The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040919	Escherichia coli strain FC853_EC chromosome, complete genome	5209476	1245898	1285779	5209476	integrase,tail,terminase	Escherichia_phage(61.9%)	49	1245116:1245131	1250587:1250602
1245116:1245131	attL	CCGCCGCCGCGCCCGA	NA	NA	NA	NA
WP_001299507.1|1245898_1247365_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138270.1|1247433_1249011_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001567237.1|1249203_1250454_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	3.6e-239
WP_140027998.1|1250485_1251205_-	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	67.4	1.4e-46
1250587:1250602	attR	CCGCCGCCGCGCCCGA	NA	NA	NA	NA
WP_001555198.1|1251841_1252090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059327372.1|1252086_1252737_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	99.5	1.9e-127
WP_140028046.1|1252729_1252981_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	3.4e-40
WP_000675390.1|1253138_1253387_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_140027999.1|1253436_1254354_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	49.3	1.7e-68
WP_042067880.1|1254350_1255172_-	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	98.9	6.1e-163
WP_001102250.1|1255168_1255468_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	94.9	3.2e-45
WP_000836290.1|1255776_1256361_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282459.1|1256515_1256746_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000402896.1|1256896_1257097_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
WP_000086417.1|1257112_1257928_+	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
WP_001406039.1|1257924_1258710_+	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
WP_016235747.1|1258827_1259172_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	8.2e-61
WP_140028000.1|1259233_1259671_+	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	63.7	8.0e-29
WP_023910398.1|1259667_1259967_+	hypothetical protein	NA	G8C7K8	Escherichia_phage	99.0	4.3e-58
WP_135107868.1|1259968_1260583_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	69.2	6.3e-80
WP_000797279.1|1260928_1261117_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_122648061.1|1261290_1261554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140028001.1|1261630_1262389_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	48.1	5.1e-55
WP_128767313.1|1262503_1262842_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	85.7	4.1e-49
WP_024166494.1|1262882_1263593_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	85.2	1.0e-105
WP_021517653.1|1263589_1265065_+	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.4	1.3e-296
WP_000848286.1|1265108_1265531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335899.1|1266233_1266440_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_128767312.1|1266454_1268134_+|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.3	2.3e-302
WP_000133160.1|1268130_1268427_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_042970478.1|1268429_1269125_+	peptidase	NA	G9L6C4	Escherichia_phage	99.6	6.0e-95
WP_135107833.1|1270177_1270615_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.9	6.5e-71
WP_000012377.1|1270625_1270961_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000179260.1|1271017_1271623_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
WP_096932100.1|1271622_1274094_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.1	0.0e+00
WP_001555171.1|1274093_1274558_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	2.4e-84
WP_000332877.1|1274557_1275133_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	95.3	7.0e-81
WP_062864961.1|1275132_1277850_+	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	99.4	0.0e+00
WP_062864960.1|1277849_1280864_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	99.4	0.0e+00
WP_062864959.1|1280875_1281439_-	hypothetical protein	NA	G9L6D5	Escherichia_phage	96.3	9.8e-96
WP_062864958.1|1281533_1281965_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	99.1	2.1e-58
WP_064768927.1|1282085_1282253_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	98.2	3.0e-24
WP_062864957.1|1282325_1283264_+	antirepressor	NA	G9L6D8	Escherichia_phage	91.1	8.2e-164
WP_000708858.1|1283337_1283499_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001154803.1|1283592_1284141_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_001609225.1|1284067_1284394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032152017.1|1284515_1285208_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	80.2	1.7e-97
WP_110221350.1|1285253_1285340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087598103.1|1285521_1285779_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	3.7e-42
>prophage 2
NZ_CP040919	Escherichia coli strain FC853_EC chromosome, complete genome	5209476	1288822	1292396	5209476	holin	Escherichia_phage(85.71%)	7	NA	NA
WP_109866943.1|1288822_1289227_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	97.0	1.0e-62
WP_000256105.1|1289213_1289522_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	96.1	4.2e-48
WP_115760333.1|1289511_1290141_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	95.7	1.3e-112
WP_115760332.1|1290137_1290620_+	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	91.9	2.0e-73
WP_022645975.1|1290838_1291378_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	2.9e-44
WP_000669402.1|1291393_1291909_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_001344399.1|1292222_1292396_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 3
NZ_CP040919	Escherichia coli strain FC853_EC chromosome, complete genome	5209476	1697098	1706540	5209476		Enterobacteria_phage(85.71%)	10	NA	NA
WP_022645872.1|1697098_1698025_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
WP_022645871.1|1698029_1698761_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1698741_1698849_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1698908_1699640_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001334139.1|1699861_1701547_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_012311742.1|1701543_1702263_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1702309_1702780_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1702820_1703282_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_022645869.1|1703406_1705407_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001329822.1|1705403_1706540_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 4
NZ_CP040919	Escherichia coli strain FC853_EC chromosome, complete genome	5209476	1798650	1807364	5209476		Enterobacteria_phage(42.86%)	7	NA	NA
WP_001116131.1|1798650_1800045_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
WP_000183060.1|1800219_1801113_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699418.1|1801485_1802571_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
WP_001023627.1|1802570_1803470_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_000857549.1|1803527_1804406_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001100791.1|1804410_1804959_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
WP_000735124.1|1806236_1807364_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	30.4	5.3e-32
>prophage 5
NZ_CP040919	Escherichia coli strain FC853_EC chromosome, complete genome	5209476	2340249	2449924	5209476	transposase,lysis,terminase,integrase,protease,tail,portal	Enterobacteria_phage(38.6%)	114	2347825:2347841	2378565:2378581
WP_001260849.1|2340249_2341071_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2341170_2341254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|2341346_2341682_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2342078_2343332_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2343438_2344332_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225257.1|2344466_2345687_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2345811_2346507_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071586384.1|2346459_2347752_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2347825:2347841	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_021516105.1|2347910_2348525_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
WP_000526500.1|2348567_2349422_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2349423_2350041_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072146081.1|2350051_2352475_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	2.2e-208
WP_022645727.1|2352535_2354962_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001295396.1|2355160_2355466_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|2355573_2356284_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2356286_2356847_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2356881_2357223_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001304355.1|2357357_2357684_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_001295394.1|2357889_2359104_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|2359115_2360135_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2360192_2360321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|2360322_2361603_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001296941.1|2361637_2361874_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_024946566.1|2361961_2364433_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001090200.1|2364525_2364717_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001317853.1|2364713_2364902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000159335.1|2365404_2365605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001320327.1|2365573_2365939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|2365950_2366103_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000476993.1|2366779_2367007_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|2366990_2367512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054505.1|2367492_2368458_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.9e-55
WP_001151189.1|2368498_2368900_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_022645725.1|2369099_2370122_+	hypothetical protein	NA	Q858S2	Enterobacteria_phage	62.4	2.5e-105
WP_001328008.1|2370774_2370978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001546200.1|2370984_2371092_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000887491.1|2371136_2371349_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|2371565_2371817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140164.1|2371883_2372162_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001376415.1|2372163_2373213_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	6.5e-109
WP_000904111.1|2373225_2373582_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_000762886.1|2373596_2374418_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
WP_001348754.1|2374951_2375278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562553.1|2375313_2375445_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_022645723.1|2375811_2376240_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2376411_2376786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839562.1|2377037_2377253_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_000196128.1|2377257_2377569_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	1.5e-24
WP_001092966.1|2377565_2378099_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071776.1|2378095_2378593_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2378565:2378581	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000066495.1|2378957_2379170_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|2379180_2379369_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2379516_2379672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2379844_2380018_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2380313_2380520_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_085947917.1|2380602_2381876_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_022645722.1|2382408_2382903_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_000934104.1|2382902_2385005_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|2385001_2385214_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985958.1|2385213_2386722_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001136588.1|2386666_2388694_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|2388779_2389103_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_022645721.1|2389095_2389371_+	phage protein	NA	K7PH43	Enterobacteria_phage	98.9	3.8e-45
WP_000677120.1|2389382_2389973_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
WP_001079410.1|2389969_2390371_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
WP_022645720.1|2390381_2391125_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.4	7.3e-131
WP_001370402.1|2391184_2391571_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_063815218.1|2391579_2391897_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	4.4e-53
WP_022645718.1|2391880_2394946_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_000447253.1|2394945_2395275_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152382.1|2395284_2395983_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_024946565.1|2395988_2396732_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
WP_023277304.1|2396629_2397277_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_001228249.1|2400883_2401483_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_001546831.1|2401547_2403920_+|tail	phage tail fiber protein	tail	A0A0E3M0V5	Enterobacteria_phage	47.5	4.1e-103
WP_001546830.1|2403916_2404195_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	54.3	3.8e-24
WP_001546829.1|2404205_2405246_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	80.5	4.5e-155
WP_001546828.1|2405288_2405582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|2405809_2406400_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2406716_2406950_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2407018_2407132_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347484.1|2407736_2409020_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527788.1|2409109_2410570_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.6e-43
WP_000214712.1|2410605_2410809_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_022645715.1|2410985_2411672_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000636571.1|2411760_2412507_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_022645714.1|2412643_2414689_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_022645713.1|2415054_2415447_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592819.1|2415701_2416592_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.4e-19
WP_000901367.1|2416810_2416906_-	protein MgtS	NA	NA	NA	NA	NA
WP_022645712.1|2417032_2418220_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087204.1|2418414_2419314_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803527.1|2419344_2419563_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2419594_2419978_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_022645711.1|2419998_2420433_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|2420644_2421310_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210799.1|2421334_2422525_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_140028015.1|2422674_2423490_-	putative protein YneK	NA	NA	NA	NA	NA
WP_000366505.1|2424644_2425526_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000156623.1|2425626_2427015_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257409.1|2427078_2428005_+	glutaminase B	NA	NA	NA	NA	NA
WP_022645709.1|2428004_2428364_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_022645708.1|2428502_2429921_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_022645707.1|2430148_2431600_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_022645706.1|2431796_2432711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645705.1|2432714_2433473_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558525.1|2433529_2433820_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_022645704.1|2433843_2434719_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000172485.1|2434745_2435768_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_001222725.1|2435779_2436772_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_022645703.1|2436771_2437800_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000154352.1|2439576_2440530_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_022645702.1|2440608_2442201_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_085947917.1|2448651_2449924_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 6
NZ_CP040919	Escherichia coli strain FC853_EC chromosome, complete genome	5209476	2667276	2733909	5209476	transposase,capsid,lysis,terminase,holin,protease,tail,integrase,head,portal	Enterobacteria_phage(36.54%)	79	2684621:2684648	2734046:2734073
WP_000422059.1|2667276_2668326_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559277.1|2668545_2669304_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278893.1|2669300_2669891_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000715.1|2669947_2670256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077266175.1|2670265_2671252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291217.1|2671457_2672333_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_022645614.1|2672543_2674433_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2674460_2675081_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285663.1|2675077_2675959_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2676096_2676141_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_022645613.1|2676232_2677795_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763524.1|2677794_2679390_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001195273.1|2679393_2680752_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_022645612.1|2680763_2681957_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_022645611.1|2681956_2682763_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2683153_2683333_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2683418_2683919_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_071586393.1|2683964_2684042_+	DUF892 family protein	NA	NA	NA	NA	NA
2684621:2684648	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000937483.1|2685243_2685513_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|2685569_2686238_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071988034.1|2686182_2686320_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
WP_000885578.1|2686292_2686877_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.0e-103
WP_000216487.1|2686876_2689903_-	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.5	7.0e-55
WP_001228314.1|2690054_2690654_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_023909008.1|2690721_2694195_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_000559722.1|2694175_2694517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122997661.1|2694538_2695171_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	94.3	1.5e-100
WP_000194723.1|2695116_2695860_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001335877.1|2695870_2696569_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000847298.1|2696568_2696898_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_023909007.1|2696894_2699468_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.3	0.0e+00
WP_000533402.1|2699448_2699862_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|2699888_2700320_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000235110.1|2700333_2701086_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|2701093_2701489_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_001575631.1|2701485_2702061_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	1.1e-49
WP_001204553.1|2702075_2702429_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201501.1|2702421_2702805_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522601.1|2702856_2703885_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.1e-113
WP_000256835.1|2703942_2704290_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_023909006.1|2704326_2705832_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	3.6e-100
WP_000831818.1|2705821_2707414_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_000259002.1|2707410_2707617_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000622379.1|2707600_2709529_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
WP_000867575.1|2709500_2710049_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_023909270.1|2710502_2711570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654790.1|2711511_2712132_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	53.7	5.1e-53
WP_024946561.1|2712548_2713007_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	92.8	7.5e-70
WP_023909004.1|2713003_2713537_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	2.5e-101
WP_023909003.1|2713592_2713907_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	3.1e-51
WP_000284510.1|2713911_2714127_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_023909002.1|2714276_2716130_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	89.2	0.0e+00
WP_000871291.1|2716390_2716726_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001438304.1|2717006_2717138_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_023141057.1|2717173_2717500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000935536.1|2717939_2718989_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_000917767.1|2719139_2719337_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_023909112.1|2719550_2720240_-	antiterminator	NA	I6PDF8	Cronobacter_phage	46.4	1.8e-54
WP_000904174.1|2720236_2720596_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	3.9e-37
WP_023909113.1|2720608_2721658_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.7e-107
WP_032151993.1|2721659_2721938_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_000967408.1|2722104_2722317_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000786213.1|2722519_2722699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948316.1|2722969_2724242_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_001327238.1|2724264_2724522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224662.1|2724687_2724870_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|2724963_2725320_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001468623.1|2725377_2725800_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.3e-64
WP_000095673.1|2725840_2726803_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
WP_000693906.1|2726825_2727251_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|2727234_2727558_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|2727682_2728159_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001725971.1|2728477_2728630_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.1e-06
WP_016237926.1|2728641_2729016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122991287.1|2729001_2729148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2729548_2729737_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2729733_2729925_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_023909115.1|2730017_2732489_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	2.3e-56
WP_140028047.1|2732772_2733909_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.7	2.0e-103
2734046:2734073	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 7
NZ_CP040919	Escherichia coli strain FC853_EC chromosome, complete genome	5209476	3125107	3214514	5209476	capsid,lysis,terminase,tRNA,protease,tail,plate,integrase,head,portal	Salmonella_phage(62.5%)	91	3180211:3180237	3214589:3214615
WP_000886683.1|3125107_3126400_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067771.1|3126490_3127834_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	7.3e-81
WP_001295343.1|3127844_3128456_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_022645455.1|3128614_3132685_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3132819_3133314_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3133857_3134823_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043590.1|3134945_3136712_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202192.1|3136712_3138434_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	4.0e-15
WP_022645453.1|3138475_3139180_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3139464_3139683_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3140430_3142707_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3142737_3143058_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3143380_3143605_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_022645444.1|3143677_3145624_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	6.5e-38
WP_000746460.1|3145620_3146736_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001400542.1|3146886_3147843_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|3147839_3149498_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000488716.1|3149923_3150619_+	aquaporin Z	NA	NA	NA	NA	NA
WP_022645441.1|3151076_3151976_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_022645440.1|3152118_3153771_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178691.1|3153782_3154751_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815366.1|3154883_3156602_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
WP_000566375.1|3156638_3157640_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_022645439.1|3157650_3159081_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001305933.1|3159179_3160193_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|3160189_3161020_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160731.1|3161016_3161340_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001328210.1|3161394_3161583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645438.1|3161550_3163320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001270657.1|3163967_3164483_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3164700_3165429_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|3165446_3166178_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001702.1|3166184_3166901_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464489.1|3166900_3167569_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3167794_3168526_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149713.1|3168554_3169682_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|3169722_3170211_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|3170270_3171116_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105436.1|3171112_3172066_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|3172075_3173209_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126075.1|3173303_3174416_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3174766_3175243_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3175330_3176233_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_022645437.1|3176293_3177016_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_022645436.1|3176999_3177287_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|3177446_3177704_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681108.1|3177733_3178111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3178380_3180066_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3180211:3180237	attL	GTGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
WP_000972391.1|3180301_3180520_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_022645435.1|3180610_3181711_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.2	1.0e-176
WP_022645434.1|3181707_3182193_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	79.4	1.6e-65
WP_022645433.1|3182189_3185267_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
WP_000763311.1|3185259_3185379_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_022645432.1|3185393_3185696_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	3.5e-39
WP_001207660.1|3185750_3186266_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046146.1|3186275_3187448_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_022645431.1|3187581_3188184_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.4	3.7e-93
WP_022645429.1|3189720_3190326_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.2e-110
WP_022645428.1|3190318_3191227_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	3.5e-143
WP_000177597.1|3191213_3191573_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000993764.1|3191569_3192148_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
WP_022645427.1|3192251_3193058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021522006.1|3192999_3193446_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	4.0e-60
WP_001595569.1|3193438_3193870_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
WP_072224386.1|3193835_3194036_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.3	3.9e-23
WP_022645426.1|3193965_3194394_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
WP_022645425.1|3194390_3194768_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	8.8e-16
WP_086555589.1|3194769_3195243_-	lysozyme	NA	E5G6N1	Salmonella_phage	90.4	8.3e-80
WP_000171568.1|3195262_3195478_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3195481_3195685_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|3195684_3196149_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_021534472.1|3196244_3196895_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	9.6e-111
WP_000742503.1|3196898_3197957_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_022645423.1|3197973_3198807_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_022645422.1|3198949_3200716_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_022645421.1|3200715_3201750_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	85.5	2.3e-167
WP_022645420.1|3201786_3203568_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_022645419.1|3204101_3205160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001311555.1|3205334_3205640_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_001154434.1|3205578_3205767_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_022645418.1|3205920_3208335_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
WP_000104157.1|3208331_3209189_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_001399246.1|3209185_3209413_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244228.1|3209412_3209646_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001311552.1|3209713_3210055_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956182.1|3210018_3210219_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_022645417.1|3210226_3210736_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3210768_3210990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645416.1|3211085_3211682_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	1.4e-39
WP_022645415.1|3211702_3213379_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	9.8e-83
WP_001595551.1|3213461_3214514_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	4.8e-104
3214589:3214615	attR	GTGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
>prophage 8
NZ_CP040919	Escherichia coli strain FC853_EC chromosome, complete genome	5209476	3531683	3586993	5209476	transposase,capsid,lysis,terminase,protease,tail,integrase,head,portal	Enterobacteria_phage(63.46%)	66	3540092:3540138	3587007:3587053
WP_022645324.1|3531683_3532820_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_022645323.1|3533017_3535255_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_022645322.1|3535241_3538214_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_022645321.1|3538214_3539105_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177457.1|3539287_3540049_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3540092:3540138	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201842.1|3540561_3541515_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3541763_3542513_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_022645319.1|3543524_3544565_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	91.9	2.1e-176
WP_001204892.1|3544577_3544847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023909117.1|3544846_3547204_-|tail	tail protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	2.2e-117
WP_038431964.1|3547268_3547868_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_023909233.1|3547935_3551415_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_000090891.1|3551475_3552108_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_022645314.1|3552044_3552788_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_001152639.1|3552793_3553492_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847321.1|3553491_3553821_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	8.9e-57
WP_022645312.1|3556370_3556805_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_001468358.1|3556786_3557209_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	2.8e-71
WP_001547245.1|3557224_3557965_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	1.7e-127
WP_000683105.1|3557972_3558368_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985119.1|3558364_3558943_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752979.1|3558954_3559308_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158919.1|3559319_3559718_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_022645311.1|3559759_3560785_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	1.0e-191
WP_001297109.1|3560840_3561173_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_022645310.1|3561182_3562502_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	6.9e-233
WP_001553867.1|3562482_3564084_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	8.5e-310
WP_001027268.1|3564268_3566194_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453580.1|3566168_3566714_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_122999095.1|3566829_3567087_+	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	97.1	8.9e-12
WP_000105084.1|3567102_3567336_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3567392_3567803_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3568154_3568307_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|3568335_3568542_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001135261.1|3568758_3569256_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	4.2e-90
WP_000839582.1|3569255_3569471_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_022645309.1|3569658_3570390_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3571892_3572417_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_022645308.1|3572572_3572950_-	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	83.3	8.1e-54
WP_000971074.1|3573035_3573176_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|3573172_3573535_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|3573531_3573822_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224912.1|3573814_3573985_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_001053034.1|3573984_3574440_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_072130332.1|3574436_3574538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379700.1|3574627_3574984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351655.1|3575445_3575769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709074.1|3575880_3577407_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	3.6e-31
WP_032139864.1|3577464_3577572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|3577663_3577996_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145902.1|3578063_3578366_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	93.5	1.7e-41
WP_140028026.1|3578362_3579064_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	5.1e-126
WP_001361484.1|3579060_3579990_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.0e-110
WP_001182772.1|3580076_3580616_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_001067458.1|3580685_3580916_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3581020_3581710_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233579.1|3582304_3582511_+	hypothetical protein	NA	K7PM31	Enterobacteria_phage	83.8	7.1e-28
WP_020241285.1|3582587_3582884_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_022645306.1|3582889_3583675_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.2	6.9e-148
WP_000186848.1|3583671_3584352_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149544.1|3584348_3584531_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|3584503_3584695_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_022645305.1|3585086_3585305_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	5.4e-34
WP_000488407.1|3585352_3585631_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|3585602_3585974_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_001299447.1|3585829_3586993_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
3587007:3587053	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 9
NZ_CP040919	Escherichia coli strain FC853_EC chromosome, complete genome	5209476	3816285	3866873	5209476	transposase,integrase,plate	Salmonella_phage(10.0%)	55	3819770:3819785	3873142:3873157
WP_016231257.1|3816285_3816723_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
WP_025693498.1|3816784_3818890_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	2.7e-90
WP_025693499.1|3818889_3820311_-	DNA transfer protein	NA	B6SCW4	Bacteriophage	52.7	4.1e-122
3819770:3819785	attL	TGATCTTTGATATCGA	NA	NA	NA	NA
WP_000909175.1|3820310_3820988_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_000420674.1|3820981_3821443_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_071791469.1|3821887_3822139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001585368.1|3822205_3824962_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	1.8e-299
WP_001208878.1|3824948_3825320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628967.1|3825312_3825654_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001058748.1|3825664_3826267_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
WP_000181940.1|3826259_3826481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|3826477_3826741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3826737_3826932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025693500.1|3826924_3827992_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	5.0e-16
WP_000476150.1|3827985_3828168_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_140028029.1|3828160_3828994_-	antA/AntB antirepressor family protein	NA	A0A0P0ZCA2	Stx2-converting_phage	45.7	6.9e-21
WP_000412531.1|3829006_3829438_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	2.3e-28
WP_000035054.1|3829437_3829641_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_001304884.1|3829688_3829904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772643.1|3830068_3831283_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_022645230.1|3831638_3832892_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	3.4e-96
WP_022645229.1|3832903_3834007_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	2.4e-61
WP_022645228.1|3834294_3835350_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.9e-117
WP_000174682.1|3835388_3835790_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3835847_3837092_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3837183_3837642_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_022645227.1|3837902_3839360_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001029361.1|3839407_3839650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001361775.1|3839666_3840176_-	hydrolase	NA	NA	NA	NA	NA
WP_022645225.1|3840237_3840852_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_023909049.1|3840848_3842000_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	30.9	3.5e-31
WP_023909048.1|3842178_3842631_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263491.1|3842640_3843039_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554755.1|3843041_3843335_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_022645222.1|3843386_3844442_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_031311948.1|3844512_3845283_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_022645219.1|3847078_3847852_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
WP_000729708.1|3848037_3848298_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_071787834.1|3848389_3848578_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_001225679.1|3848733_3849474_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3849444_3850212_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001570958.1|3850327_3850906_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	2.5e-14
WP_000973081.1|3851145_3853590_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|3853632_3854106_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_022645218.1|3854259_3855030_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_085949836.1|3855493_3856706_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_001142958.1|3856893_3857412_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037391.1|3858108_3858609_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_022645217.1|3858643_3858868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645215.1|3860399_3860813_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_022645214.1|3860816_3862667_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022645213.1|3862630_3863713_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113710.1|3863737_3865018_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3865014_3865539_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_022645212.1|3865541_3866873_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
3873142:3873157	attR	TGATCTTTGATATCGA	NA	NA	NA	NA
>prophage 10
NZ_CP040919	Escherichia coli strain FC853_EC chromosome, complete genome	5209476	4357882	4419185	5209476	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162184.1|4357882_4359235_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4359328_4359880_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219806.1|4360035_4361409_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|4361584_4362583_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|4362614_4363610_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001297255.1|4363596_4364619_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000210557.1|4364632_4366135_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265933.1|4366274_4367231_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|4367540_4368071_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_001219160.1|4368450_4368792_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_140028032.1|4368794_4372574_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001556747.1|4372570_4374304_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|4374509_4375148_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935042.1|4375470_4376814_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4376874_4377081_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000937648.1|4378048_4378960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886909.1|4379171_4379912_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589446.1|4380101_4382045_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4382173_4382554_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560581.1|4382641_4383502_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001305661.1|4383610_4384576_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331457.1|4384683_4385346_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000936773.1|4385390_4386875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000240846.1|4386908_4388072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000228342.1|4388205_4389609_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4389917_4390538_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|4390755_4391394_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_001309930.1|4391540_4392737_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.7	1.3e-206
WP_001526538.1|4392744_4393359_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	8.9e-42
WP_001305664.1|4393800_4394595_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4394665_4395115_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4395156_4395384_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4395388_4395703_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216677.1|4395709_4396105_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492918.1|4396431_4396707_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170835.1|4396836_4397523_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000949501.1|4397522_4398377_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000056760.1|4398386_4399037_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776521.1|4399050_4399515_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4399524_4399830_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001305665.1|4399845_4401243_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001366537.1|4401597_4402662_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4402769_4403525_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569683.1|4403521_4404271_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4404452_4404782_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4404930_4405206_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_012311664.1|4405322_4406948_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000944003.1|4407031_4408195_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	1.8e-80
WP_022646468.1|4408197_4408836_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4408845_4409244_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012568.1|4409261_4409921_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511950.1|4409970_4410669_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|4410687_4411089_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4411215_4411947_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|4412127_4414569_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|4414607_4415033_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4415237_4416536_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4416639_4416837_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4416918_4417923_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312479.1|4417925_4419185_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 11
NZ_CP040919	Escherichia coli strain FC853_EC chromosome, complete genome	5209476	4551150	4589824	5209476	capsid,lysis,terminase,tRNA,holin,integrase,tail,plate,protease,head,portal	Shigella_phage(42.55%)	54	4545404:4545418	4574431:4574445
4545404:4545418	attL	CTGGCGCGTAAGCTG	NA	NA	NA	NA
WP_000918363.1|4551150_4552566_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_022646433.1|4552648_4553632_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891408.1|4553797_4554040_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543828.1|4554173_4555211_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332264.1|4555299_4556397_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_001217553.1|4556458_4556707_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_077526557.1|4556934_4558119_+	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	34.8	7.7e-50
WP_069904755.1|4558130_4558730_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	70.7	4.7e-72
WP_089438600.1|4558729_4559434_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	76.5	9.2e-51
WP_000383548.1|4559437_4560022_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_089438601.1|4560012_4561071_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.6	5.2e-199
WP_000424747.1|4561057_4561483_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	2.0e-80
WP_001259084.1|4561482_4562031_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000999518.1|4562030_4563110_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_128767295.1|4563106_4564435_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_089438603.1|4564495_4566331_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.0	3.2e-305
WP_023147733.1|4566323_4566506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661054.1|4566472_4566742_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090997.1|4566741_4567098_-	hypothetical protein	NA	U5P076	Shigella_phage	99.2	9.0e-63
WP_000155710.1|4567097_4568594_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000497751.1|4568577_4568748_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779292.1|4568756_4569317_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_073461653.1|4569313_4569820_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	98.8	1.9e-90
WP_115760314.1|4569794_4570205_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	3.5e-74
WP_000924829.1|4570201_4570525_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	1.7e-52
WP_000766100.1|4570603_4571833_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4571843_4572446_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_089438606.1|4572438_4573665_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	5.4e-240
WP_124939318.1|4573812_4575309_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	2.4e-290
4574431:4574445	attR	CAGCTTACGCGCCAG	NA	NA	NA	NA
WP_000929174.1|4575559_4576045_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	2.1e-86
WP_001135093.1|4576170_4576521_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	7.5e-62
WP_001139680.1|4576744_4576897_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001393971.1|4576884_4577352_-|lysis	lysis protein	lysis	A0A2I6TCF9	Escherichia_phage	97.4	3.9e-74
WP_001393970.1|4577348_4577825_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	1.3e-85
WP_000781785.1|4577828_4578170_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	1.1e-52
WP_089438607.1|4578301_4578544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015967852.1|4578832_4579585_-	antitermination protein	NA	Q8SBE4	Shigella_phage	100.0	2.8e-138
WP_032176009.1|4579598_4580588_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.2e-194
WP_001061438.1|4580595_4581405_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767113.1|4581424_4581814_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_021513308.1|4581810_4582137_-	LexA repressor	NA	A5LH73	Enterobacteria_phage	98.1	2.3e-52
WP_001343335.1|4582133_4582787_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	9.6e-127
WP_072178178.1|4582786_4583281_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	98.8	4.3e-87
WP_000128176.1|4583277_4583646_-	hypothetical protein	NA	U5P0A0	Shigella_phage	98.4	3.9e-69
WP_089438608.1|4584226_4584439_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	1.2e-14
WP_000514174.1|4584614_4585199_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001231956.1|4585226_4585424_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000981537.1|4585519_4586173_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_021563905.1|4586406_4586682_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	5.7e-49
WP_000141753.1|4586599_4586845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|4587282_4587645_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_023908886.1|4587710_4588535_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.0e-149
WP_023908887.1|4588723_4589506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093916.1|4589542_4589824_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
>prophage 12
NZ_CP040919	Escherichia coli strain FC853_EC chromosome, complete genome	5209476	4619290	4635673	5209476	tail,plate	Burkholderia_phage(33.33%)	22	NA	NA
WP_000619864.1|4619290_4619638_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_022646418.1|4620175_4620463_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
WP_000266448.1|4620465_4621071_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000777272.1|4621083_4621398_+	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_022646417.1|4621542_4621998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875310.1|4621994_4622192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646416.1|4622181_4623606_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
WP_000907502.1|4623605_4624130_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_022646415.1|4624180_4624498_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_015674804.1|4624457_4624586_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_022646414.1|4624687_4627063_+	hypothetical protein	NA	A4JWL0	Burkholderia_virus	26.0	1.0e-56
WP_022646413.1|4627062_4628016_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_001269711.1|4628015_4628225_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_022646412.1|4628212_4629253_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.1	2.0e-73
WP_000679403.1|4629262_4629964_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_022646411.1|4630062_4630422_+	hypothetical protein	NA	Q6QIA0	Burkholderia_phage	64.2	1.1e-34
WP_038432214.1|4630412_4631390_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	47.8	1.4e-86
WP_022646409.1|4631382_4632099_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	3.1e-22
WP_022646408.1|4632101_4633712_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.1	3.8e-84
WP_022646407.1|4633708_4634416_+	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	5.3e-14
WP_022646406.1|4634412_4634868_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	6.6e-26
WP_022646405.1|4634881_4635673_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
>prophage 13
NZ_CP040919	Escherichia coli strain FC853_EC chromosome, complete genome	5209476	5124595	5137826	5209476	integrase	Morganella_phage(33.33%)	16	5122509:5122523	5141735:5141749
5122509:5122523	attL	TTGCCGCGCAGTTGC	NA	NA	NA	NA
WP_063082446.1|5124595_5127217_-	transglycosylase SLT domain-containing protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	37.8	3.9e-70
WP_000995640.1|5127313_5127520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001580975.1|5127885_5128302_-	hypothetical protein	NA	A0A077SLR9	Escherichia_phage	71.0	1.2e-21
WP_001580977.1|5128282_5128780_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	46.1	6.0e-12
WP_140028043.1|5128816_5129209_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_021543047.1|5129451_5131578_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.5	2.4e-174
WP_000721275.1|5131574_5131877_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001336359.1|5131879_5132137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111961088.1|5132129_5132465_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_140028044.1|5132538_5132736_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	42.6	7.3e-06
WP_023151911.1|5132793_5132991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021549395.1|5133159_5133717_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.6	1.1e-51
WP_063082445.1|5133709_5134453_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	42.0	1.6e-21
WP_021568517.1|5134445_5135144_-	hypothetical protein	NA	A0A0S2SYC0	Pseudomonas_phage	38.7	1.1e-11
WP_001336356.1|5135218_5135437_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001355495.1|5136557_5137826_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.6	2.3e-193
5141735:5141749	attR	GCAACTGCGCGGCAA	NA	NA	NA	NA
>prophage 1
NZ_CP040920	Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence	97266	0	97119	97266	head,integrase,tail,portal,holin	Escherichia_phage(65.69%)	104	6072:6087	72686:72701
WP_001198660.1|524_1523_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	97.3	5.8e-192
WP_001276603.1|1522_2887_-	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
WP_001410793.1|2877_3093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000751808.1|3276_4104_-	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
WP_001180697.1|4084_4321_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	50.0	2.1e-07
WP_032335105.1|4513_4705_+	hypothetical protein	NA	Q71T98	Escherichia_phage	98.4	3.9e-28
WP_024134673.1|5093_5279_+	hypothetical protein	NA	Q71T99	Escherichia_phage	100.0	1.5e-16
6072:6087	attL	AATTTATTAGAGCAAT	NA	NA	NA	NA
WP_053890978.1|6077_8342_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	67.1	0.0e+00
WP_000472529.1|8338_9244_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_001177862.1|9236_9521_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
WP_001369296.1|9794_9974_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_000007765.1|10809_11232_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	100.0	5.0e-60
WP_001281115.1|11407_11800_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
WP_001113742.1|12135_13020_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_001154687.1|13312_14122_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
WP_001285362.1|14290_15487_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000067705.1|16730_18437_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.2	2.4e-310
WP_140028048.1|18497_20087_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	99.1	6.9e-304
WP_140028049.1|20096_20912_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.5	2.2e-112
WP_000035302.1|20947_21529_+	hypothetical protein	NA	A0A077SL48	Escherichia_phage	100.0	4.5e-104
WP_000509939.1|21540_22050_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_024199466.1|22133_22430_+	hypothetical protein	NA	Q71TM6	Escherichia_phage	93.9	9.5e-50
WP_001697749.1|22596_23061_-	hypothetical protein	NA	Q71TB7	Escherichia_phage	98.7	4.3e-89
WP_001697750.1|23060_23765_-	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	99.1	8.7e-134
WP_062863745.1|23933_24779_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.9	3.2e-151
WP_001187875.1|24808_25609_-	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_140028050.1|25773_26817_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	98.0	1.7e-186
WP_072020142.1|26813_27035_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	98.6	8.1e-38
WP_000908460.1|27615_27933_+	hypothetical protein	NA	Q71TC5	Escherichia_phage	100.0	2.9e-28
WP_024166536.1|27940_28720_+	hypothetical protein	NA	Q71TC6	Escherichia_phage	96.1	9.3e-145
WP_032192785.1|28967_29534_+	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.9	4.3e-99
WP_032192784.1|29544_30156_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	98.5	2.7e-107
WP_000926346.1|30170_31052_+	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.7	6.3e-174
WP_140028051.1|31133_34859_+	transglycosylase SLT domain-containing protein	NA	A0A1B0VDM8	Salmonella_phage	86.0	0.0e+00
WP_000002800.1|34858_35215_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000047920.1|35211_36645_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	100.0	6.3e-272
WP_001189832.1|36644_37481_+	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
WP_001286325.1|37559_37994_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	7.4e-75
WP_033556184.1|40794_41397_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	1.0e-98
WP_000782982.1|41368_41788_-|tail	tail assembly chaperone	tail	M1SNQ2	Escherichia_phage	65.8	6.5e-36
WP_077688495.1|41784_42153_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	38.5	4.3e-07
WP_001165547.1|42224_42797_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
WP_000145199.1|43232_43496_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
WP_000887652.1|43570_43900_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|43896_44340_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_001345482.1|44326_44929_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_068880417.1|44930_46850_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	98.3	0.0e+00
WP_063612273.1|46846_47212_+	hypothetical protein	NA	Q1MVM8	Enterobacteria_phage	98.3	5.1e-45
WP_140028052.1|47224_50212_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.5	0.0e+00
WP_001165936.1|50201_50510_+	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_000432105.1|50539_51322_-	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	100.0	1.9e-145
WP_001376650.1|51328_52006_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	99.6	1.2e-127
WP_000068865.1|52203_52692_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
WP_001345478.1|52861_53419_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_106108351.1|53554_53731_+|holin	antiholin	holin	Q71TR5	Escherichia_phage	93.1	1.9e-26
WP_000132943.1|53710_54730_-|head	head processing protein	head	Q1MVN5	Enterobacteria_phage	100.0	3.9e-183
WP_140028053.1|54722_56432_-|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.5	0.0e+00
WP_140028054.1|56507_63275_+	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.8	0.0e+00
WP_015974230.1|63308_63749_+	hypothetical protein	NA	Q71TR9	Escherichia_phage	100.0	4.5e-80
WP_000747846.1|63745_63994_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_032190829.1|64139_66086_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	99.8	0.0e+00
WP_015974229.1|66088_69001_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	100.0	0.0e+00
WP_024175651.1|69076_69718_-	hypothetical protein	NA	Q71TG2	Escherichia_phage	100.0	5.2e-117
WP_140028055.1|69907_70474_-	recombinase	NA	Q71TG3	Escherichia_phage	95.6	3.8e-95
WP_001697578.1|70713_71025_-	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	100.0	1.6e-47
WP_105288829.1|71075_72107_-|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.4	1.9e-193
WP_000542336.1|72114_72336_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_001312283.1|72747_72861_+	hypothetical protein	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
72686:72701	attR	ATTGCTCTAATAAATT	NA	NA	NA	NA
WP_012817944.1|72879_72975_+	hypothetical protein	NA	Q38402	Escherichia_phage	100.0	2.8e-11
WP_000874154.1|72940_73150_+	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_000124155.1|74135_75620_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
WP_001369802.1|76898_77351_-	hypothetical protein	NA	Q71T63	Escherichia_phage	98.7	1.1e-78
WP_000648825.1|77439_78483_-	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	99.4	3.9e-207
WP_000113019.1|78510_78690_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_001216045.1|78694_79075_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_001190712.1|79074_79296_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000506726.1|79368_79758_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001377386.1|79881_80133_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
WP_024134677.1|80286_80484_-	hypothetical protein	NA	Q71TI2	Escherichia_phage	98.5	7.5e-27
WP_001261544.1|80794_81157_-	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_077780118.1|81153_82086_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	97.7	2.6e-178
WP_001677496.1|82447_82741_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	91.8	9.1e-45
WP_000516537.1|82919_83153_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_023356290.1|83235_84120_-	DUF551 domain-containing protein	NA	Q1MVF7	Enterobacteria_phage	97.7	6.9e-120
WP_122648061.1|84196_84460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000797279.1|84633_84822_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_033559672.1|85167_85716_-	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	65.9	1.3e-65
WP_000476202.1|85712_85952_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	92.4	2.0e-34
WP_000158003.1|85944_86148_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
WP_033559671.1|86231_86960_-	hypothetical protein	NA	Q71T76	Escherichia_phage	98.3	9.3e-139
WP_000021755.1|87154_87661_-	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.8	5.4e-93
WP_000107675.1|87733_88996_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	7.8e-234
WP_000267620.1|88997_89216_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
WP_000684845.1|89297_89999_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
WP_001354545.1|89995_90673_-	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000484112.1|90669_91296_-	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.0	2.3e-122
WP_012817939.1|91193_91856_-	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_000095381.1|91797_91953_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	96.1	2.7e-19
WP_000943609.1|92019_92598_-	norphogenetic protein	NA	Q71T85	Escherichia_phage	100.0	1.5e-107
WP_000235786.1|92992_93370_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141908.1|93379_94597_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_001615608.1|94600_95329_+	hypothetical protein	NA	Q71TJ9	Escherichia_phage	99.6	3.5e-138
WP_000602717.1|95315_96101_+	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
WP_140028056.1|96102_97119_+|tail	phage tail tape measure protein	tail	A0A077SLQ1	Escherichia_phage	99.1	1.7e-191
>prophage 1
NZ_CP040921	Escherichia coli strain FC853_EC plasmid p853EC2, complete sequence	49465	751	49402	49465	capsid,portal,terminase,plate,holin,tail,protease,transposase,head	Vibrio_phage(37.14%)	67	NA	NA
WP_000450805.1|751_1033_-	hypothetical protein	NA	A0A0C5AEP1	Bacteriophage	37.4	1.0e-05
WP_004105328.1|1042_1564_-|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	57.8	1.2e-50
WP_004105325.1|1580_3044_-	hypothetical protein	NA	A0A059WKP9	Vibrio_phage	53.6	4.2e-146
WP_001284546.1|3043_3334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609134.1|3334_3820_-	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	37.4	3.0e-16
WP_004105322.1|3816_4161_-	ATP-binding sugar transporter from pro-phage family protein	NA	NA	NA	NA	NA
WP_001523066.1|4160_4553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004105318.1|4553_5597_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	47.9	4.0e-74
WP_004105317.1|5617_6001_-|head	bacteriophage lambda head decoration D family protein	head	NA	NA	NA	NA
WP_032150711.1|6010_7078_-|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	48.2	1.3e-77
WP_001022885.1|7067_8642_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	65.7	1.2e-191
WP_001058287.1|8638_8878_-	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	52.0	6.8e-14
WP_001406385.1|8889_10746_-|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	62.7	8.5e-237
WP_001019009.1|10751_11303_-	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	29.4	1.7e-07
WP_001185429.1|11302_11893_-	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	58.5	1.6e-40
WP_001705017.1|12450_13146_-	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	33.8	1.3e-28
WP_004105305.1|13186_14560_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_023908957.1|14559_15183_-	ParB N-terminal domain-containing protein	NA	A0A0E3JS81	Verrucomicrobia_phage	43.8	2.4e-34
WP_000636451.1|16025_16238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141358.1|16215_16515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001222808.1|16589_16787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000867916.1|16786_17056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023908958.1|17167_17755_-	adenine methylase	NA	G9L699	Escherichia_phage	77.0	7.1e-81
WP_023908959.1|18432_18711_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	51.7	1.2e-17
WP_024180651.1|18707_19253_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	84.0	3.0e-89
WP_000254764.1|19236_19533_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	63.7	2.3e-27
WP_001271967.1|19519_19915_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	82.3	6.1e-52
WP_023908960.1|20105_20297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023908961.1|20293_21010_-	ead/Ea22-like family protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	92.6	1.5e-69
WP_001705006.1|21002_21347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004105282.1|21349_21961_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	45.9	5.2e-42
WP_001706266.1|21957_22116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004105278.1|22145_22511_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	55.9	3.1e-10
WP_000823235.1|22507_22789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001705004.1|22866_23934_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001250512.1|24103_24481_-	hypothetical protein	NA	A0A2I7R3L8	Vibrio_phage	35.1	6.3e-06
WP_001014473.1|24812_25217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100624.1|25216_25450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523092.1|25446_25962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004105269.1|25958_26453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839976.1|26627_27284_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004105266.1|27376_27751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000156167.1|27899_28553_+	ParA family protein	NA	A0A219YB79	Aeromonas_phage	32.5	9.2e-21
WP_000730008.1|28596_28845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183351.1|29975_30167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032154032.1|30163_31306_+	hypothetical protein	NA	B0FED5	Escherichia_phage	89.2	1.0e-51
WP_032154031.1|31340_31976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039052397.1|32632_32884_-	helix-turn-helix domain-containing protein	NA	A0A248SLB9	Klebsiella_phage	54.9	5.3e-09
WP_016240784.1|32985_33411_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	74.5	3.6e-50
WP_001523084.1|33514_33895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259436.1|34058_34358_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000269912.1|34357_34705_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000424604.1|34949_35213_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	46.2	9.8e-14
WP_000356589.1|35236_35524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024171747.1|36167_37004_-	replication initiator protein RepA	NA	NA	NA	NA	NA
WP_001704996.1|37629_38175_+	transferase	NA	NA	NA	NA	NA
WP_001523080.1|38138_38756_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	3.5e-86
WP_140028057.1|38755_41602_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	45.8	1.4e-166
WP_140028058.1|41632_42160_-|tail	phage tail protein I	tail	A0A219YA10	Aeromonas_phage	36.2	4.5e-10
WP_085947917.1|42144_43418_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001705026.1|43542_44667_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	44.2	4.9e-86
WP_001523074.1|44663_44984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000635200.1|44980_45448_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001523073.1|45444_46065_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	51.6	1.0e-29
WP_004105332.1|46067_47069_-	phage late control D family protein	NA	A0A067ZG47	Vibrio_phage	42.5	1.3e-69
WP_071592412.1|47058_47277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064717798.1|47269_49402_-|tail	phage tail tape measure protein	tail	A0A097P6S4	Vibrio_phage	39.6	3.7e-18
>prophage 1
NZ_CP040922	Escherichia coli strain FC853_EC plasmid p853EC3, complete sequence	143714	9001	51701	143714	protease,transposase	Escherichia_phage(44.44%)	44	NA	NA
WP_140028060.1|9001_10370_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	2.4e-111
WP_001312861.1|10568_10727_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001426396.1|10946_11177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032143370.1|11227_11416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140028061.1|11356_11584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032165723.1|11503_11623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107535.1|11647_11935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234469.1|12053_12875_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000243712.1|13171_13774_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001151566.1|14104_14488_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_001348626.1|14621_15299_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_001254388.1|15386_15614_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000338606.1|15647_16010_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001617873.1|16968_17253_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_000059829.1|17239_17785_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_071571857.1|17714_18062_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_001348758.1|18009_18435_+	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_000944328.1|18421_19795_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001007062.1|19791_22611_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000605862.1|22629_23127_+	entry exclusion protein	NA	NA	NA	NA	NA
WP_000850429.1|23158_23890_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000199914.1|24092_24872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047605472.1|24868_27094_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001617867.1|27093_32364_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205718.1|32383_33130_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_000139341.1|33184_33745_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013023861.1|33875_34088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023144756.1|34958_35093_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001300609.1|35568_36351_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000255944.1|36347_37370_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_072258247.1|37450_37603_+	replication protein A	NA	NA	NA	NA	NA
WP_031943482.1|37839_37914_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130640.1|37906_38764_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_012311408.1|39127_39514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000616807.1|39703_40357_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|40449_40707_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000439434.1|40708_41041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262765.1|41325_42636_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000027057.1|42912_43773_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|44014_44719_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|45598_46435_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_110221376.1|46434_46998_-	phosphotransferase	NA	NA	NA	NA	NA
WP_024946709.1|47056_50059_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	46.6	5.2e-252
WP_024946710.1|50201_51701_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	25.0	7.1e-16
