The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032480	Helicobacter pylori strain 19-C-EK1 chromosome, complete genome	1709363	553710	607089	1709363	tRNA,terminase,transposase,holin,protease,portal	Helicobacter_phage(87.5%)	42	NA	NA
WP_139543921.1|553710_554691_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_139543922.1|554629_555775_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_001099598.1|555771_556353_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_001115881.1|556499_556706_+	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_139543923.1|556768_557872_-	Hop family outer membrane protein HopJ/HopK	NA	NA	NA	NA	NA
WP_139544631.1|557923_565378_-	toxin	NA	NA	NA	NA	NA
WP_139543924.1|565457_566453_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_139543925.1|566597_567290_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_139543926.1|567388_570646_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_139543927.1|570650_571082_+	Sua5/YciO/YrdC/YwlC family protein	NA	NA	NA	NA	NA
WP_139543928.1|571261_573697_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_108383079.1|573944_575489_+	outer membrane beta-barrel protein HofG	NA	NA	NA	NA	NA
WP_139543929.1|576285_577881_-	Hop family adhesin AlpB	NA	NA	NA	NA	NA
WP_139543930.1|577902_579456_-	Hop family adhesin AlpA	NA	NA	NA	NA	NA
WP_139543931.1|580289_582317_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	27.8	2.3e-54
WP_139543932.1|582320_583460_-	N-6 DNA methylase	NA	A0A1V0SF64	Hokovirus	31.9	6.9e-48
WP_139543933.1|583481_584063_-	restriction endonuclease	NA	R4THR6	Phaeocystis_globosa_virus	34.9	2.2e-26
WP_139543934.1|584114_585932_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_139543935.1|585928_586924_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_139543936.1|586974_588483_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_139543937.1|588620_589631_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_000063685.1|590897_591365_+|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	99.4	7.9e-83
WP_139543879.1|591333_592482_+|transposase	transposase	transposase	G9CU70	Helicobacter_phage	99.0	3.9e-216
WP_139544632.1|592566_592962_+	DUF1353 domain-containing protein	NA	A0A1S5REZ3	Helicobacter_phage	92.4	6.3e-65
WP_139543938.1|592961_593363_+	hypothetical protein	NA	A0A1S5RFA7	Helicobacter_phage	85.7	4.7e-60
WP_139543939.1|593359_593947_+	hypothetical protein	NA	I7HHP2	Helicobacter_phage	90.3	2.0e-91
WP_139543940.1|594172_594721_+	Coiled-coil domain-containing protein	NA	A0A1S5RFN1	Helicobacter_phage	91.5	2.6e-85
WP_139543941.1|595893_596250_+	hypothetical protein	NA	A0A1S5RG28	Helicobacter_phage	83.1	2.2e-48
WP_139543942.1|596287_596695_+	hypothetical protein	NA	A0A1S5RFS1	Helicobacter_phage	96.3	1.0e-65
WP_139543943.1|596764_598570_+|portal	portal protein	portal	A0A1S5RFE9	Helicobacter_phage	93.2	3.3e-312
WP_139543944.1|598684_600241_+	hypothetical protein	NA	A0A1S5RFE3	Helicobacter_phage	96.1	4.1e-293
WP_139543945.1|600306_600510_+	hypothetical protein	NA	A0A1S5RFP0	Helicobacter_phage	95.5	3.8e-26
WP_139543946.1|600520_600757_+	hypothetical protein	NA	A0A1S5RF02	Helicobacter_phage	76.9	1.2e-23
WP_139543947.1|600756_601086_+|holin	holin	holin	A0A1S5RF07	Helicobacter_phage	87.2	3.5e-45
WP_139543948.1|601087_602083_+	hypothetical protein	NA	A0A1S5RF11	Helicobacter_phage	80.4	2.4e-137
WP_139543949.1|602079_602319_+	hypothetical protein	NA	A0A1S5RFZ3	Helicobacter_phage	88.4	1.0e-25
WP_139543950.1|602352_602898_+	hypothetical protein	NA	A0A1S5RF47	Helicobacter_phage	96.1	2.3e-97
WP_139543951.1|602901_603720_+	hypothetical protein	NA	A0A1S5RHD1	Helicobacter_phage	92.6	2.2e-128
WP_139543952.1|603721_604282_+	hypothetical protein	NA	A0A1S5RG18	Helicobacter_phage	71.0	3.8e-47
WP_139543953.1|604281_604608_+	hypothetical protein	NA	A0A1S5RHF0	Helicobacter_phage	85.2	7.3e-43
WP_139543954.1|605558_606338_+	Coiled-coil domain-containing protein	NA	A0A1S5RFL1	Helicobacter_phage	82.6	4.3e-118
WP_139543955.1|606324_607089_+|terminase	terminase	terminase	A0A1S5RFI2	Helicobacter_phage	86.2	1.5e-110
>prophage 2
NZ_CP032480	Helicobacter pylori strain 19-C-EK1 chromosome, complete genome	1709363	1279911	1346800	1709363	transposase,tRNA,integrase,protease	Helicobacter_phage(33.33%)	56	1278392:1278412	1342742:1342762
1278392:1278412	attL	TTTCTAAAAAAGAGCTAGAAA	NA	NA	NA	NA
WP_139544374.1|1279911_1281261_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_139544375.1|1281264_1282998_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_139544376.1|1283008_1283929_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_139544377.1|1283928_1284300_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_139544378.1|1284393_1285461_+	Sel1-like repeat protein HcpE	NA	NA	NA	NA	NA
WP_139544379.1|1286179_1286710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001197146.1|1286709_1287882_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	31.2	3.8e-33
WP_078242255.1|1287905_1288556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000603207.1|1288571_1289369_-	protein disulfide-isomerase DsbK	NA	NA	NA	NA	NA
WP_139544380.1|1289483_1290215_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_139544381.1|1290409_1291861_+	Hop family outer membrane protein HopA	NA	NA	NA	NA	NA
WP_139544382.1|1292098_1293271_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.9e-69
WP_139544653.1|1293514_1295590_+	Hop family outer membrane protein HopM/HopN	NA	NA	NA	NA	NA
WP_139544383.1|1295802_1296636_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_139544384.1|1297011_1298091_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_139544385.1|1298214_1299585_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000415833.1|1299672_1299906_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_139544386.1|1300061_1301042_-	iron-sulfur cluster assembly scaffold protein NifU	NA	A0A1B1IT19	uncultured_Mediterranean_phage	37.0	6.7e-15
WP_033744554.1|1301063_1302227_-	cysteine desulfurase, NifS family	NA	H7BUW1	unidentified_phage	42.3	2.1e-39
WP_139544387.1|1302397_1302859_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_139544388.1|1303004_1303556_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_139544389.1|1303737_1304838_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_139544390.1|1304838_1305639_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_139544391.1|1305651_1307310_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_139544392.1|1307405_1309271_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_139544393.1|1309281_1310433_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_139544394.1|1310889_1311642_+	Sel1-like repeat protein HcpA	NA	NA	NA	NA	NA
WP_139544395.1|1311836_1313702_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	33.8	3.1e-93
WP_139544654.1|1313805_1315158_-	outer membrane beta-barrel protein HofA	NA	NA	NA	NA	NA
WP_139544396.1|1315364_1316564_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_139544397.1|1316577_1317816_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_139544398.1|1317780_1320627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139544655.1|1321765_1323571_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_139544399.1|1324655_1325723_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	25.9	2.1e-06
WP_139544400.1|1326035_1326833_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_120823133.1|1326804_1327056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139544402.1|1327585_1327975_-|protease	CAAX protease	protease	NA	NA	NA	NA
WP_120861553.1|1328172_1328508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001877677.1|1328539_1329169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139544403.1|1329173_1330451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139544404.1|1331704_1333138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139544405.1|1333147_1335151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139544406.1|1335150_1336203_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
WP_139544407.1|1337004_1337673_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	33.5	1.2e-23
WP_000365707.1|1337719_1338097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000063685.1|1338281_1338749_+|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	99.4	7.9e-83
WP_139543879.1|1338717_1339866_+|transposase	transposase	transposase	G9CU70	Helicobacter_phage	99.0	3.9e-216
WP_139544408.1|1339952_1340579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139544409.1|1340652_1341456_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_000965788.1|1341425_1341896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139544410.1|1341950_1344011_-	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.7	1.3e-57
1342742:1342762	attR	TTTCTAGCTCTTTTTTAGAAA	NA	NA	NA	NA
WP_108593827.1|1344150_1344402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139544411.1|1344538_1344763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108593828.1|1344755_1344953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139543879.1|1345215_1346364_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	99.0	3.9e-216
WP_000063685.1|1346332_1346800_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	99.4	7.9e-83
