The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032903	Helicobacter pylori strain 173-A-EK1 chromosome, complete genome	1690720	1501898	1556305	1690720	protease,transposase,integrase	Catovirus(20.0%)	39	1517693:1517714	1556281:1556302
WP_139545624.1|1501898_1502687_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_139545625.1|1502664_1503120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139545626.1|1503119_1504505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139545627.1|1504508_1506686_-	competence protein	NA	NA	NA	NA	NA
WP_139545628.1|1506729_1508124_-	hypothetical protein	NA	NA	NA	NA	NA
1517693:1517714	attL	AAATCTAAAGAAGTCTTAAAGA	NA	NA	NA	NA
WP_000462384.1|1518097_1518307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139545629.1|1518303_1518555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139545770.1|1518686_1519007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139545630.1|1519019_1521080_+	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	29.1	7.1e-59
WP_052918319.1|1521119_1521605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377503.1|1521574_1522378_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_025454908.1|1522451_1523117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139545771.1|1523094_1523472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139545631.1|1523518_1524187_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	32.6	7.7e-23
WP_139545632.1|1524988_1526113_+	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
WP_139545633.1|1526112_1527906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139545634.1|1527915_1529349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139545635.1|1529345_1530608_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_139545636.1|1530604_1531315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139545637.1|1531307_1531883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127983487.1|1531887_1532901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139545638.1|1533080_1533494_+|protease	CAAX protease	protease	NA	NA	NA	NA
WP_000006537.1|1533893_1534145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139545639.1|1534116_1534920_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_139545640.1|1535236_1536304_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.0e-08
WP_139545772.1|1537458_1539258_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_139545773.1|1540643_1541138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139545774.1|1541200_1542277_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_139545641.1|1542528_1542930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139545642.1|1542939_1543200_-	type VII secretion protein	NA	NA	NA	NA	NA
WP_139545643.1|1543215_1543785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139545644.1|1543781_1544549_-	dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_139545645.1|1546245_1547187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139545775.1|1547570_1547957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139545646.1|1548254_1548464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139545647.1|1548785_1552343_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_139545648.1|1552369_1553860_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_139545649.1|1554456_1555686_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	39.8	1.4e-70
WP_139545516.1|1555672_1556305_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	45.5	9.5e-39
1556281:1556302	attR	TCTTTAAGACTTCTTTAGATTT	NA	NA	NA	NA
