The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040902	Longibaculum sp. KGMB06250 chromosome, complete genome	2918948	1290152	1310827	2918948	capsid,terminase	Clostridium_phage(25.0%)	42	NA	NA
WP_117574499.1|1290152_1290419_+	hypothetical protein	NA	K4K7R2	Streptococcus_phage	44.3	1.3e-13
WP_118744041.1|1290490_1290958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744042.1|1290959_1291430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118721797.1|1291422_1291761_+	hypothetical protein	NA	F8UBK7	Clostridium_phage	44.6	3.3e-06
WP_118721796.1|1291757_1292033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158548228.1|1292032_1292179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117574504.1|1292314_1292515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117574505.1|1292507_1292690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744043.1|1292671_1293073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117574507.1|1293065_1293245_+	hypothetical protein	NA	A0A1J0MGB9	Staphylococcus_phage	55.2	1.6e-07
WP_117574508.1|1293245_1293635_+	hypothetical protein	NA	A0A191KC44	Streptococcus_virus	34.8	3.8e-14
WP_117574509.1|1293645_1293978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744045.1|1293983_1294175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744046.1|1294299_1294797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168191641.1|1295712_1296312_+	hypothetical protein	NA	Q5YA77	Bacillus_phage	27.7	3.1e-15
WP_117574514.1|1296295_1297675_+|terminase	PBSX family phage terminase large subunit	terminase	A0A286QNX6	Streptococcus_phage	25.4	1.9e-28
WP_118748670.1|1297719_1299156_+|capsid	phage capsid protein	capsid	F6K8Q7	Clostridium_phage	38.3	8.1e-86
WP_118744007.1|1299145_1300993_+	hypothetical protein	NA	A0A2K9V3K1	Faecalibacterium_phage	26.1	4.0e-37
WP_158546467.1|1300970_1301147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168191642.1|1301177_1301339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158576624.1|1301394_1301541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744008.1|1301559_1301823_+	hypothetical protein	NA	C1KFI4	Lactobacillus_virus	65.5	1.7e-26
WP_139939322.1|1301827_1302304_+	DUF2829 domain-containing protein	NA	H7BV51	unidentified_phage	54.6	2.7e-46
WP_118744010.1|1302316_1302622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117782128.1|1302623_1302809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744011.1|1302803_1303340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117782130.1|1303467_1303998_-	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	39.4	2.3e-06
WP_168191603.1|1304133_1304277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744012.1|1304370_1304658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744013.1|1304635_1305061_+	hypothetical protein	NA	A0A059T7N7	Staphylococcus_phage	51.8	6.0e-29
WP_139939325.1|1305042_1305291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117782133.1|1305370_1305589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744015.1|1305734_1306337_+	hypothetical protein	NA	L0P7B0	Lactobacillus_phage	28.5	6.5e-05
WP_118744016.1|1306360_1307251_+|capsid	capsid protein	capsid	X5J9Z5	Clostridium_phage	63.7	9.4e-109
WP_118744017.1|1307267_1307579_+	hypothetical protein	NA	A0A0A8WFD0	Clostridium_phage	36.7	9.8e-05
WP_118744018.1|1307580_1307985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744019.1|1307977_1308376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168191643.1|1308405_1308735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744021.1|1308724_1309207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744022.1|1309206_1309776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744023.1|1309803_1310301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118744024.1|1310227_1310827_+	hypothetical protein	NA	M1IEU4	Streptococcus_phage	42.1	6.1e-11
>prophage 2
NZ_CP040902	Longibaculum sp. KGMB06250 chromosome, complete genome	2918948	1524082	1539991	2918948	tRNA	Prochlorococcus_phage(18.18%)	13	NA	NA
WP_081918925.1|1524082_1524427_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	37.5	1.4e-12
WP_022001468.1|1524563_1525631_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	31.7	2.7e-09
WP_139939479.1|1525623_1527375_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	25.5	1.4e-23
WP_139939481.1|1527367_1528651_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	7.1e-17
WP_022001465.1|1528964_1529222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139939483.1|1529221_1530601_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	41.7	1.0e-98
WP_139939485.1|1530602_1534358_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.7	6.9e-28
WP_107029483.1|1534369_1535623_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_022001461.1|1535632_1537156_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	43.6	8.7e-62
WP_022001460.1|1537156_1537750_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.1	2.0e-22
WP_022001459.1|1537743_1538769_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.5	4.2e-68
WP_022001458.1|1538784_1539489_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	44.3	4.0e-46
WP_117864350.1|1539502_1539991_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.6	1.3e-22
>prophage 3
NZ_CP040902	Longibaculum sp. KGMB06250 chromosome, complete genome	2918948	1972428	1979782	2918948		Bacillus_phage(33.33%)	9	NA	NA
WP_139939721.1|1972428_1973667_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	25.0	8.4e-15
WP_022002962.1|1973682_1974936_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	32.4	2.0e-24
WP_139939723.1|1974928_1975603_-	response regulator	NA	W8CYM9	Bacillus_phage	34.4	1.3e-33
WP_022002964.1|1975595_1976549_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	48.5	4.2e-46
WP_117574989.1|1976545_1977454_-	sporulation protein YqfD	NA	NA	NA	NA	NA
WP_022002966.1|1977450_1977642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022002967.1|1977745_1978216_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_117346620.1|1978229_1979096_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	28.7	9.1e-08
WP_117787126.1|1979182_1979782_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.2	8.2e-32
>prophage 4
NZ_CP040902	Longibaculum sp. KGMB06250 chromosome, complete genome	2918948	2125223	2132635	2918948	integrase	Streptococcus_phage(50.0%)	7	2130572:2130600	2132767:2132795
WP_000336323.1|2125223_2125391_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_001227347.1|2125450_2125804_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_117792692.1|2126308_2126728_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	66.4	5.5e-43
WP_044383637.1|2126769_2126973_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_139939801.1|2127241_2130541_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	26.4	3.3e-18
WP_168191659.1|2130534_2131614_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	25.9	2.6e-12
2130572:2130600	attL	AATCTTGATTTATCGACTTCTTTTACAAA	NA	NA	NA	NA
WP_118662369.1|2131639_2132635_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.5	5.9e-35
WP_118662369.1|2131639_2132635_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.5	5.9e-35
2132767:2132795	attR	AATCTTGATTTATCGACTTCTTTTACAAA	NA	NA	NA	NA
>prophage 5
NZ_CP040902	Longibaculum sp. KGMB06250 chromosome, complete genome	2918948	2305318	2371135	2918948	transposase,tRNA	Planktothrix_phage(25.0%)	54	NA	NA
WP_107030509.1|2305318_2306430_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.7	1.9e-74
WP_117832731.1|2306515_2307649_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_022002108.1|2308066_2308945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139939935.1|2313445_2313787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139939937.1|2314284_2317788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139939939.1|2317808_2318108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107030148.1|2318450_2319014_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.3	1.9e-22
WP_139939941.1|2318902_2319706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022001897.1|2319892_2320144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022001898.1|2320140_2320773_-	rubredoxin	NA	NA	NA	NA	NA
WP_022001899.1|2320795_2322277_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_139939943.1|2323670_2324996_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.0	1.7e-05
WP_107030145.1|2325000_2325654_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	9.5e-26
WP_118347697.1|2325751_2327128_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_117346429.1|2327127_2327784_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	6.4e-22
WP_107030142.1|2327793_2329071_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_139939945.1|2330829_2331120_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_107030140.1|2331044_2331401_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_107030139.1|2331356_2331551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168191666.1|2331580_2331778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022000839.1|2331908_2332499_-	rubredoxin	NA	NA	NA	NA	NA
WP_139939947.1|2332654_2333515_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_139939949.1|2333502_2334399_-	AEC family transporter	NA	NA	NA	NA	NA
WP_139939951.1|2334400_2335516_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_139940510.1|2335546_2336830_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_139939953.1|2336842_2338249_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_117865149.1|2338362_2339256_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_139939955.1|2339429_2339876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139939957.1|2340008_2340608_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_117783290.1|2340604_2341255_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_139940512.1|2341247_2342123_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_107030129.1|2342124_2344026_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	G9BWE0	Planktothrix_phage	32.5	8.4e-22
WP_107030128.1|2344029_2344761_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	R4ZGL0	Mythimna_separata_entomopoxvirus	23.1	2.1e-05
WP_139939959.1|2347039_2349229_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_107030125.1|2349310_2349874_-	guanylate kinase	NA	S4W1R9	Pandoravirus	31.9	1.2e-11
WP_022001655.1|2349974_2351615_+	fibronectin/fibrinogen-binding protein	NA	M1H1U8	Paramecium_bursaria_Chlorella_virus	38.5	8.3e-10
WP_022001654.1|2351632_2351911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032089887.1|2351980_2352727_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_118306547.1|2352756_2353128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139939961.1|2353376_2354846_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_139939963.1|2354915_2356331_-	peptidoglycan endopeptidase	NA	A0A0K2SUC1	Clostridium_phage	48.2	6.0e-25
WP_117865162.1|2356525_2357929_-	DUF5011 domain-containing protein	NA	A0A090DCQ7	Clostridium_phage	38.4	8.1e-22
WP_139939965.1|2358225_2361453_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_117481134.1|2361455_2362160_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-34
WP_032089881.1|2362221_2362749_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_139939967.1|2362749_2364021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139939969.1|2364020_2364791_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	3.1e-31
WP_107030117.1|2366096_2366519_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_139939971.1|2366704_2367376_-|tRNA	tRNA ligase	tRNA	NA	NA	NA	NA
WP_139939973.1|2367415_2368348_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	56.8	6.2e-87
WP_022002087.1|2368463_2368823_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_022002088.1|2368857_2369052_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_032089875.1|2369070_2369628_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.5	5.8e-16
WP_052010840.1|2369998_2371135_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.6	1.5e-31
