The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040993	Klebsiella pneumoniae strain FDAARGOS_775 chromosome, complete genome	5303035	722449	769839	5303035	head,tail,protease,tRNA,capsid,terminase,portal	uncultured_Caudovirales_phage(57.14%)	49	NA	NA
WP_002918465.1|722449_722944_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|722947_723586_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|723555_723840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|723897_724290_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|724305_724734_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|724999_726127_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|726317_726716_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_004149967.1|726889_728257_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|728344_729403_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|729539_730478_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|730892_731363_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|731738_732002_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|732100_732367_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|732417_732693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|732772_734740_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|734745_735678_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|735685_735889_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|736020_736950_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_004144958.1|736985_738431_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004149972.1|738519_742317_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|742354_743824_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|743826_744408_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|744415_744904_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|744903_745896_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|745966_747010_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|747315_749256_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_004144963.1|749335_749527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|749755_750757_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_004185869.1|750756_751365_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_004174104.1|751588_752041_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_025861195.1|752063_752531_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_004149979.1|752541_753891_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|754001_754244_+	YhdT family protein	NA	NA	NA	NA	NA
WP_004188394.1|754233_755685_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|755696_756578_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|756935_757901_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|757925_758222_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_128972062.1|758611_758821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004149985.1|758826_761124_-	hypothetical protein	NA	A0A286S1S3	Klebsiella_phage	46.4	7.7e-155
WP_004149986.1|761135_762797_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	93.5	1.3e-310
WP_025861187.1|762780_763137_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	93.2	2.0e-57
WP_004150957.1|763265_763418_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_032435108.1|763410_763854_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	89.1	2.3e-76
WP_025861186.1|763853_764147_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	85.6	3.8e-43
WP_025861185.1|764139_764481_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	47.0	2.2e-21
WP_004149988.1|764477_765713_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	94.9	6.7e-230
WP_025861183.1|765714_766275_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.2	2.7e-98
WP_004149989.1|766326_767487_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	97.9	5.9e-212
WP_004149991.1|768087_769839_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	51.8	1.9e-129
>prophage 2
NZ_CP040993	Klebsiella pneumoniae strain FDAARGOS_775 chromosome, complete genome	5303035	3061795	3071258	5303035	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|3061795_3062911_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004147781.1|3062907_3064848_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
WP_002896516.1|3064924_3065146_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|3065471_3065789_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|3065819_3068099_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|3068218_3068437_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|3068790_3069492_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004147784.1|3069536_3071258_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 3
NZ_CP040993	Klebsiella pneumoniae strain FDAARGOS_775 chromosome, complete genome	5303035	3319885	3407081	5303035	head,tail,tRNA,capsid,holin,terminase,portal	Klebsiella_phage(52.5%)	94	NA	NA
WP_048968652.1|3319885_3320992_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|3321048_3321507_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032443838.1|3321523_3322174_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|3322414_3323665_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_012542206.1|3324890_3325136_-	excisionase	NA	NA	NA	NA	NA
WP_004147979.1|3325188_3327327_-	exonuclease	NA	S4TNL0	Salmonella_phage	42.9	1.9e-99
WP_014228879.1|3327468_3327813_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_016160636.1|3327855_3328050_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_040234937.1|3328441_3328756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861419.1|3329078_3329468_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	64.3	5.5e-37
WP_004147982.1|3329603_3329825_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	75.3	1.2e-28
WP_004147983.1|3329827_3330382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147984.1|3330433_3331417_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.8	7.3e-46
WP_032443839.1|3331409_3331874_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	69.5	1.7e-61
WP_032443841.1|3331887_3332328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147987.1|3332991_3334491_+	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_004147988.1|3334496_3335642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050511144.1|3335638_3337441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157779422.1|3337430_3337925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025368263.1|3338549_3338783_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_071531363.1|3338845_3339085_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.6	1.9e-16
WP_025861428.1|3339125_3339518_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_025861430.1|3339717_3340749_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	2.1e-96
WP_025861432.1|3340765_3341368_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_004147997.1|3341611_3341815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147999.1|3342552_3342702_-	small membrane protein	NA	NA	NA	NA	NA
WP_025861434.1|3343632_3343932_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	82.8	4.5e-39
WP_032443843.1|3343928_3344468_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	96.1	2.0e-98
WP_025861436.1|3344464_3344812_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	76.5	3.7e-37
WP_032443845.1|3344808_3345084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861440.1|3345488_3346061_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	54.3	2.3e-55
WP_004148005.1|3346050_3347118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025861442.1|3347474_3347837_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	85.8	1.8e-58
WP_128972059.1|3347833_3348106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032429123.1|3348105_3348534_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	8.1e-42
WP_012542168.1|3348783_3349218_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_004148008.1|3349217_3350939_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.2	9.4e-190
WP_004148010.1|3351111_3352371_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	6.2e-223
WP_004148012.1|3352407_3353328_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.8e-148
WP_004148013.1|3353405_3354692_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	1.2e-216
WP_014907814.1|3354750_3355011_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
WP_020317538.1|3354991_3355309_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_014228910.1|3355305_3355644_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_017880258.1|3355624_3356014_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_017898997.1|3356010_3356412_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_023328090.1|3356443_3356905_+	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_004148015.1|3356962_3357328_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	88.5	2.4e-50
WP_071531361.1|3357342_3357561_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	89.2	1.6e-33
WP_025861453.1|3360895_3361234_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	7.0e-57
WP_023289191.1|3361230_3361986_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
WP_025861455.1|3361987_3362698_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	91.1	2.9e-137
WP_023328085.1|3363188_3363782_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_004148022.1|3363844_3376549_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.0	0.0e+00
WP_004148023.1|3376617_3378114_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	62.8	3.9e-123
WP_004892953.1|3378267_3378420_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_004150799.1|3378691_3379405_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025861458.1|3379401_3379794_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_025861459.1|3379786_3380110_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_032443847.1|3380229_3380406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032443848.1|3380353_3380539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|3380559_3380787_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004148024.1|3380899_3382093_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004148025.1|3382160_3382496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|3382715_3382901_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|3382991_3383486_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|3383512_3384019_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140512.1|3384035_3384923_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004148028.1|3384978_3386385_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004148029.1|3386381_3387392_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|3387507_3387705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3388271_3388904_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140501.1|3388943_3389123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|3389520_3390207_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_020804938.1|3390319_3390484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150788.1|3392145_3393036_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004148034.1|3393042_3394827_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|3394900_3396109_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004892909.1|3396411_3397455_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148037.1|3397535_3397655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004148038.1|3398116_3399031_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|3399120_3399759_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|3399889_3400153_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004148039.1|3400212_3400341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|3400458_3400533_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|3400532_3400634_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004176549.1|3400691_3401705_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004176548.1|3402005_3402245_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_073980562.1|3402234_3402573_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_004190885.1|3402577_3403087_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_025861467.1|3403232_3403925_+	CTP synthase	NA	NA	NA	NA	NA
WP_020324105.1|3403956_3405132_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004224197.1|3405239_3406034_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|3406017_3406464_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004892876.1|3406580_3407081_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP040993	Klebsiella pneumoniae strain FDAARGOS_775 chromosome, complete genome	5303035	3788355	3799242	5303035		Escherichia_phage(87.5%)	9	NA	NA
WP_032443877.1|3788355_3788976_-	aldolase	NA	A0A077SK32	Escherichia_phage	99.5	2.3e-114
WP_004148325.1|3788968_3790234_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_004148326.1|3790245_3791148_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	4.5e-159
WP_002210513.1|3791409_3792171_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001620095.1|3792191_3793052_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|3793348_3793609_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_025862028.1|3793695_3794784_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.2	1.3e-208
WP_004176258.1|3794814_3796080_-	MFS transporter	NA	NA	NA	NA	NA
WP_004148330.1|3796134_3799242_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.4	0.0e+00
>prophage 5
NZ_CP040993	Klebsiella pneumoniae strain FDAARGOS_775 chromosome, complete genome	5303035	4804637	4811546	5303035	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|4804637_4806116_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_025862095.1|4806112_4806835_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_004144192.1|4807153_4808515_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|4808757_4809654_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_024264506.1|4809898_4810672_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_032444047.1|4810682_4811546_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	4.4e-10
>prophage 6
NZ_CP040993	Klebsiella pneumoniae strain FDAARGOS_775 chromosome, complete genome	5303035	5110796	5184530	5303035	tail,protease,tRNA,capsid,holin,terminase,transposase,integrase	Salmonella_phage(40.82%)	78	5116451:5116468	5183519:5183536
WP_004149277.1|5110796_5112800_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|5112809_5113685_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|5113804_5114518_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_004149279.1|5114746_5115781_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|5115797_5116676_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
5116451:5116468	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_002913804.1|5116829_5117396_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|5117399_5117870_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|5117931_5118993_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004221267.1|5119047_5119164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004149282.1|5119215_5120679_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_004174871.1|5120688_5121048_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_025860608.1|5121176_5122088_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.3	1.7e-73
WP_020947395.1|5122084_5122786_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|5122884_5124171_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|5124266_5124893_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004149286.1|5125110_5126544_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_025860605.1|5126553_5127447_-	ROK family protein	NA	NA	NA	NA	NA
WP_004149288.1|5127710_5128748_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	6.3e-72
WP_004145656.1|5128744_5129386_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
WP_002913838.1|5129566_5131627_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004149289.1|5131630_5133163_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_004149290.1|5133216_5135445_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_004174861.1|5135815_5135989_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_073901078.1|5136085_5136997_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004149291.1|5137070_5138303_+	MFS transporter	NA	NA	NA	NA	NA
WP_004149293.1|5138596_5139775_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004149294.1|5139758_5141627_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_032443968.1|5141811_5142312_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	87.5	5.9e-68
WP_025860598.1|5142308_5142938_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	77.4	1.1e-90
WP_004146393.1|5142927_5143233_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|5143219_5143624_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_128972065.1|5143724_5143931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004149297.1|5143930_5146348_-	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	46.5	3.7e-75
WP_024622826.1|5147088_5147589_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_004152433.1|5147962_5148652_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_025860592.1|5148895_5149108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004149303.1|5149104_5149482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025860590.1|5149761_5150058_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	91.7	3.7e-46
WP_004149306.1|5150253_5152728_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	86.5	0.0e+00
WP_004149307.1|5152731_5154537_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	72.8	2.4e-236
WP_100219344.1|5154533_5155139_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	87.6	2.9e-101
WP_025860587.1|5157062_5157560_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	8.9e-24
WP_025860585.1|5157552_5158023_-	hypothetical protein	NA	Q858G2	Salmonella_phage	53.3	1.8e-42
WP_004149310.1|5158024_5160502_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	5.2e-266
WP_025860577.1|5160501_5161113_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	7.0e-47
WP_004152465.1|5161161_5161440_-	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004152466.1|5161432_5161825_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004149311.1|5161835_5162843_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	6.1e-181
WP_004152468.1|5162855_5163254_-	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004152470.1|5163535_5163841_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004149313.1|5163837_5165517_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
WP_004152472.1|5165520_5165724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025860573.1|5166479_5166857_+	hypothetical protein	NA	A0AR14	Salmonella_phage	75.0	2.6e-44
WP_004149315.1|5166900_5168376_-	hypothetical protein	NA	Q858H3	Salmonella_phage	92.4	1.6e-278
WP_025860570.1|5168372_5169083_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	82.6	1.8e-102
WP_025860568.1|5169123_5169462_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	1.4e-49
WP_050511149.1|5169454_5170042_-	hypothetical protein	NA	A0A1X9I9I7	Staphylococcus_phage	44.1	3.0e-31
WP_025860565.1|5171127_5171337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025860564.1|5171408_5171876_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	38.7	3.3e-12
WP_004197334.1|5172068_5172413_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	86.0	2.4e-52
WP_032443965.1|5172532_5173318_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	1.4e-132
WP_025860560.1|5173314_5174082_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	6.8e-140
WP_023301592.1|5174081_5174291_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	79.7	1.0e-26
WP_025860555.1|5174437_5174671_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	64.9	4.6e-23
WP_004144290.1|5174825_5175407_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_164993470.1|5175625_5175775_+	hypothetical protein	NA	T1SA20	Salmonella_phage	66.0	2.1e-13
WP_004149323.1|5175771_5176071_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	5.5e-21
WP_025860551.1|5176067_5176967_+	endonuclease	NA	Q858E0	Salmonella_phage	90.6	2.5e-157
WP_004149325.1|5176976_5177999_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	5.2e-180
WP_004144294.1|5178049_5178298_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_025860549.1|5178332_5178524_+	hypothetical protein	NA	T1S9J5	Salmonella_phage	74.1	4.1e-14
WP_025860547.1|5178516_5178675_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	76.9	2.8e-16
WP_023285452.1|5178671_5179178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025860545.1|5179174_5179771_+	adenine methylase	NA	T1SA14	Salmonella_phage	91.2	3.8e-106
WP_004200579.1|5179767_5179959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004149328.1|5179975_5181226_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	1.8e-206
WP_004151979.1|5181418_5182996_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|5183063_5184530_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
5183519:5183536	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
>prophage 1
NZ_CP040994	Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence	96085	14402	64331	96085	integrase,transposase	Macacine_betaherpesvirus(21.43%)	32	23829:23888	51062:51315
WP_025862268.1|14402_15197_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_013023785.1|15452_15758_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_025862266.1|15759_15978_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_004150739.1|16290_16494_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004098928.1|16542_16800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025862265.1|16858_17113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150724.1|19747_20692_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004150723.1|20754_21177_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004150722.1|21247_22447_-	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
WP_025862337.1|22544_22997_+	transcriptional repressor	NA	NA	NA	NA	NA
23829:23888	attL	CTAGACTGGCCCCCTGAATCTCCAGACAACCAATATCACTTAAATAAGTGATAGTCTTAA	NA	NA	NA	NA
WP_112209671.1|24103_24955_-|transposase	transposase	transposase	A0A1S7J231	Thermus_phage	25.5	7.1e-05
WP_004150546.1|28590_28947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025862222.1|30498_30753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150541.1|30930_32067_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077260970.1|34671_35310_-	DNA replication protein	NA	J9Q7H0	Salmonella_phage	52.0	1.7e-48
WP_023287153.1|36410_37577_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
WP_004117790.1|37576_38548_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_032444102.1|41328_42345_+|transposase	IS110-like element ISKpn2 family transposase	transposase	NA	NA	NA	NA
WP_025862237.1|43859_44513_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004150523.1|45705_45885_+	small membrane protein	NA	NA	NA	NA	NA
WP_071531393.1|46072_46624_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004144055.1|48723_49368_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.2	2.1e-54
WP_016529501.1|49352_50585_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	34.0	6.3e-63
WP_085956323.1|51153_52381_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.7e-169
51062:51315	attR	CTAGACTGGCCCCCTGAATCTCCAGACAACCAATATCACTTAAATAAGTGATAGTCTTAATACTAGTTTTTAGACTAGTCATTGGAGAACAGATGATTGATGTCTTAGGGCCGGAGAAACGCAGACGGCGTACTACACAGGAAAAGATCGCTATCGTTCAGCAGAGCTTTGAACCGGGAATGACGGTCTCCCTTGTTGCCCGGCAACATGGTGTGGCAGCCAGCCAGCTATTTCTCTGGCGTAAGCAATACCAG	NA	NA	NA	NA
WP_004150512.1|52427_56519_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.7	4.1e-276
WP_032444095.1|56868_58407_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	1.9e-295
WP_000612591.1|58456_58804_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_004150475.1|58800_59181_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	6.0e-65
WP_025862253.1|60366_61308_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	1.9e-75
WP_025862333.1|62296_62806_+	cytochrome b561	NA	NA	NA	NA	NA
WP_025862332.1|62994_63231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146847.1|63290_64331_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	93.4	1.9e-193
>prophage 2
NZ_CP040994	Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence	96085	83889	92873	96085		Escherichia_phage(42.86%)	10	NA	NA
WP_025861956.1|83889_84645_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.6	4.5e-136
WP_001568033.1|85611_86817_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	4.0e-163
WP_004150761.1|86816_87791_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	8.5e-87
WP_004150760.1|87872_89144_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	2.0e-152
WP_001568036.1|89143_89575_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004150759.1|89807_90779_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.8e-73
WP_025861958.1|90781_91441_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|91504_91735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343518.1|91853_91970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|92171_92873_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 1
NZ_CP040995	Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence	105919	0	2522	105919		Bacillus_phage(100.0%)	1	NA	NA
WP_004150708.1|959_2522_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	1.0e-09
>prophage 2
NZ_CP040995	Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence	105919	6040	39844	105919	transposase,integrase	Sodalis_phage(25.0%)	30	21493:21511	34030:34048
WP_004150712.1|6040_6193_+|transposase	transposase	transposase	U5P0U6	Shigella_phage	100.0	3.6e-05
WP_004144467.1|6423_7071_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	41.2	5.5e-26
WP_032444057.1|7067_8027_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.2	5.2e-73
WP_050511153.1|8055_8670_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_032444086.1|10568_12566_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.7	3.3e-21
WP_032444073.1|12837_14046_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_004150716.1|13955_15167_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004146533.1|15147_15420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150712.1|15413_15566_+|transposase	transposase	transposase	U5P0U6	Shigella_phage	100.0	3.6e-05
WP_004150717.1|15899_16826_+	DMT family transporter	NA	NA	NA	NA	NA
WP_025862299.1|16936_17797_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_025862298.1|17903_18521_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	35.3	2.1e-22
WP_004150696.1|19492_20713_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_050511154.1|20947_21562_-	DUF2913 family protein	NA	NA	NA	NA	NA
21493:21511	attL	CGCAGAACGCCAGGTGGCT	NA	NA	NA	NA
WP_004148938.1|21590_22523_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.8e-70
WP_025862211.1|23934_24678_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.0	1.5e-19
WP_025862212.1|24849_25473_+	AAA family ATPase	NA	K7R2R7	Vibrio_phage	46.4	1.4e-42
WP_025862213.1|25475_25718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050511155.1|26336_26729_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_025862214.1|27817_28147_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_025862215.1|28130_28391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004148949.1|30843_32244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025862217.1|32675_33002_+	hypothetical protein	NA	S4TSG5	Salmonella_phage	43.8	1.2e-08
WP_025862218.1|33005_33953_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	1.2e-74
WP_044241768.1|33978_34617_+	DUF2913 family protein	NA	NA	NA	NA	NA
34030:34048	attR	AGCCACCTGGCGTTCTGCG	NA	NA	NA	NA
WP_050511156.1|34656_35238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000904911.1|35266_35842_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	54.1	4.7e-45
WP_044242211.1|37585_38200_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_032444070.1|38228_39200_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.8	8.5e-71
WP_032444069.1|39196_39844_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	41.2	5.5e-26
>prophage 3
NZ_CP040995	Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence	105919	46886	50263	105919		Moraxella_phage(33.33%)	5	NA	NA
WP_071531398.1|46886_47360_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.3e-20
WP_071531399.1|47592_47805_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150632.1|47934_48495_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_025861841.1|48597_49458_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	2.2e-09
WP_025861839.1|49516_50263_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	2.1e-08
>prophage 4
NZ_CP040995	Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence	105919	76848	77070	105919		Vibrio_virus(100.0%)	1	NA	NA
WP_025861821.1|76848_77070_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	5.7e-07
>prophage 5
NZ_CP040995	Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence	105919	84868	85690	105919		Yersinia_phage(100.0%)	1	NA	NA
WP_032447228.1|84868_85690_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.8	2.8e-43
>prophage 6
NZ_CP040995	Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence	105919	89918	94343	105919	transposase	Vibrio_phage(25.0%)	6	NA	NA
WP_032444061.1|89918_90602_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	38.8	1.0e-30
WP_071531410.1|91100_91301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150689.1|91493_91769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044242206.1|91759_92347_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	42.1	2.7e-32
WP_025861795.1|92678_93275_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	37.6	4.0e-23
WP_004150693.1|93389_94343_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.9	9.2e-62
