAGACTCGCAGCGAACCCGTAGAAAGCCATGCTCCAGCCGCCCGCATTGGAGAAATTCTTCAAATTCCCGTTGCACATAGCCCGGCAATTCCTTTCCCTGCTCTGCCATAAGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTAT	NA	NA	NA	NA
WP_001067855.1|4340925_4341630_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|4342385_4343237_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|4343544_4344360_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|4344420_4345224_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4345223_4346060_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|4346120_4346825_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 287
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4360604	4363011	5302688		Yersinia_phage(33.33%)	4	NA	NA
WP_001234716.1|4360604_4361423_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	8.0e-46
WP_001387789.1|4361761_4362235_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	4.3e-12
WP_001186773.1|4362250_4362727_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692300.1|4362789_4363011_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
>prophage 288
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4371895	4373230	5302688		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|4371895_4373230_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 289
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4380534	4389695	5302688		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168480.1|4380534_4382223_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001315912.1|4382328_4382427_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|4382991_4383081_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|4383499_4384684_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148063.1|4384691_4385189_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|4385185_4385548_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|4385537_4385885_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511287.1|4385993_4386443_+	membrane protein	NA	NA	NA	NA	NA
WP_000828483.1|4386489_4387983_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_001087135.1|4387979_4389695_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 290
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4396825	4397779	5302688		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|4396825_4397254_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|4397365_4397779_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 291
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4402206	4403355	5302688		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|4402206_4403355_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 292
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4408061	4415430	5302688		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|4408061_4410476_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|4410504_4411578_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|4411577_4412678_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|4412682_4414086_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|4414382_4414463_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|4414692_4414833_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|4414849_4415209_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|4415172_4415430_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 293
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4425629	4426967	5302688		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|4425629_4426967_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 294
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4437957	4441798	5302688		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|4437957_4438731_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|4438821_4439712_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|4439711_4440671_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|4440757_4441798_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 295
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4447329	4450691	5302688		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334099.1|4447329_4449159_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933720.1|4449320_4450691_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	6.9e-34
>prophage 296
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4462643	4463636	5302688		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845133.1|4462643_4463636_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 297
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4466804	4472657	5302688		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|4466804_4468673_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|4468839_4469259_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387753.1|4469266_4470772_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_000211858.1|4470776_4471742_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|4471766_4472657_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 298
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4486048	4487695	5302688		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012602.1|4486048_4487695_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	1.4e-65
>prophage 299
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4496168	4501580	5302688		Bacillus_phage(33.33%)	4	NA	NA
WP_001238897.1|4496168_4498190_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	8.4e-113
WP_001384924.1|4498236_4499721_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|4499854_4501120_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|4501250_4501580_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 300
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4505622	4511766	5302688		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866673.1|4505622_4506753_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.0	1.9e-26
WP_000006625.1|4506749_4508012_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226604.1|4508011_4509079_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000676056.1|4509097_4509979_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145196.1|4509956_4510631_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|4510635_4511766_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 301
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4528081	4530882	5302688		Salmonella_phage(100.0%)	2	NA	NA
WP_001014280.1|4528081_4529407_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	33.6	6.3e-08
WP_001300182.1|4529403_4530882_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
>prophage 302
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4533918	4537777	5302688		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|4533918_4534815_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|4534814_4535531_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|4535614_4537777_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 303
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4545283	4547113	5302688		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|4545283_4547113_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 304
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4559525	4562812	5302688		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|4559525_4561166_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|4561244_4561514_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|4561517_4562033_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|4562035_4562812_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 305
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4571602	4572217	5302688		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|4571602_4572217_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 306
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4585906	4588693	5302688		uncultured_virus(100.0%)	1	NA	NA
WP_000250015.1|4585906_4588693_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	1.1e-70
>prophage 307
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4592771	4595242	5302688		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188776.1|4592771_4594181_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|4594192_4595242_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 308
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4602525	4607256	5302688		Escherichia_phage(33.33%)	5	NA	NA
WP_000022286.1|4602525_4603314_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_000160872.1|4603353_4604250_-	sugar kinase	NA	NA	NA	NA	NA
WP_001299483.1|4604422_4605301_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.7e-47
WP_000094544.1|4605325_4606213_+	aldolase	NA	NA	NA	NA	NA
WP_000357967.1|4606245_4607256_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 309
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4619981	4623032	5302688		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|4619981_4623032_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 310
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4637807	4642668	5302688		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|4637807_4638428_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|4638687_4639671_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|4639819_4640494_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4640599_4641973_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4641969_4642668_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 311
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4654243	4658747	5302688		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|4654243_4655089_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4655514_4655760_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4655844_4656330_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001307494.1|4656422_4657349_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|4657415_4658747_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 312
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4664384	4668569	5302688		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000015046.1|4664384_4668569_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	4.7e-25
>prophage 313
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4681435	4688682	5302688		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424845.1|4681435_4682098_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174096.1|4682109_4684611_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.8e-11
WP_001004434.1|4684919_4685999_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|4686013_4686334_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184831.1|4686384_4688682_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 314
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4700865	4702080	5302688		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690934.1|4700865_4702080_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
>prophage 315
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4708829	4710674	5302688		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591366.1|4708829_4710674_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 316
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4719180	4722233	5302688		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|4719180_4720131_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|4721048_4722233_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 317
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4726349	4734678	5302688		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|4726349_4730378_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|4730454_4734678_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 318
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4743894	4745658	5302688		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|4743894_4744566_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|4744608_4745199_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|4745385_4745658_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 319
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4751026	4752616	5302688		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|4751026_4752616_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 320
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4767991	4771675	5302688		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|4767991_4771675_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 321
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4777324	4778116	5302688		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130540.1|4777324_4778116_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.6	7.7e-46
>prophage 322
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4793978	4795094	5302688		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|4793978_4795094_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 323
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4804218	4804827	5302688		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|4804218_4804827_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 324
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4811425	4813973	5302688		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|4811425_4812841_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|4812893_4813973_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 325
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4818180	4821793	5302688		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357745.1|4818180_4821003_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|4821256_4821793_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 326
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4825610	4826960	5302688		Moraxella_phage(100.0%)	1	NA	NA
WP_000106879.1|4825610_4826960_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	2.3e-159
>prophage 327
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4832543	4834502	5302688		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|4832543_4834502_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 328
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4843784	4845932	5302688		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|4843784_4845932_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 329
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4851177	4853163	5302688		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001307516.1|4851177_4853163_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 330
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4857148	4858764	5302688		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611428.1|4857148_4857829_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001039800.1|4858005_4858764_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
>prophage 331
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4864368	4865157	5302688		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|4864368_4865157_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 332
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4869996	4871499	5302688		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|4869996_4871499_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 333
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4892695	4944632	5302688	tRNA,protease,transposase	Enterobacteria_phage(28.57%)	34	NA	NA
WP_001295074.1|4892695_4894213_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856837.1|4894449_4895907_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	5.2e-48
WP_001295383.1|4895965_4898113_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|4898192_4899527_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187182.1|4899892_4901431_-	DNA-binding transcriptional activator CadC	NA	NA	NA	NA	NA
WP_001290187.1|4902179_4903022_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772029.1|4903106_4903304_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761715.1|4903323_4903812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094430.1|4903808_4904186_-	toxin	NA	NA	NA	NA	NA
WP_001285620.1|4904232_4904610_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692350.1|4904689_4904911_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001387238.1|4904997_4905474_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855057.1|4905489_4905963_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.1e-12
WP_032142224.1|4907218_4907590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189118.1|4907898_4909407_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001045650.1|4910134_4914253_+|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
WP_001390760.1|4915414_4916539_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.3e-199
WP_085970120.1|4917116_4918329_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
WP_000555385.1|4918369_4919512_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001387604.1|4920251_4921178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074478.1|4921127_4922321_-	MFS transporter	NA	NA	NA	NA	NA
WP_001387605.1|4922456_4924181_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287497.1|4924181_4925129_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015710.1|4925128_4926871_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750143.1|4926867_4928205_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001387241.1|4928210_4930406_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001189118.1|4931370_4932879_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_032142224.1|4933187_4933559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422750.1|4934564_4934990_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
WP_001309734.1|4937529_4937964_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|4937960_4938311_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000080172.1|4938341_4939955_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_000291751.1|4940146_4940728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034110.1|4940774_4944632_-|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
>prophage 334
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4951071	4952334	5302688	integrase	Enterobacteria_phage(100.0%)	1	4948385:4948398	4955233:4955246
4948385:4948398	attL	TTTTTCCGCCAGCA	NA	NA	NA	NA
WP_001218804.1|4951071_4952334_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
WP_001218804.1|4951071_4952334_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
4955233:4955246	attR	TTTTTCCGCCAGCA	NA	NA	NA	NA
>prophage 335
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4960668	4962652	5302688		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|4960668_4960962_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4961005_4962652_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 336
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4967163	4967697	5302688		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|4967163_4967697_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 337
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4972617	4973595	5302688		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|4972617_4973595_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 338
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4981578	4982124	5302688		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|4981578_4982124_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 339
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	4986039	5053931	5302688	tRNA,protease,transposase	Vibrio_phage(23.08%)	68	NA	NA
WP_000990321.1|4986039_4987377_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122523.1|4987386_4989234_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.6	2.6e-60
WP_001280345.1|4989226_4990177_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|4990262_4990571_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|4990647_4991928_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312490.1|4992013_4993273_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4993275_4994280_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4994361_4994559_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4994662_4995961_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|4996165_4996591_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|4996629_4999071_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|4999250_4999982_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|5000108_5000510_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|5000528_5001227_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|5001277_5001937_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000101644.1|5002362_5003001_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943976.1|5003003_5004167_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
WP_001339483.1|5004250_5005876_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5005992_5006268_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|5006416_5006746_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569708.1|5006927_5007677_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5007673_5008429_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|5008536_5009601_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|5009955_5011353_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5011368_5011674_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|5011683_5012148_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5012161_5012812_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949539.1|5012821_5013676_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001170812.1|5013675_5014362_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000996728.1|5014458_5015010_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000492914.1|5015084_5015360_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5015686_5016082_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5016088_5016403_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5016407_5016635_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5016676_5017126_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001351393.1|5017196_5017991_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|5018613_5019045_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_000826425.1|5019052_5020261_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_001119478.1|5020395_5021034_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5021252_5021873_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5022181_5023594_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|5023638_5024301_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001296686.1|5024408_5025374_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560563.1|5025481_5026342_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5026430_5026811_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589423.1|5026939_5028883_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|5029072_5029813_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|5029802_5030360_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5030684_5030891_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|5030952_5032296_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|5032618_5033257_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5033462_5035196_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060946.1|5035192_5038972_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5038974_5039316_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|5039527_5039779_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|5039772_5040123_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055072.1|5040202_5040733_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|5041042_5041999_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205794.1|5042308_5043811_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001387274.1|5043824_5044847_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595979.1|5044833_5045829_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|5045861_5046860_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219816.1|5047035_5048409_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5048559_5049111_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5049204_5050557_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232244.1|5050739_5051126_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106222.1|5051170_5051635_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
WP_000187798.1|5051792_5053931_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 340
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5057578	5064954	5302688	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	7	NA	NA
WP_001181324.1|5057578_5058526_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|5058710_5058764_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471902.1|5058904_5061601_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	3.4e-45
WP_000399648.1|5061828_5062809_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000047539.1|5063085_5063472_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|5063544_5064006_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013042.1|5064018_5064954_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	3.8e-52
>prophage 341
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5074010	5083024	5302688	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416381.1|5074010_5076866_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_001188289.1|5076865_5077348_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|5077442_5078954_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|5079220_5080321_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|5080320_5081403_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294559.1|5081521_5083024_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.0e-83
>prophage 342
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5088153	5089173	5302688		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000061766.1|5088153_5089173_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
>prophage 343
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5106341	5110160	5302688	transposase	Enterobacteria_phage(100.0%)	5	NA	NA
WP_000416151.1|5106341_5107373_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916805.1|5107643_5108087_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705930.1|5108102_5108390_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|5108402_5109659_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|5109905_5110160_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
>prophage 344
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5116142	5124539	5302688	transposase	Stx2-converting_phage(40.0%)	8	NA	NA
WP_000080200.1|5116142_5117756_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000624722.1|5117786_5118137_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|5118133_5118559_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001422798.1|5118697_5118826_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145474.1|5119006_5119663_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625669.1|5119908_5121186_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|5121248_5123246_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088357.1|5123399_5124539_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
>prophage 345
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5130192	5134891	5302688		Pseudomonas_phage(33.33%)	4	NA	NA
WP_001189126.1|5130192_5131701_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000177057.1|5132351_5132609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|5133166_5133934_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|5133934_5134891_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 346
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5144234	5146394	5302688	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000998014.1|5144234_5145620_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.4e-257
WP_000612591.1|5145669_5146017_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001390365.1|5146013_5146394_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	3.9e-64
>prophage 347
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5156861	5158322	5302688		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208220.1|5156861_5158322_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	3.6e-49
>prophage 348
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5164889	5165444	5302688		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|5164889_5165444_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 349
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5172945	5173902	5302688	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181142.1|5172945_5173902_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.5	2.7e-61
>prophage 350
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5180432	5184401	5302688		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001387312.1|5180432_5181902_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
WP_000819019.1|5181968_5184401_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
>prophage 351
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5190227	5195592	5302688		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919540.1|5190227_5191892_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410144.1|5191940_5193302_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|5193516_5194431_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106033.1|5194569_5195592_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 352
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5198820	5200100	5302688		Shigella_phage(50.0%)	2	NA	NA
WP_000799913.1|5198820_5199558_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.4	4.9e-63
WP_000098818.1|5199560_5200100_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 353
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5208039	5210915	5302688		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|5208039_5209629_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295410.1|5210021_5210627_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5210753_5210915_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 354
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5216618	5217941	5302688		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477808.1|5216618_5217941_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
>prophage 355
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5224684	5230039	5302688		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093810.1|5224684_5225917_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|5226223_5227891_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409453.1|5228101_5230039_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.7	2.3e-11
>prophage 356
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5233270	5235384	5302688		Bacillus_phage(50.0%)	2	NA	NA
WP_001188659.1|5233270_5233960_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219611.1|5233959_5235384_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
>prophage 357
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5247153	5256222	5302688		Cyanophage(20.0%)	9	NA	NA
WP_000130189.1|5247153_5248107_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|5248221_5248809_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|5248843_5249410_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102379.1|5249558_5250272_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843559.1|5250297_5250702_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|5251078_5252995_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|5253083_5254214_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001386573.1|5254317_5254527_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	4.0e-18
WP_000681360.1|5255055_5256222_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 358
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5263255	5266072	5302688	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|5263255_5266072_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 359
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5270478	5271627	5302688		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|5270478_5271627_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 360
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5277097	5282758	5302688		Hepacivirus(50.0%)	4	NA	NA
WP_001386575.1|5277097_5278651_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.2	2.3e-30
WP_000349932.1|5278724_5279942_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|5280070_5281213_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|5281243_5282758_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 361
NZ_CP041002	Escherichia coli strain FDAARGOS_772 chromosome, complete genome	5302688	5290653	5292053	5302688		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|5290653_5291133_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257192.1|5291210_5292053_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 1
NZ_CP041001	Escherichia coli strain FDAARGOS_772 plasmid unnamed1, complete sequence	75555	1586	64638	75555	transposase,integrase,protease	Stx2-converting_phage(29.63%)	56	35632:35691	73787:73854
WP_001390477.1|1586_2234_+|protease	serine protease	protease	Q9LA58	Enterobacterial_phage	43.1	6.1e-33
WP_001390480.1|2205_3381_+|protease	serine protease	protease	Q9LA58	Enterobacterial_phage	46.8	4.2e-72
WP_000239755.1|3352_3589_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	63.8	2.0e-18
WP_001387329.1|3731_3980_-|transposase	IS3 family transposase	transposase	A0A0N7BVE9	Escherichia_phage	82.4	1.2e-24
WP_000209219.1|4359_5490_+	dispersin export ABC transporter permease subunit AatP	NA	NA	NA	NA	NA
WP_001216021.1|5486_6725_+	dispersin export ABC transporter outer membrane protein AatA	NA	NA	NA	NA	NA
WP_000810824.1|6621_7443_+	dispersin export-associated protein AatB	NA	NA	NA	NA	NA
WP_000621743.1|7435_8065_+	dispersin export ABC transporter ATP-binding protein AatC	NA	G9BWD6	Planktothrix_phage	35.4	1.2e-20
WP_000673201.1|8081_9293_+	dispersin export-associated protein AatD	NA	NA	NA	NA	NA
WP_000555401.1|10267_11401_+|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_000624736.1|13109_13460_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.6e-40
WP_001387845.1|13456_13891_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
WP_001034126.1|14484_18579_-|protease	serine protease autotransporter toxin SepA	protease	Q9LA58	Enterobacterial_phage	42.2	3.3e-281
WP_001234427.1|20152_20953_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.5	2.8e-43
WP_000614287.1|21270_21918_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001151564.1|22203_22587_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000943160.1|28520_28658_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_000205736.1|28677_29424_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_000139330.1|29478_30039_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001387845.1|30267_30702_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
WP_000624689.1|30698_30995_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.4	3.4e-31
WP_000381397.1|31307_32879_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_000624622.1|32898_33246_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|33245_33923_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000019427.1|34650_35631_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
35632:35691	attL	GATGTCCCTCTGGGATGCGCTCCGGATGAATATGATGATCTCATATCAGGAACTTGTTCG	NA	NA	NA	NA
WP_000083850.1|35911_36166_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_014966221.1|36403_36478_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001387467.1|38206_38491_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421273.1|38490_38766_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001440647.1|39218_39380_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032159539.1|39502_39628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066951.1|39748_40489_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001387465.1|40767_41745_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	8.8e-100
WP_001392130.1|43068_43470_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261288.1|43493_43724_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000813638.1|44318_44537_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159872.1|44538_44844_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016961.1|44844_45651_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	2.7e-54
WP_001144032.1|45829_46474_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030204.1|46560_46869_+	molecular chaperone GroEL	NA	NA	NA	NA	NA
WP_000688504.1|47282_48263_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	2.2e-79
WP_001278815.1|48255_48672_+	recombinase	NA	NA	NA	NA	NA
WP_071589020.1|48673_48745_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_000457137.1|49946_50324_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.2	6.1e-25
WP_032159540.1|50455_51022_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	45.6	4.8e-34
WP_001390505.1|51028_51208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000702455.1|51858_52617_+	aggregative adherence fimbria I chaperone AggD	NA	NA	NA	NA	NA
WP_000858405.1|52630_55159_+	aggregative adherence fimbria I usher protein AggC	NA	NA	NA	NA	NA
WP_001390509.1|55710_56214_+	aggregative adherence fimbria I major subunit AggA	NA	NA	NA	NA	NA
WP_001401984.1|57007_57388_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
WP_000612591.1|57384_57732_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997981.1|57781_59320_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000033204.1|60335_60836_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	28.2	2.4e-08
WP_000869859.1|61271_62300_+	class 1 isoprenoid biosynthesis enzyme	NA	NA	NA	NA	NA
WP_001387337.1|62303_62843_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000019427.1|63657_64638_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
73787:73854	attR	CGAACAAGTTCCTGATATGAGATCATCATATTCATCCGGAGCGCATCCCAGAGGGACATCATGAGCCA	NA	NA	NA	NA
