The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040918	Pasteurella multocida strain PM 8-6 chromosome, complete genome	2448652	99532	135273	2448652	transposase,integrase,tail	Pseudomonas_phage(53.33%)	46	125240:125254	134966:134980
WP_005755558.1|99532_100378_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	62.4	2.4e-101
WP_005755559.1|100529_100790_-	hypothetical protein	NA	B7SDP6	Haemophilus_phage	57.3	5.8e-19
WP_025248440.1|100855_103645_-|tail	phage tail protein	tail	A0A2D1GNP9	Pseudomonas_phage	46.0	2.0e-181
WP_014668240.1|103644_103845_-	hypothetical protein	NA	A0A2D2W288	Stenotrophomonas_phage	45.8	1.2e-08
WP_005755565.1|103848_104100_-	hypothetical protein	NA	A0A2D1GNV4	Pseudomonas_phage	59.2	4.6e-21
WP_014668241.1|104116_104926_-	DUF2163 domain-containing protein	NA	A0A2D1GNT2	Pseudomonas_phage	50.5	1.7e-77
WP_014668242.1|104939_106619_-	hypothetical protein	NA	J9STL4	Pseudomonas_phage	38.6	4.4e-91
WP_005755570.1|106626_107589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668243.1|107590_108583_-	hypothetical protein	NA	A0A2D1GMZ0	Marinobacter_phage	27.5	5.2e-23
WP_014668244.1|108592_111940_-	tape measure protein	NA	A0A2D1GNK1	Pseudomonas_phage	32.5	3.8e-118
WP_014668245.1|111952_112168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538947.1|112198_112378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668246.1|112377_112803_-	hypothetical protein	NA	A0A2D1GNY5	Pseudomonas_phage	40.4	3.0e-20
WP_014668247.1|113552_113813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668248.1|113809_114256_-	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	30.9	1.5e-14
WP_005755584.1|114255_114762_-	DUF1320 domain-containing protein	NA	Q5ZQX5	Pseudomonas_phage	42.1	1.6e-28
WP_005755585.1|114771_115695_-	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	60.7	1.8e-102
WP_014668249.1|115755_116121_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_014668250.1|116117_117119_-	peptidase	NA	Q5ZQY0	Pseudomonas_phage	54.6	8.0e-40
WP_014668251.1|117336_117837_-	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	41.7	3.1e-32
WP_014668252.1|117934_119173_-	hypothetical protein	NA	J9STS2	Pseudomonas_phage	47.2	2.3e-105
WP_014668253.1|119156_120680_-	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	53.5	2.5e-149
WP_025248438.1|120682_122299_-	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	64.6	2.9e-185
WP_014668255.1|122298_122838_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	51.7	4.0e-46
WP_005755593.1|122849_123155_-	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	53.0	8.7e-22
WP_005755594.1|123156_123507_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	33.6	5.3e-07
WP_038641606.1|123603_123855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668258.1|124034_124634_-	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	55.7	2.7e-59
WP_014668259.1|124635_125007_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	53.2	2.6e-20
125240:125254	attL	CAGTAATTTTTACTC	NA	NA	NA	NA
WP_014668260.1|125248_125488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668261.1|125545_126136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140012161.1|126425_126674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005755617.1|126704_127115_-	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	39.4	8.9e-14
WP_005755620.1|127583_127820_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_014668263.1|127899_128085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005755623.1|128097_128412_+	hypothetical protein	NA	Q5ZR02	Pseudomonas_phage	41.1	5.8e-13
WP_014668264.1|128422_129367_+	hypothetical protein	NA	J9SND0	Pseudomonas_phage	31.5	2.3e-28
WP_014668265.1|129378_131148_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	46.5	1.8e-148
WP_014668266.1|131159_132338_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	54.8	4.6e-111
WP_014668267.1|132340_132664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005755632.1|132673_132895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032851712.1|132869_133124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005755634.1|133143_133764_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	60.2	1.2e-67
WP_005755637.1|133933_134161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668269.1|134157_134703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668270.1|134712_135273_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	29.7	8.2e-18
134966:134980	attR	GAGTAAAAATTACTG	NA	NA	NA	NA
>prophage 2
NZ_CP040918	Pasteurella multocida strain PM 8-6 chromosome, complete genome	2448652	309714	319072	2448652		Sinorhizobium_phage(16.67%)	9	NA	NA
WP_014326205.1|309714_310989_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.8e-92
WP_005753554.1|311029_311647_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_014326206.1|311646_312534_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_025248491.1|312603_313551_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	39.0	1.5e-43
WP_005753553.1|313626_315180_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
WP_010906540.1|315414_316206_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	4.4e-17
WP_005724066.1|316214_317000_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_005724065.1|317076_318057_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-15
WP_014326208.1|318073_319072_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
>prophage 3
NZ_CP040918	Pasteurella multocida strain PM 8-6 chromosome, complete genome	2448652	666305	675743	2448652	transposase	Lactococcus_phage(16.67%)	7	NA	NA
WP_010907422.1|666305_668708_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.2	5.2e-69
WP_005725044.1|668708_669446_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_038641419.1|669530_670091_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	61.8	1.6e-50
WP_010907420.1|670161_672993_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
WP_005719438.1|673164_673665_+	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	55.6	4.0e-40
WP_014325726.1|673847_674312_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
WP_005725034.1|674888_675743_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.3	5.8e-31
>prophage 4
NZ_CP040918	Pasteurella multocida strain PM 8-6 chromosome, complete genome	2448652	853670	930765	2448652	plate,protease,terminase,integrase,tRNA,tail	Escherichia_phage(21.62%)	78	848781:848796	900419:900434
848781:848796	attL	AAAGTGCGGTCATTTT	NA	NA	NA	NA
WP_014326462.1|853670_854954_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	34.4	6.6e-63
WP_014326463.1|855582_856965_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_016504487.1|857000_857933_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_014326465.1|858153_860028_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.2	7.5e-15
WP_014326466.1|860078_860627_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_016504488.1|860644_861250_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.7	3.1e-23
WP_014326468.1|861338_862187_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_005724710.1|862188_862809_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.8	1.4e-71
WP_075270726.1|863748_864459_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	48.4	6.4e-52
WP_046338746.1|864634_864901_+	transcriptional regulator	NA	F6MII4	Haemophilus_phage	63.4	1.2e-19
WP_075270727.1|864945_866931_+	DDE endonuclease	NA	M4M9R2	Vibrio_phage	45.1	7.1e-157
WP_075270728.1|866941_867859_+	AAA family ATPase	NA	M4M9P4	Vibrio_phage	43.5	1.5e-61
WP_075270729.1|867861_868158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270730.1|868171_868399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270731.1|868413_868935_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	54.4	1.0e-46
WP_075270732.1|869020_869209_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075270733.1|869416_870331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270734.1|870400_870901_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_075270735.1|870897_871440_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	43.7	2.4e-38
WP_075270736.1|871439_871802_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	44.2	2.9e-24
WP_075270737.1|871920_872343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270738.1|872467_873004_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	69.7	1.3e-73
WP_064775722.1|873014_873242_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	72.4	6.0e-20
WP_064775721.1|873238_873499_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_064775719.1|873616_873946_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_074865631.1|873942_874245_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	61.5	2.2e-25
WP_075270739.1|874267_874840_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	44.0	1.7e-34
WP_075270740.1|874826_876134_+|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	65.7	6.5e-151
WP_075270741.1|876135_877551_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	45.8	2.0e-113
WP_016533207.1|877551_878823_+	mu gp30-like protein	NA	J9STS2	Pseudomonas_phage	49.1	2.5e-54
WP_016533208.1|878951_879416_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	38.8	6.8e-10
WP_016533209.1|879666_880770_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	42.0	4.6e-73
WP_016533210.1|880788_881715_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	47.9	1.0e-73
WP_016533211.1|881780_882098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533212.1|882097_882532_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	37.8	4.0e-20
WP_016533213.1|882543_883041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533214.1|883050_884436_+|tail	tail sheath-like protein	tail	A4JWK5	Burkholderia_virus	44.3	2.0e-97
WP_016533215.1|884446_884965_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	45.0	3.9e-38
WP_016533216.1|885057_885327_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_016533217.1|885347_885482_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_016533218.1|885497_885731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570132.1|885765_888114_+|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	38.8	1.1e-71
WP_016533316.1|888113_889046_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_016533315.1|889026_889257_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	47.8	7.2e-13
WP_016533314.1|889249_890314_+	regulator-like protein	NA	NA	NA	NA	NA
WP_016533313.1|890300_890870_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_016533312.1|890924_891290_+|plate	phage baseplate-like protein	plate	NA	NA	NA	NA
WP_016533311.1|891289_892396_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	36.4	3.6e-57
WP_016533310.1|892388_892958_+|tail	phage tail protein	tail	A4JWL7	Burkholderia_virus	44.8	4.5e-40
WP_016570130.1|895505_895685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718857.1|897877_898597_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	34.2	2.0e-16
WP_005724708.1|898740_900234_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_014326471.1|900453_901317_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
900419:900434	attR	AAAATGACCGCACTTT	NA	NA	NA	NA
WP_005724701.1|901428_901959_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_014326472.1|901974_903306_+	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	29.1	4.6e-43
WP_010907311.1|903386_904337_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.7	3.9e-28
WP_005751979.1|905054_906239_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.3	8.3e-12
WP_014326473.1|906361_907702_-	phospholipase	NA	NA	NA	NA	NA
WP_005751981.1|907766_909233_-	gluconate permease	NA	NA	NA	NA	NA
WP_014326474.1|909244_910192_-	SDR family oxidoreductase	NA	A0A0N7KVW3	Yellowstone_lake_phycodnavirus	26.0	3.4e-08
WP_014326475.1|910330_912130_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005723974.1|912131_912806_-	cyclase family protein	NA	NA	NA	NA	NA
WP_014326476.1|912821_913604_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_005751985.1|913605_914238_-	aldolase	NA	A0A077SK32	Escherichia_phage	60.0	2.2e-64
WP_016504417.1|914234_915476_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	53.5	3.2e-115
WP_116538863.1|915478_916384_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	72.9	8.9e-115
WP_005717875.1|916598_917360_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	52.4	7.9e-64
WP_116538864.1|917417_918878_-	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_014326479.1|919036_919498_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005754896.1|919572_920757_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_005752716.1|921214_921961_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014326482.1|923242_923731_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_014668377.1|923745_925056_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_014326484.1|925105_925951_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014326485.1|925976_927380_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_014326486.1|927389_928331_+	sugar kinase	NA	NA	NA	NA	NA
WP_005754908.1|928349_928988_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_005757558.1|929049_930765_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP040918	Pasteurella multocida strain PM 8-6 chromosome, complete genome	2448652	1591886	1636160	2448652	head,terminase,coat,integrase,tail	Mannheimia_phage(50.0%)	68	1591737:1591782	1645893:1645938
1591737:1591782	attL	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
WP_014390695.1|1591886_1593059_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	53.1	2.0e-111
WP_014390696.1|1593434_1593890_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	47.1	4.6e-27
WP_041423219.1|1593934_1594288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391445.1|1594296_1594794_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_014391447.1|1594928_1595528_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	37.6	4.6e-19
WP_064964852.1|1595578_1596367_-	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.6	4.2e-20
WP_016570064.1|1596438_1596792_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_116538880.1|1596864_1597317_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	52.9	1.4e-36
WP_075271319.1|1597316_1597856_-	HNH endonuclease	NA	U5XJH2	Phormidium_phage	44.1	4.8e-07
WP_116538881.1|1597855_1598515_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	74.9	1.2e-95
WP_014391451.1|1598501_1599455_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	72.8	1.2e-122
WP_014391452.1|1599456_1599744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538882.1|1599756_1599993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538883.1|1599964_1600264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|1600330_1600642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538953.1|1600703_1601360_-	KilA-N domain-containing protein	NA	K7PH30	Enterobacteria_phage	46.6	2.7e-20
WP_064964923.1|1602283_1603081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538884.1|1603299_1603680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391457.1|1603857_1604130_+	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	78.9	5.5e-36
WP_014391458.1|1604122_1604311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391459.1|1604607_1604802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271373.1|1604965_1605196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041423181.1|1605704_1606229_-	DUF2730 family protein	NA	A0A0M3LP99	Mannheimia_phage	60.4	1.3e-22
WP_014391463.1|1606200_1606596_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	77.8	2.2e-57
WP_099803111.1|1606615_1607305_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	56.2	9.6e-69
WP_099803112.1|1607426_1607627_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101750067.1|1607675_1608128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390721.1|1608179_1608863_+	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	67.9	9.5e-77
WP_075271368.1|1608859_1609075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538885.1|1609071_1609830_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	85.3	1.5e-46
WP_078819893.1|1609826_1611182_+	AAA family ATPase	NA	A0A0M3LQC0	Mannheimia_phage	52.2	5.2e-127
WP_078819892.1|1611184_1611610_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	59.3	5.6e-43
WP_014667790.1|1611683_1611899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538886.1|1611891_1612494_+	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	4.8e-32
WP_116538887.1|1612495_1612957_+	antitermination protein	NA	NA	NA	NA	NA
WP_064964938.1|1613086_1613644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391475.1|1613760_1614021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078737811.1|1614017_1614548_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	51.4	2.0e-45
WP_116538954.1|1614520_1614844_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_116538888.1|1614749_1615031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538955.1|1615267_1615603_+	DUF2829 domain-containing protein	NA	F8WPN8	Bacillus_phage	45.3	1.9e-14
WP_016533412.1|1615711_1616089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533413.1|1616212_1616449_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016533414.1|1616445_1616742_-	hypothetical protein	NA	S5M7P0	Sinorhizobium_phage	43.0	1.9e-13
WP_016533415.1|1616874_1617576_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_016533416.1|1617562_1617991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538889.1|1618306_1618897_+	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	39.5	3.7e-21
WP_116538890.1|1618899_1620171_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	61.4	4.3e-147
WP_116538891.1|1620180_1621584_+	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	59.8	6.8e-154
WP_079157879.1|1621573_1623175_+|head	phage head morphogenesis protein	head	A0A0M3LQ07	Mannheimia_phage	52.1	4.7e-151
WP_079157866.1|1623177_1623396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064965033.1|1623370_1623805_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	D0UIJ3	Aggregatibacter_phage	60.1	7.7e-40
WP_079157867.1|1623841_1624240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079157868.1|1624415_1625201_+	hypothetical protein	NA	A0A1V0DY60	Dinoroseobacter_phage	36.5	1.1e-25
WP_075271385.1|1625218_1626376_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	43.6	1.3e-81
WP_015691075.1|1626432_1626669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538892.1|1626685_1627153_+	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	55.7	1.4e-34
WP_015691077.1|1627154_1627529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533105.1|1627530_1627932_+	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.4	2.1e-39
WP_015691079.1|1627931_1628324_+	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	46.2	5.5e-29
WP_116538893.1|1628336_1629353_+	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	69.3	1.1e-129
WP_016533103.1|1629425_1629842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080637888.1|1629841_1630171_+	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	54.8	1.8e-25
WP_116538894.1|1630210_1630540_+|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	50.9	1.9e-27
WP_116538895.1|1630611_1631307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538896.1|1634141_1634846_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	64.4	1.0e-81
WP_116538956.1|1634850_1635594_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	60.8	7.9e-85
WP_102827078.1|1635536_1636160_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	55.3	9.6e-52
1645893:1645938	attR	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
>prophage 6
NZ_CP040918	Pasteurella multocida strain PM 8-6 chromosome, complete genome	2448652	1660664	1741187	2448652	plate,head,transposase,tRNA,tail	Shigella_phage(25.0%)	84	NA	NA
WP_014325706.1|1660664_1662734_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005751822.1|1662763_1663144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325707.1|1663274_1663898_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_014325708.1|1663915_1664179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095177582.1|1664209_1665115_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016504292.1|1665393_1666647_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_005723289.1|1666757_1667615_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_005717448.1|1667867_1668881_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_005717447.1|1668951_1669398_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_005717446.1|1669552_1670014_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005723284.1|1670115_1671462_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005723282.1|1671544_1671796_+	YhdT family protein	NA	NA	NA	NA	NA
WP_014325712.1|1671785_1673219_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005717441.1|1673361_1674243_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_005723278.1|1674519_1675524_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005723276.1|1675504_1675804_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_025248417.1|1676028_1679922_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	53.2	1.5e-113
WP_014325718.1|1683189_1684215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016504262.1|1684679_1687109_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_116538899.1|1687254_1687992_-	ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	32.5	1.9e-14
WP_014325720.1|1688003_1688948_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005717426.1|1688960_1689749_-	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014325721.1|1690056_1690611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325722.1|1691091_1692171_+	endonuclease	NA	NA	NA	NA	NA
WP_010907004.1|1692260_1693916_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	34.9	7.4e-83
WP_005723242.1|1694133_1694688_-	DUF5358 domain-containing protein	NA	NA	NA	NA	NA
WP_025248418.1|1694835_1696593_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_005723238.1|1696777_1698439_+	putative transporter	NA	NA	NA	NA	NA
WP_005723236.1|1698486_1698777_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_014325723.1|1699021_1700332_+	porin	NA	NA	NA	NA	NA
WP_014325724.1|1700394_1700937_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.7	4.8e-23
WP_005757181.1|1700946_1701615_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_005717387.1|1701680_1702409_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	38.1	4.9e-31
WP_005826050.1|1702689_1702950_+	hypothetical protein	NA	F6MIM3	Haemophilus_phage	100.0	6.4e-42
WP_116538957.1|1702990_1703776_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	95.4	5.3e-148
WP_116538900.1|1703914_1704199_-	DNA helicase UvrD	NA	Q776W9	Haemophilus_phage	62.5	2.8e-22
WP_116538901.1|1704177_1704726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538902.1|1704728_1706948_-	hypothetical protein	NA	A0A1Y0SVL0	Pasteurella_phage	33.4	7.3e-86
WP_116538958.1|1706950_1707508_-	YmfQ family protein	NA	A0A2I7S9L6	Vibrio_phage	34.6	1.9e-22
WP_116538903.1|1707540_1708608_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	43.1	9.3e-71
WP_005752473.1|1708607_1709018_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	38.7	3.5e-18
WP_116538904.1|1709028_1709577_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	47.0	2.2e-31
WP_116538905.1|1709608_1710088_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	39.0	1.2e-14
WP_116538906.1|1710091_1710859_-|tail	phage tail protein	tail	A0A0C4UQS1	Shigella_phage	37.4	4.1e-44
WP_116538907.1|1710858_1712223_-	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	27.5	2.3e-34
WP_116538908.1|1712232_1714125_-	tape measure protein	NA	A0A2I7S9D9	Vibrio_phage	34.4	1.2e-55
WP_116538909.1|1714214_1714598_-	hypothetical protein	NA	C9DGP9	Escherichia_phage	52.1	6.4e-22
WP_005752480.1|1714601_1714955_-|tail	tail protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	32.7	1.7e-08
WP_116538910.1|1714965_1716429_-|tail	phage tail protein	tail	A0A0C4UQS0	Shigella_phage	50.6	4.0e-125
WP_005738156.1|1716428_1716620_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_079157925.1|1716631_1717186_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_116538911.1|1717182_1717605_-	DUF1320 family protein	NA	NA	NA	NA	NA
WP_116538912.1|1717601_1718006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005825910.1|1718094_1719018_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	55.1	7.5e-93
WP_116538913.1|1719017_1720082_-	hypothetical protein	NA	A0A0C4UQU6	Shigella_phage	48.0	2.1e-70
WP_116538914.1|1720310_1720745_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_139625264.1|1720913_1721180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538916.1|1721319_1722654_-|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	42.1	4.3e-89
WP_116538959.1|1722640_1724200_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	52.8	1.2e-146
WP_116538960.1|1724202_1725717_-	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	61.4	1.2e-156
WP_116538917.1|1725773_1726343_-	DUF3486 family protein	NA	A0A2I7S9D1	Vibrio_phage	45.9	1.7e-42
WP_005752497.1|1726376_1726670_-	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	65.6	1.4e-24
WP_005752500.1|1726666_1726996_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_116538918.1|1726992_1727220_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_116538919.1|1727212_1727431_-	hypothetical protein	NA	F6MIK2	Haemophilus_phage	61.2	2.5e-07
WP_116538920.1|1727348_1727621_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_005752503.1|1727623_1727842_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	88.4	9.2e-26
WP_116538921.1|1727844_1728393_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	70.6	3.3e-72
WP_116538922.1|1728472_1728988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538923.1|1728996_1729431_-	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	43.3	4.2e-22
WP_116538924.1|1729634_1730189_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	53.0	1.3e-44
WP_116538925.1|1730175_1730724_-	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_116538926.1|1730860_1731277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005752512.1|1731278_1731464_-	hypothetical protein	NA	F6MIJ2	Haemophilus_phage	96.4	6.4e-20
WP_005752513.1|1731463_1731682_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_116538927.1|1731757_1732054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538928.1|1732050_1732575_-	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	92.5	2.3e-83
WP_005825938.1|1732599_1732917_-	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	45.2	1.5e-13
WP_116538929.1|1733871_1734378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538930.1|1734478_1736470_-|transposase	transposase	transposase	C9DGL1	Escherichia_phage	44.7	9.3e-149
WP_079157945.1|1736481_1736694_-	DNA-binding protein	NA	A0A0M3LPY8	Mannheimia_phage	70.6	1.9e-20
WP_116538931.1|1736907_1737447_+	DNA-binding protein	NA	A0A0M3LP76	Mannheimia_phage	69.1	7.4e-16
WP_014325726.1|1737804_1738269_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
WP_116538932.1|1738394_1741187_-	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	33.6	5.4e-78
