The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	23864	124720	2659111	transposase,head,holin,portal,terminase,integrase,tail,tRNA,capsid,protease	Enterococcus_phage(21.43%)	108	55020:55037	131916:131933
WP_002286621.1|23864_26663_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|26711_28238_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|28252_28900_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|29081_29411_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|29587_30316_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|30331_31345_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|31344_32622_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|32684_35387_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|35538_35856_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|35885_36206_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|36313_37774_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|37841_38063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|38093_38276_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|38275_38689_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|38811_39993_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010728492.1|40523_41663_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	46.8	2.6e-95
WP_010728491.1|41772_42063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139424769.1|42086_42575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729101.1|42659_43082_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_139424772.1|43099_43420_-	helix-turn-helix domain-containing protein	NA	A0A182BQC8	Lactococcus_phage	49.1	2.1e-18
WP_002318514.1|43712_43904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002317757.1|43916_44237_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_060854001.1|44241_44421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002317844.1|44540_45119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350675.1|45273_45591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002329420.1|45523_46003_+	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	49.0	5.3e-34
WP_010706181.1|46354_47041_+	AAA family ATPase	NA	A0A1P8VVS4	Streptococcus_phage	52.3	3.3e-61
WP_139424775.1|47015_48368_+	DEAD/DEAH box helicase family protein	NA	A0A0P0ID30	Lactobacillus_phage	53.1	6.4e-133
WP_010725530.1|48355_48733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010706184.1|48746_49247_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	52.2	5.0e-35
WP_139424778.1|49260_51573_+	DNA primase	NA	R4IBW2	Listeria_phage	56.0	2.0e-251
WP_002350665.1|51818_52136_+	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	61.5	3.6e-31
WP_002319167.1|52132_52294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139424781.1|52290_52599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139424784.1|52595_53330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113787856.1|53879_54164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139425011.1|54230_54488_+	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	52.1	1.2e-11
WP_128704395.1|54494_54698_+	toxin PIN	NA	NA	NA	NA	NA
WP_139424786.1|54694_54994_+	hypothetical protein	NA	NA	NA	NA	NA
55020:55037	attL	AAATTAGAAAAAGAATTA	NA	NA	NA	NA
WP_139425015.1|55236_55650_+	autolysin	NA	C9E2P5	Enterococcus_phage	80.3	1.6e-55
WP_002318050.1|56340_56523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305386.1|56766_57111_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002340808.1|57115_57397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|57499_57814_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_123838942.1|57791_59486_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	50.6	5.0e-151
WP_002342088.1|59505_60684_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	3.2e-80
WP_061605169.1|60646_61333_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	40.2	6.1e-31
WP_139424789.1|61332_62493_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	2.7e-100
WP_139424792.1|62502_63378_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.6	4.3e-130
WP_073490602.1|63374_63686_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	43.5	8.3e-12
WP_002286522.1|63675_64029_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002342093.1|64018_64420_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	34.1	3.0e-14
WP_073490603.1|64412_64817_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002343573.1|64828_65434_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.2	6.7e-34
WP_002299170.1|65455_65818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|65820_66003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139424795.1|66019_69340_+|tail	phage tail protein	tail	D2J070	Enterococcus_phage	44.4	2.3e-51
WP_002338649.1|69390_70128_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002338650.1|70137_72429_+	phage minor structural protein	NA	A0A1D3SNL1	Enterococcus_phage	29.9	1.7e-90
WP_139424798.1|72452_74576_+	hypothetical protein	NA	A0A0M4RT83	Enterococcus_phage	45.6	1.0e-81
WP_002322123.1|74639_74882_+|holin	holin	holin	D2J075	Enterococcus_phage	68.4	2.1e-23
WP_002302122.1|74897_75095_+|holin	holin	holin	A0A0S2MYF6	Enterococcus_phage	85.9	7.8e-24
WP_139424801.1|75105_76122_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	65.4	2.9e-61
WP_104853563.1|76329_76884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104853564.1|76885_77353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060789855.1|77364_77772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139424804.1|78450_78741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002336354.1|78755_78977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286470.1|79225_79426_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002286469.1|79730_80963_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|81217_81787_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286465.1|81964_82405_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|82562_83327_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|83358_84282_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|84357_85497_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_113787866.1|85489_86290_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|86289_87117_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|87094_87829_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|87928_88795_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|88808_89381_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|89402_90431_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|90528_91380_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002302719.1|91413_93447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322625.1|93490_94771_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002289081.1|94980_95787_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289079.1|95798_97019_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
WP_002289078.1|97008_98595_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002289076.1|98633_100772_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002289074.1|101139_102123_-	serine hydrolase	NA	NA	NA	NA	NA
WP_002289073.1|102500_103892_+	sugar transferase	NA	NA	NA	NA	NA
WP_002289071.1|103907_104948_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_002289069.1|104966_106052_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002289068.1|106084_107047_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_002292877.1|107039_108467_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002302730.1|108468_109539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002292875.1|109525_110947_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_002289359.1|110959_111967_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
WP_002292874.1|111978_112983_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289362.1|112979_114128_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002289363.1|114100_114778_+	acetyltransferase	NA	NA	NA	NA	NA
WP_002326811.1|114767_115910_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
WP_002289366.1|115922_116900_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002289368.1|116899_117808_+	dehydrogenase	NA	NA	NA	NA	NA
WP_002289370.1|117808_118561_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289372.1|118565_119513_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
WP_113787867.1|119686_120982_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.1e-54
WP_002325884.1|121470_122424_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002323245.1|123547_124720_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
131916:131933	attR	AAATTAGAAAAAGAATTA	NA	NA	NA	NA
>prophage 2
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	238110	276699	2659111	transposase	Staphylococcus_phage(50.0%)	40	NA	NA
WP_002323245.1|238110_239283_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_000222572.1|239493_240447_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002297183.1|240671_242534_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002291790.1|242533_242866_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002287107.1|243008_244259_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002288314.1|244668_245025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288312.1|245040_245391_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_002288309.1|245419_246199_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_002296962.1|246209_246887_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_002288305.1|246905_248012_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_002288304.1|248001_249093_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_002288301.1|249105_249846_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_000997695.1|250068_251247_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002288299.1|251479_253420_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002288297.1|253506_255429_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_002288294.1|255708_256131_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	48.9	2.0e-29
WP_002321389.1|256558_257545_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002288290.1|257669_258104_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288289.1|258218_259193_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002321390.1|259302_259494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294357.1|259590_260544_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_002294358.1|260509_261301_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.8	1.8e-18
WP_002294359.1|261524_261983_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|262118_263369_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002288285.1|263778_264078_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002294360.1|264150_265512_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288318.1|265533_265794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288278.1|265807_266560_+	aldolase	NA	NA	NA	NA	NA
WP_002338196.1|266653_267259_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002288275.1|267314_268289_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_002321392.1|268363_268576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077940815.1|268666_269446_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002294365.1|269512_270784_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002323562.1|270936_272334_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002289467.1|272414_272855_+	universal stress protein	NA	NA	NA	NA	NA
WP_002289468.1|273001_273328_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289470.1|273328_274078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289471.1|274157_274613_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002289474.1|275039_275315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323245.1|275526_276699_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
>prophage 3
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	413464	422527	2659111		Gordonia_phage(16.67%)	9	NA	NA
WP_104858002.1|413464_414760_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.5	4.5e-19
WP_002338223.1|414941_415319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|415574_416303_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002338224.1|416302_416557_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|416558_417230_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002338225.1|417230_419453_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.4	1.1e-150
WP_002309482.1|419437_420877_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002321731.1|420908_421952_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002331832.1|421948_422527_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.0e-26
>prophage 4
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	616614	662892	2659111	transposase,integrase	Staphylococcus_phage(25.0%)	45	610642:610658	634671:634687
610642:610658	attL	CATTTTCTTTGTTTTTT	NA	NA	NA	NA
WP_002302025.1|616614_617646_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_002325711.1|617754_619287_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_104858060.1|619425_620238_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_002286069.1|620227_620713_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002302021.1|620735_621281_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_002302020.1|621353_622997_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_104858059.1|623125_625354_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_002286073.1|625386_625866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298432.1|626096_626945_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	37.4	9.8e-15
WP_002302018.1|627101_628712_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002295896.1|628955_629273_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_002295898.1|629265_630045_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002295900.1|630177_631113_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_002302017.1|631188_631581_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_002295904.1|631561_632080_-	membrane protein	NA	NA	NA	NA	NA
WP_104858058.1|632227_633301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302013.1|633293_634211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295907.1|634413_634605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295908.1|634763_636272_+	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
634671:634687	attR	CATTTTCTTTGTTTTTT	NA	NA	NA	NA
WP_002302011.1|636506_637688_+	pyrimidine nucleoside transporter NupC	NA	NA	NA	NA	NA
WP_002302009.1|637776_638325_+	AAA family ATPase	NA	S4W1R9	Pandoravirus	29.4	9.5e-11
WP_002302007.1|638580_639093_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002302005.1|639136_640093_-	sce7725 family protein	NA	NA	NA	NA	NA
WP_002325714.1|640098_640788_-	hypothetical protein	NA	U5PU21	Bacillus_phage	33.2	1.8e-19
WP_002321153.1|640913_641573_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002298445.1|641572_642409_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002327903.1|642429_643881_-	amidase	NA	NA	NA	NA	NA
WP_002295918.1|644015_644960_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	44.4	5.2e-65
WP_002346575.1|645043_645691_-	lipoprotein	NA	NA	NA	NA	NA
WP_002323589.1|645922_647071_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002287522.1|647087_647492_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_104775442.1|647715_648888_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.4	8.3e-121
WP_002298451.1|649143_650310_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	39.3	1.6e-47
WP_002298453.1|650460_651276_-	maltodextrose utilization protein MalA	NA	NA	NA	NA	NA
WP_002288156.1|651288_652140_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002318365.1|652142_653444_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002301997.1|653590_654850_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002324073.1|654951_656718_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_113843842.1|657045_657999_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002303243.1|658173_659022_+	YitT family protein	NA	NA	NA	NA	NA
WP_002301993.1|659121_659556_+	VOC family protein	NA	NA	NA	NA	NA
WP_002288163.1|659735_660146_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_002324072.1|660202_660643_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050558076.1|660751_661831_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002325884.1|661938_662892_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	676623	723364	2659111	transposase	Bacillus_phage(20.0%)	46	NA	NA
WP_000997695.1|676623_677802_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_096705491.1|678002_678545_+	ATP-binding protein	NA	A0A1G4GQ67	Klebsiella_phage	29.8	2.4e-06
WP_096705492.1|678696_680031_-	CoA-disulfide reductase	NA	NA	NA	NA	NA
WP_100970418.1|680519_681660_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	2.2e-78
WP_139425018.1|681802_682870_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_002324522.1|682947_683856_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_104770788.1|684099_686400_-	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_104770787.1|686383_687712_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_096705478.1|687736_688009_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_139424843.1|688144_688435_-	C26 family cysteine hydrolase domain-containing family	NA	NA	NA	NA	NA
WP_100970418.1|688514_689655_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	2.2e-78
WP_139424846.1|689797_690283_-	C26 family cysteine hydrolase domain-containing family	NA	NA	NA	NA	NA
WP_002322585.1|690427_691600_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	89.2	3.4e-122
WP_000997695.1|691842_693021_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002324056.1|693318_695082_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_082254248.1|695302_696235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293280.1|696501_697461_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|697620_698799_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_139424850.1|698823_699177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324054.1|699384_700311_-	glutaminase A	NA	NA	NA	NA	NA
WP_002333570.1|700333_701761_-	amino acid permease	NA	NA	NA	NA	NA
WP_002296683.1|701791_703006_-	ammonium transporter	NA	NA	NA	NA	NA
WP_002323245.1|703239_704412_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_139424853.1|704405_704651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290686.1|704678_704921_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002295944.1|704952_705510_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002290682.1|705522_705711_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002297459.1|705723_706290_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_000997695.1|706759_707938_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_123828039.1|708150_708339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002324051.1|708867_709341_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_002295139.1|709349_709577_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002291278.1|710851_711094_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002324049.1|711125_712028_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|712040_712229_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|712242_712806_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002324048.1|712843_713737_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.4	2.8e-60
WP_096705279.1|713814_714753_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002298673.1|714786_715137_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002324047.1|715168_716071_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002324046.1|716063_716921_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	26.5	1.7e-19
WP_002298676.1|717254_718064_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000202380.1|718512_719832_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_025478769.1|720627_721323_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.0	5.2e-22
WP_002319298.1|721306_721705_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|722113_723364_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 6
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	887510	977508	2659111	transposase,head,plate,holin,portal,terminase,integrase,tail,tRNA,capsid,protease	Enterococcus_phage(50.0%)	109	933939:933954	979474:979489
WP_104832521.1|887510_889220_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|889287_890556_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|890716_891517_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|891513_892326_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002334076.1|892528_893701_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	99.6	2.2e-134
WP_002293875.1|893852_894410_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|894412_895135_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|895270_896152_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|896250_897033_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|897391_897871_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326249.1|898087_899179_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002338382.1|899171_899957_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_010726235.1|900545_902237_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	5.8e-75
WP_002288434.1|902658_903606_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|903720_904740_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|904830_906060_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|906520_907222_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002306427.1|907793_908810_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.4	3.2e-60
WP_002306425.1|908806_909271_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002324992.1|909277_909820_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_079996781.1|909803_910628_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002293893.1|910716_911697_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_113787800.1|911720_913205_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002293897.1|913216_914206_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	1.6e-48
WP_002288457.1|914454_914622_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_104889205.1|914683_916495_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|916491_916857_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002293900.1|917019_917415_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002293901.1|917432_918395_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|918394_918607_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|918627_919326_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|919345_919888_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002293903.1|920019_921024_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|921020_922010_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_139424863.1|922006_922813_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	32.5	5.1e-13
WP_002333069.1|922978_923935_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002324997.1|924011_924530_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	9.2e-24
WP_002296119.1|924617_924767_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_104858105.1|924996_925443_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002293915.1|925636_927532_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002338392.1|927856_928831_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	1.5e-22
WP_024636555.1|929484_929787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347086.1|930547_930946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305550.1|930938_931391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002318238.1|931377_931884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139424867.1|932169_933189_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	67.2	8.4e-61
WP_002319084.1|933199_933397_-|holin	holin	holin	A0A0S2MYF6	Enterococcus_phage	87.5	5.9e-24
WP_002312831.1|933410_933653_-|holin	holin	holin	D2J075	Enterococcus_phage	62.0	2.0e-21
WP_002331002.1|933687_933825_-	XkdX family protein	NA	NA	NA	NA	NA
WP_139424870.1|933826_934273_-	hypothetical protein	NA	NA	NA	NA	NA
933939:933954	attL	GCTTTTTCTTTCAATG	NA	NA	NA	NA
WP_139424873.1|934435_936481_-|plate	BppU family phage baseplate upper protein	plate	A0A0M4RT83	Enterococcus_phage	60.9	1.4e-110
WP_002290629.1|936498_937323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290632.1|937326_938376_-	hypothetical protein	NA	Q5K5I4	Oenococcus_phage	27.9	9.3e-31
WP_002350711.1|938372_939245_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_139424876.1|939245_943079_-	tape measure protein	NA	A0A0M5M3L4	Enterococcus_phage	74.3	0.0e+00
WP_002290636.1|943078_943270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002329391.1|943293_943605_-	hypothetical protein	NA	A0A0S2MY76	Enterococcus_phage	44.8	4.0e-14
WP_139424879.1|943623_943974_-	hypothetical protein	NA	A0A0M4RCH3	Enterococcus_phage	38.9	1.7e-13
WP_139424882.1|944081_944642_-|tail	phage tail protein	tail	V5UQL2	Enterococcus_phage	46.2	7.6e-40
WP_002329393.1|944657_945029_-	hypothetical protein	NA	A0A060ANH4	Enterococcus_phage	46.2	2.5e-23
WP_002290643.1|945025_945421_-	hypothetical protein	NA	A0A0M5M1E5	Enterococcus_phage	41.7	5.8e-18
WP_002333638.1|945417_945753_-|head	phage head closure protein	head	C0LZZ3	Enterococcus_phage	42.3	4.1e-17
WP_002333639.1|945730_946015_-|head,tail	phage gp6-like head-tail connector protein	head,tail	V5US31	Enterococcus_phage	48.9	1.0e-16
WP_080114386.1|946026_946284_-	Ig domain-containing protein	NA	A0A1P8BL30	Lactococcus_phage	65.0	3.3e-14
WP_139424886.1|946280_947462_-|capsid	phage major capsid protein	capsid	A0A0S2SXJ6	Bacillus_phage	55.6	7.6e-82
WP_073463482.1|947501_948047_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0M4R4P2	Enterococcus_phage	59.2	1.1e-54
WP_139424889.1|947994_949179_-|portal	phage portal protein	portal	V5US36	Enterococcus_phage	42.8	9.7e-77
WP_010725039.1|949352_951077_-|terminase	terminase large subunit	terminase	D7PQ39	Enterococcus_phage	53.0	3.5e-168
WP_002343508.1|951069_951549_-|terminase	phage terminase small subunit P27 family	terminase	V5UQR4	Enterococcus_phage	55.0	1.5e-41
WP_002347933.1|951714_952089_-	HNH endonuclease	NA	A0A249XUN4	Enterococcus_phage	58.4	4.9e-35
WP_002333645.1|952081_952282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139424893.1|952278_952509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060809366.1|952549_952810_-	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	50.0	1.0e-15
WP_060809367.1|952799_952988_-	hypothetical protein	NA	F0PII8	Enterococcus_phage	83.3	2.2e-20
WP_139424897.1|953547_953934_-	hypothetical protein	NA	U6E9D1	Streptococcus_phage	54.7	1.6e-28
WP_010726209.1|953946_954360_-	ArpU family phage transcriptional regulator	NA	C9E2P5	Enterococcus_phage	79.6	3.6e-55
WP_139424900.1|954603_954903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322969.1|954899_955103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002343501.1|955109_955340_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	53.5	5.5e-13
WP_104853429.1|955365_955647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139424903.1|955646_955967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139424906.1|955963_956518_-	DUF1642 domain-containing protein	NA	C9E2N9	Enterococcus_phage	47.2	9.2e-30
WP_104870228.1|956514_957252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139424909.1|957248_957551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061100026.1|957712_957982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139424912.1|957993_958845_-	replication protein	NA	A0A1S5SFJ6	Streptococcus_phage	66.4	2.7e-49
WP_139424916.1|958851_959538_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.5	8.3e-89
WP_002317841.1|959543_960290_-	DUF1071 domain-containing protein	NA	A0A1X9IGE5	Lactococcus_phage	47.0	1.4e-41
WP_139424919.1|960258_960624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010725023.1|960801_961500_-	rha family phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	2.1e-26
WP_025479656.1|961553_962219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323902.1|962535_962796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002306337.1|962935_963139_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010722961.1|963153_963933_-	bro family toxin-antitoxin system toxin component	NA	A0A1Q1PVU2	Staphylococcus_phage	53.9	6.8e-71
WP_010722960.1|963956_964181_-	DUF739 family protein	NA	A0A141E1D4	Streptococcus_phage	70.4	7.0e-21
WP_139424922.1|964340_965042_+	helix-turn-helix domain-containing protein	NA	U5U470	Staphylococcus_phage	45.3	1.3e-49
WP_010722958.1|965127_965757_+	hypothetical protein	NA	A0A059T7Z1	Listeria_phage	40.9	4.3e-31
WP_002332474.1|965936_966593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010706176.1|966746_967895_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	38.9	1.6e-68
WP_002302607.1|968233_968800_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002293923.1|970352_970706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002306407.1|970797_971217_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002293927.1|971217_971562_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002287776.1|971911_972508_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002293929.1|972631_974431_+	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002293930.1|974708_974921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002328397.1|975786_976740_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002288573.1|976865_977252_+	YxeA family protein	NA	NA	NA	NA	NA
WP_002293932.1|977295_977508_+|integrase	integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	62.5	3.5e-06
979474:979489	attR	GCTTTTTCTTTCAATG	NA	NA	NA	NA
>prophage 7
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	980536	990352	2659111	tRNA	Streptococcus_phage(50.0%)	10	NA	NA
WP_002293934.1|980536_981790_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	4.5e-24
WP_002288577.1|981860_982346_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002293935.1|982368_983127_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.9	8.5e-26
WP_002302597.1|983142_984321_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	49.5	1.0e-102
WP_104858107.1|984550_986671_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.3	8.2e-220
WP_100066493.1|986606_986882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297641.1|986893_987619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302595.1|987608_988118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302594.1|988187_989636_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002293942.1|989635_990352_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
>prophage 8
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	1031199	1037217	2659111		Streptococcus_phage(100.0%)	9	NA	NA
WP_029487153.1|1031199_1031703_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	65.1	2.5e-58
WP_010708778.1|1031714_1031936_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	89.0	2.6e-28
WP_080111713.1|1031940_1032078_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_029487154.1|1032074_1033259_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	62.0	5.9e-143
WP_029487155.1|1033594_1034737_-	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	67.3	3.4e-127
WP_029487156.1|1034733_1036092_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	63.6	2.0e-158
WP_029487157.1|1036161_1036515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029487158.1|1036515_1036890_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	67.0	1.1e-34
WP_010727672.1|1036902_1037217_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
>prophage 9
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	1334742	1395043	2659111	transposase,tRNA	Streptococcus_phage(21.43%)	56	NA	NA
WP_002301399.1|1334742_1335702_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002323720.1|1335778_1337761_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002287094.1|1337774_1338671_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_002291589.1|1338673_1339735_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_002296174.1|1339945_1340473_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_002291593.1|1340539_1342042_-	Lsa family ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	26.1	8.1e-28
WP_002291594.1|1342299_1343421_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	31.3	5.8e-23
WP_002323721.1|1343546_1344488_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002323722.1|1344637_1345534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002337859.1|1345802_1347143_+	amino acid permease	NA	NA	NA	NA	NA
WP_002299975.1|1347360_1347804_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_071974495.1|1347871_1348015_-	hydrolase	NA	NA	NA	NA	NA
WP_080032539.1|1348100_1348304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293307.1|1348308_1349727_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_002293788.1|1350129_1351353_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_002296185.1|1351383_1352223_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293786.1|1352239_1352920_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002293784.1|1352921_1353995_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.5	5.8e-28
WP_002293782.1|1354065_1354665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293780.1|1354641_1355313_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002304253.1|1355399_1358078_-	magnesium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	25.6	1.1e-48
WP_002293327.1|1358736_1359174_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	46.2	4.1e-25
WP_002293329.1|1359195_1360062_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002293776.1|1360221_1362315_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	47.1	4.5e-162
WP_048950403.1|1362493_1362748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293828.1|1363063_1363687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293829.1|1363845_1365243_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002293830.1|1365274_1366246_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_104853385.1|1366619_1367045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304249.1|1367106_1367304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293834.1|1367532_1368234_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	48.6	7.8e-50
WP_002293607.1|1368249_1368690_-	nucleoside deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	50.7	8.9e-36
WP_002293608.1|1368689_1369265_-	TIGR00730 family Rossman fold protein	NA	A0A1D3SNB7	Enterococcus_phage	44.9	1.5e-35
WP_002296192.1|1369505_1369715_+|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
WP_002293836.1|1369772_1369931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293839.1|1370750_1371452_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002293840.1|1371559_1372969_-	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	28.0	6.6e-32
WP_002318720.1|1373016_1374882_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_080004817.1|1374839_1375028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104853387.1|1375002_1375854_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002327693.1|1376163_1376877_-	class A sortase	NA	NA	NA	NA	NA
WP_002293844.1|1376944_1377271_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_113787808.1|1377341_1378295_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_104853556.1|1379008_1380262_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002297271.1|1380879_1381839_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_104853562.1|1382216_1382975_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_104853561.1|1382971_1384000_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_139424935.1|1384019_1387190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297271.1|1387426_1388386_-|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_113787809.1|1388459_1389365_-	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_104853482.1|1389459_1389807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139424938.1|1389868_1391041_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	99.6	2.2e-134
WP_104853440.1|1391449_1392361_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_104858648.1|1392737_1393376_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.8	7.6e-12
WP_104853442.1|1393379_1393958_-	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
WP_002301399.1|1394083_1395043_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
>prophage 10
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	1426046	1489627	2659111	transposase,integrase,tRNA	Streptococcus_phage(17.65%)	58	1423096:1423110	1436742:1436756
1423096:1423110	attL	TCTGTTAAACCAGTA	NA	NA	NA	NA
WP_002287107.1|1426046_1427297_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_003744430.1|1427440_1427752_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_002415733.1|1428503_1428908_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002372173.1|1428973_1429174_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003744413.1|1429795_1430002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002367047.1|1430081_1431272_+|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	29.6	3.9e-33
WP_002287686.1|1431369_1432761_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_002323751.1|1432765_1433236_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_010718306.1|1433222_1434458_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	48.0	1.0e-113
WP_002287681.1|1434454_1435741_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002287679.1|1435753_1436527_-	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	2.1e-08
WP_002287678.1|1436723_1437572_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1436742:1436756	attR	TACTGGTTTAACAGA	NA	NA	NA	NA
WP_002287674.1|1437595_1438282_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_104853543.1|1438274_1439309_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	4.2e-28
WP_002291179.1|1439703_1440042_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_002325873.1|1440043_1440400_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	42.3	2.7e-22
WP_002291183.1|1440405_1441593_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_002353096.1|1441577_1441775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002291186.1|1441783_1442629_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002291188.1|1442862_1443828_+	TDT family transporter	NA	NA	NA	NA	NA
WP_079995577.1|1444023_1444227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298276.1|1444327_1445371_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_002298278.1|1445432_1445897_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	38.7	1.5e-17
WP_002289773.1|1446142_1447090_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	51.0	5.0e-84
WP_002306019.1|1447300_1449373_-	DNA topoisomerase III	NA	NA	NA	NA	NA
WP_002291196.1|1449305_1449683_-	DUF1033 family protein	NA	NA	NA	NA	NA
WP_002323745.1|1449811_1450372_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002325116.1|1450521_1451814_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002298286.1|1451873_1452992_-	aminotransferase	NA	NA	NA	NA	NA
WP_002286721.1|1453005_1454427_-	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_010718311.1|1454673_1455795_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002291205.1|1456198_1456798_+	metallophosphatase	NA	A0A288TXW7	Enterococcus_phage	40.0	5.6e-33
WP_096705366.1|1456935_1458222_-	multidrug efflux MFS transporter EfmA	NA	A0A1B0RXG2	Streptococcus_phage	36.4	1.2e-67
WP_002286736.1|1458492_1458837_-	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_002336026.1|1458973_1460110_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002286741.1|1460298_1461273_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.2	2.0e-40
WP_096705365.1|1461352_1462228_-	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
WP_002342000.1|1462357_1464265_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.2	4.7e-81
WP_077150388.1|1464442_1464631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096705364.1|1464862_1468129_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_139424946.1|1468325_1469285_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.5	1.4e-09
WP_002291217.1|1469465_1470011_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	37.4	2.6e-24
WP_002291218.1|1470022_1470715_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_002286760.1|1470733_1471018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325125.1|1471030_1471594_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002286764.1|1471821_1472484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286766.1|1472607_1473804_+	toxic anion resistance protein	NA	A0A2K9VCT6	Lactobacillus_phage	29.1	3.9e-33
WP_002286768.1|1473904_1475281_-	amino acid permease	NA	NA	NA	NA	NA
WP_002286769.1|1475317_1476184_-	glucose transporter GlcU	NA	NA	NA	NA	NA
WP_002286770.1|1476272_1477298_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002291233.1|1477315_1477990_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002326335.1|1478173_1479067_-	class C sortase	NA	NA	NA	NA	NA
WP_002326336.1|1479140_1480838_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_002301399.1|1480874_1481834_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_113787810.1|1481904_1483209_-	peptidase	NA	NA	NA	NA	NA
WP_104879498.1|1483208_1485713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104776418.1|1486043_1487157_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	52.0	3.3e-79
WP_002300314.1|1488457_1489627_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	1656324	1725127	2659111	transposase,tRNA	Staphylococcus_phage(20.0%)	58	NA	NA
WP_002295743.1|1656324_1657233_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_025477870.1|1658411_1658657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104770914.1|1658669_1659434_-	TIM44-like domain-containing protein	NA	NA	NA	NA	NA
WP_002322585.1|1659494_1660667_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	89.2	3.4e-122
WP_002319518.1|1660876_1661746_-	triphosphoribosyl-dephospho-CoA synthase MdcB	NA	NA	NA	NA	NA
WP_104770915.1|1662881_1663472_-	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_002328723.1|1663475_1665152_-	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_002287548.1|1665141_1665441_-	malonate decarboxylase subunit delta	NA	NA	NA	NA	NA
WP_104770916.1|1665542_1667108_-	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_002319511.1|1667114_1668026_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002287552.1|1669188_1669551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294711.1|1669739_1669922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038811235.1|1674007_1675339_-	amino acid permease	NA	NA	NA	NA	NA
WP_002319503.1|1675304_1676783_-	amino acid permease	NA	NA	NA	NA	NA
WP_104770917.1|1677087_1678923_-	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_002307868.1|1680910_1681276_-	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_002287567.1|1681272_1681638_-	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_002287569.1|1682075_1682204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002319499.1|1682260_1683955_+	oleate hydratase	NA	NA	NA	NA	NA
WP_033795539.1|1684144_1684351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002319497.1|1684728_1685862_+	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	24.5	5.5e-13
WP_002319496.1|1685892_1686183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287577.1|1686833_1688087_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002287579.1|1688115_1688433_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287582.1|1688458_1688779_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002319493.1|1689243_1690659_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002303791.1|1690691_1691651_-|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_113787928.1|1691724_1693059_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_104770919.1|1693208_1693907_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104770920.1|1695264_1696098_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002300898.1|1696331_1697075_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002294730.1|1697265_1697901_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002294732.1|1698047_1699289_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002300902.1|1699609_1700272_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002312676.1|1700537_1701080_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_002300905.1|1701084_1701312_-	copper chaperone	NA	NA	NA	NA	NA
WP_002300907.1|1701390_1703271_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.9	1.9e-98
WP_002316025.1|1703556_1703892_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_072538373.1|1704087_1705683_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_113787899.1|1706990_1708153_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.9	4.6e-79
WP_139424973.1|1708283_1709213_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002336120.1|1709287_1709584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104776419.1|1709576_1709870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312616.1|1710015_1710567_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002312614.1|1710740_1711040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323668.1|1711066_1711375_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002312610.1|1711491_1712451_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002312609.1|1712594_1713371_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002298781.1|1713468_1714116_-	HAD family phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.4	4.5e-12
WP_002312607.1|1714115_1714946_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002298779.1|1714945_1715695_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298777.1|1715708_1716173_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002312606.1|1716222_1716684_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298774.1|1716665_1717640_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002317114.1|1719756_1720929_-	MFS transporter	NA	NA	NA	NA	NA
WP_002322792.1|1720931_1723181_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002317112.1|1723277_1724132_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010778368.1|1724218_1725127_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	1929597	1991310	2659111	transposase,integrase,protease,tRNA	Bacillus_virus(11.76%)	50	1926694:1926708	1944064:1944078
1926694:1926708	attL	CTGTTTCACGTGAAA	NA	NA	NA	NA
WP_113787892.1|1929597_1930815_-|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	34.1	2.8e-39
WP_038811063.1|1930807_1931017_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_000997695.1|1931471_1932650_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_080129289.1|1933492_1933711_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_002301399.1|1933919_1934879_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002333846.1|1934906_1935860_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_113787891.1|1935942_1937190_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_038811542.1|1937678_1938182_+	VanZ family protein	NA	NA	NA	NA	NA
WP_002294340.1|1939963_1940161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294342.1|1940262_1941081_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_002301048.1|1941245_1942976_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_099130712.1|1943242_1943461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002309892.1|1943405_1943927_-	membrane protein	NA	NA	NA	NA	NA
WP_113787890.1|1944175_1945798_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.3	8.9e-49
1944064:1944078	attR	CTGTTTCACGTGAAA	NA	NA	NA	NA
WP_002288377.1|1945926_1946790_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	29.9	8.8e-11
WP_002288375.1|1947576_1948869_-	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	36.0	8.1e-69
WP_002288373.1|1949648_1951016_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.8	3.0e-130
WP_002288372.1|1951289_1951742_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_002288371.1|1951747_1953721_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_002288370.1|1953863_1954100_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002288368.1|1954125_1954638_-	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	60.0	1.3e-46
WP_002288366.1|1954687_1954987_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_113787889.1|1955222_1957694_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.5	2.2e-99
WP_002288364.1|1957713_1959660_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	43.6	2.7e-140
WP_002288363.1|1959656_1960781_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_002295251.1|1960767_1961010_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_002288361.1|1961238_1962369_-	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	25.3	1.9e-29
WP_002288360.1|1962566_1963901_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_089030564.1|1963994_1964261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293121.1|1964423_1964558_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_002295255.1|1964675_1965032_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_002295256.1|1965028_1965847_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002295258.1|1965864_1966623_+	protein jag	NA	NA	NA	NA	NA
WP_002295260.1|1966790_1967129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113787888.1|1967473_1968871_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_113787887.1|1968887_1970789_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_002288804.1|1971020_1971734_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_002288805.1|1971745_1972513_+	ParA family protein	NA	Q8JL10	Natrialba_phage	33.6	2.8e-29
WP_002299776.1|1972499_1973390_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	33.5	1.1e-16
WP_002293106.1|1973410_1973602_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_002325956.1|1973610_1974711_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002299780.1|1974800_1975496_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_002295264.1|1975999_1977484_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.8	5.6e-98
WP_080032555.1|1977966_1978161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002307286.1|1978153_1979425_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.4	1.5e-88
WP_002326377.1|1979718_1980927_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.7	2.0e-24
WP_002295268.1|1980913_1981603_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	1.8e-38
WP_002322034.1|1983981_1984179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289036.1|1988343_1988811_+	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002299386.1|1988817_1991310_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	38.3	9.0e-125
>prophage 13
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	2037467	2096328	2659111	transposase,integrase,tRNA	Staphylococcus_phage(29.41%)	58	2032973:2033006	2091524:2091557
2032973:2033006	attL	TTTTGAGCTAATACCGAGGGTCAGCTGATTGAAC	NA	NA	NA	NA
WP_113787920.1|2037467_2038634_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	33.8	1.3e-44
WP_075491742.1|2038688_2039339_-	helix-turn-helix transcriptional regulator	NA	Q20DG0	Lactobacillus_phage	33.3	3.2e-05
WP_002323245.1|2039553_2040726_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_002301399.1|2041282_2042242_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002323245.1|2042718_2043891_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_033779060.1|2044880_2045090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113787924.1|2047632_2047947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033779052.1|2047996_2048770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033779050.1|2048874_2049120_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033779049.1|2049423_2050002_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_033779093.1|2050023_2053080_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_081117312.1|2053173_2054079_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	51.7	5.1e-78
WP_033779044.1|2054075_2055299_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	25.6	7.8e-21
WP_033779042.1|2055314_2056931_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	48.4	4.8e-119
WP_075491458.1|2056986_2057832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033779040.1|2057828_2058680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033779038.1|2058669_2059191_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_002295987.1|2059958_2060174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287502.1|2060176_2061094_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.8	4.6e-42
WP_002287500.1|2061086_2061869_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002319654.1|2061869_2062550_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.4e-25
WP_002328795.1|2062542_2063439_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002328243.1|2063633_2065283_+	DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	27.8	1.4e-17
WP_002303702.1|2065339_2065543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287494.1|2065598_2066534_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.1	6.1e-26
WP_002287492.1|2066526_2067297_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_074400058.1|2067293_2067473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317460.1|2067709_2068693_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_071974450.1|2068846_2069032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287486.1|2069139_2070177_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000122610.1|2070300_2071593_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002287484.1|2071772_2072096_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_104889228.1|2072082_2072790_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002301008.1|2072875_2073217_+	xylulose kinase	NA	NA	NA	NA	NA
WP_002287480.1|2073387_2074236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350612.1|2074647_2074854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139424979.1|2074833_2075697_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025481765.1|2075796_2076279_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287477.1|2076541_2077009_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287475.1|2077131_2077983_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002287473.1|2078233_2080192_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002287471.1|2080188_2081061_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002287470.1|2081402_2082275_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104889229.1|2082402_2082972_+	acetyltransferase	NA	NA	NA	NA	NA
WP_002287466.1|2083038_2083776_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002287463.1|2084006_2085275_+	glycoside hydrolase family 73 protein	NA	A0A0K2CP65	Brevibacillus_phage	37.6	1.6e-16
WP_002302683.1|2085761_2086226_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287459.1|2086209_2086839_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_002391534.1|2086982_2087174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287457.1|2088717_2089164_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_002321784.1|2089148_2089331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287456.1|2089362_2089878_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296013.1|2089994_2091197_+	MFS transporter	NA	NA	NA	NA	NA
WP_002287453.1|2091811_2092138_+	hypothetical protein	NA	NA	NA	NA	NA
2091524:2091557	attR	TTTTGAGCTAATACCGAGGGTCAGCTGATTGAAC	NA	NA	NA	NA
WP_002287507.1|2092254_2092599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298218.1|2092674_2093922_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	57.7	9.4e-115
WP_002287451.1|2093918_2094725_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	3.0e-45
WP_002287107.1|2095077_2096328_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 14
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	2322187	2381632	2659111	transposase,protease,bacteriocin,tRNA	Bacillus_phage(17.65%)	59	NA	NA
WP_002325884.1|2322187_2323141_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002299366.1|2323247_2323889_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002294559.1|2323997_2324864_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002304784.1|2325081_2325588_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_002294557.1|2325636_2326296_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_002301298.1|2326315_2328904_+	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	29.2	8.6e-62
WP_002289596.1|2329006_2329234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289597.1|2329343_2329973_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_139424985.1|2329969_2331049_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002338642.1|2331165_2332098_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	32.7	2.9e-20
WP_002301301.1|2332111_2333257_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_113787873.1|2334514_2335480_-	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_002294548.1|2336077_2336581_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	34.3	3.4e-07
WP_002294577.1|2336636_2337281_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002294578.1|2337442_2337595_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002294579.1|2337618_2337789_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_139424989.1|2337889_2338435_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_002294581.1|2338511_2339399_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002301343.1|2339490_2340591_+	L-lactate oxidase	NA	NA	NA	NA	NA
WP_002294584.1|2340681_2341554_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_002294585.1|2341566_2342235_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_002291638.1|2342577_2343000_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002294587.1|2343103_2343793_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002291634.1|2344202_2344706_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002294588.1|2344758_2345127_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002301342.1|2345232_2345922_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_002301341.1|2346003_2347206_+	MFS transporter	NA	NA	NA	NA	NA
WP_002300319.1|2347396_2348929_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.5e-45
WP_002287787.1|2349162_2349864_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002287788.1|2350118_2350832_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.7	6.5e-20
WP_002298514.1|2351141_2352281_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002287792.1|2352369_2353335_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.4	3.4e-128
WP_002287793.1|2353384_2355544_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.2	3.8e-265
WP_002287795.1|2355702_2355927_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.7	1.7e-11
WP_002287797.1|2356327_2356801_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002287799.1|2356797_2358930_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_002290587.1|2358931_2359066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304795.1|2359020_2359212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287801.1|2359159_2359804_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287805.1|2359991_2361185_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-29
WP_002287807.1|2361177_2362905_+	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_002323245.1|2363322_2364495_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_113787874.1|2364620_2364767_+|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_002295743.1|2365188_2366097_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002293041.1|2366386_2366584_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	78.5	3.9e-23
WP_002295273.1|2367448_2367706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295271.1|2367868_2368843_+	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002299784.1|2369381_2369684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322652.1|2370437_2371007_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002294132.1|2370993_2371854_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	4.6e-12
WP_002288850.1|2372043_2372748_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002294131.1|2372752_2374588_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	5.2e-37
WP_002318504.1|2374584_2375901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288853.1|2375901_2376771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288854.1|2376825_2377635_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002301399.1|2377663_2378623_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002288856.1|2378802_2379432_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002338654.1|2379601_2380894_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_113787875.1|2380969_2381632_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 15
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	2450594	2510536	2659111	transposase,protease,tRNA	Planktothrix_phage(23.08%)	52	NA	NA
WP_002326001.1|2450594_2451233_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002323245.1|2451444_2452617_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_139424999.1|2452678_2456572_+	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_002289239.1|2456843_2457329_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002289240.1|2457808_2458450_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002299692.1|2458468_2459104_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	1.1e-26
WP_002318672.1|2459121_2459937_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002338676.1|2460622_2462059_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.2	3.9e-48
WP_002338677.1|2462247_2464695_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	50.7	8.1e-86
WP_002293986.1|2464924_2465992_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002307236.1|2465981_2466188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002338678.1|2466184_2467288_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000997695.1|2467724_2468903_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002293989.1|2469187_2469736_+	aminoglycoside N-acetyltransferase AAC(6')-Ii	NA	NA	NA	NA	NA
WP_080129772.1|2469998_2470220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002338679.1|2470282_2471947_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293992.1|2472016_2472364_-	DUF3899 domain-containing protein	NA	NA	NA	NA	NA
WP_002293573.1|2472447_2473389_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002338680.1|2473389_2474433_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289332.1|2474438_2475509_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.5e-20
WP_002289330.1|2475498_2476452_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.2	3.0e-20
WP_002319647.1|2476463_2477474_+	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	40.8	2.8e-56
WP_072538526.1|2477577_2477766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293995.1|2477758_2478580_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	32.8	2.7e-25
WP_002289337.1|2478676_2478955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289325.1|2479222_2481232_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.3	1.4e-96
WP_113787882.1|2481644_2482823_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002325419.1|2483061_2483649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002319648.1|2483823_2485146_+	amino acid permease	NA	NA	NA	NA	NA
WP_002324188.1|2485300_2486077_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_002305490.1|2486069_2486639_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_002294004.1|2486631_2487516_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_139425002.1|2487966_2488596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002338684.1|2488718_2489828_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	33.0	4.6e-20
WP_002291069.1|2490036_2490459_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002289509.1|2490781_2491318_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002289511.1|2491357_2493121_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	1.5e-44
WP_002294013.1|2493123_2494839_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	1.7e-50
WP_113787883.1|2495082_2496036_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294014.1|2496684_2496909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302892.1|2497108_2499877_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002294017.1|2499957_2500377_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287114.1|2500388_2500859_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287115.1|2500875_2501655_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002287116.1|2501641_2502463_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002324182.1|2502479_2503529_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002287119.1|2503541_2504546_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002287121.1|2505178_2506198_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002287122.1|2506240_2507122_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.3	1.3e-73
WP_002298948.1|2507421_2507799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287124.1|2508404_2509019_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002325884.1|2509582_2510536_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP040849	Enterococcus faecium strain F17E0263 chromosome, complete genome	2659111	2611857	2620453	2659111		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|2611857_2612502_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|2612516_2612846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300512.1|2612859_2613798_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.1	5.5e-35
WP_002298875.1|2613833_2614658_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|2614650_2614998_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002298874.1|2615066_2615939_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	4.0e-88
WP_002294035.1|2616047_2617169_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|2617222_2617825_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|2618263_2620453_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 1
NZ_CP040850	Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence	207651	0	133942	207651	transposase,holin	Streptococcus_phage(32.0%)	118	NA	NA
WP_000933358.1|751_1501_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_104765563.1|1500_2331_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_002326549.1|2756_3179_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_139425036.1|3748_3928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|4048_4453_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323589.1|4469_5618_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_096541010.1|6549_7706_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.8e-75
WP_002326544.1|7792_9019_+	hypothetical protein	NA	E5DV73	Deep-sea_thermophilic_phage	27.8	2.9e-15
WP_002326543.1|8876_9170_-	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	40.3	4.1e-05
WP_002326542.1|9159_9738_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	32.4	3.1e-12
WP_083578800.1|9727_11323_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	50.9	1.5e-125
WP_002405179.1|12507_13110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010731429.1|13140_14916_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_137278094.1|15034_15154_-	SAM-dependent chlorinase/fluorinase	NA	NA	NA	NA	NA
WP_003762723.1|17110_17332_-	putative cytoplasmic protein	NA	A0A172JI00	Bacillus_phage	42.6	2.6e-12
WP_139425039.1|19586_19991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096573250.1|20053_20896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331328.1|20911_21133_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080108108.1|21275_21581_-	site-specific recombinase	NA	A0A2K5B2B4	Erysipelothrix_phage	49.5	3.0e-14
WP_002331330.1|22392_22548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295679.1|22577_23306_-	peptidase	NA	A0A1B0T6A2	Bacillus_phage	26.1	3.1e-09
WP_002292681.1|23565_24114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292680.1|24114_24972_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002311051.1|25257_25545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292678.1|25534_25864_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_032491579.1|26107_26794_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	1.7e-126
WP_104885187.1|27012_29145_-	copper-translocating P-type ATPase TcrB	NA	E4ZFI9	Streptococcus_phage	29.4	2.3e-60
WP_002335389.1|29283_29490_-	copper chaperone TcrZ	NA	NA	NA	NA	NA
WP_000122610.1|30581_31874_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002328406.1|32141_32729_-	YdhK family protein	NA	NA	NA	NA	NA
WP_002307659.1|32758_32965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002307657.1|32979_34374_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.8	7.2e-39
WP_002294790.1|34373_35054_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.4	2.8e-36
WP_033604471.1|35081_36665_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_002328408.1|36669_36894_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_100970418.1|37054_38195_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	2.2e-78
WP_047389834.1|38454_39072_-	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_000195429.1|39438_40611_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_001028144.1|40740_42180_-	aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A1X9I6C2	Streptococcus_phage	100.0	3.8e-285
WP_000393259.1|42180_42573_-	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	100.0	6.9e-72
WP_000195429.1|42629_43802_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002328476.1|44296_45250_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	2.8e-34
WP_002324484.1|45402_47307_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.3	1.7e-99
WP_002301447.1|47504_47738_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_002300937.1|47884_48739_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002300938.1|48723_49062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002336879.1|49289_49994_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002292150.1|50138_50711_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	42.6	3.9e-23
WP_000997695.1|51333_52512_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_010726850.1|52690_53680_-|transposase	IS30-like element IS6770 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.8e-36
WP_139425042.1|53944_55123_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	2.3e-30
WP_002295743.1|55383_56292_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002323245.1|57039_58212_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_002307605.1|61651_62044_-	OsmC family protein	NA	NA	NA	NA	NA
WP_104775459.1|62040_62931_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	6.7e-22
WP_104775460.1|63466_64132_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	66.1	1.6e-84
WP_002314381.1|64333_64738_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_002334645.1|64753_65317_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_010738673.1|65330_67814_-	vitamin B12-dependent ribonucleotide reductase	NA	A0A0K2CP92	Brevibacillus_phage	45.4	2.9e-184
WP_010738674.1|67963_68509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113836386.1|69142_69829_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	5.0e-126
WP_104775475.1|70076_71477_-	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_104775474.1|71524_73024_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_104775473.1|73059_73770_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104775472.1|73837_74653_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_002336724.1|74663_75632_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002288612.1|76365_77568_-	restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_002285820.1|78540_79746_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.7	2.5e-35
WP_113787907.1|79806_80493_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	2.2e-126
WP_002298365.1|81621_82254_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	28.4	7.8e-09
WP_002330554.1|82266_84990_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002322451.1|85126_86092_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002298371.1|86145_86958_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002298373.1|86971_87745_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298375.1|87758_88229_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002343823.1|88225_88642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311511.1|88966_89809_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_104775254.1|90203_91628_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_104775253.1|91627_92371_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	36.8	1.2e-35
WP_104775252.1|92603_94116_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.4	2.0e-50
WP_139425047.1|97395_98064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297423.1|99018_99945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290394.1|100503_100821_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002323399.1|100821_101076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|101434_101839_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323589.1|101855_103004_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002348857.1|103710_103905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303636.1|105256_106297_+	replication protein RepA	NA	NA	NA	NA	NA
WP_002323647.1|107120_107453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705466.1|108071_108413_+	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	62.5	1.5e-35
WP_139425050.1|108424_108616_+	DUF5415 family protein	NA	NA	NA	NA	NA
WP_033603157.1|109817_110201_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	74.4	1.4e-48
WP_002305041.1|110690_111509_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002305042.1|111669_112359_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002305043.1|112372_113875_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002305045.1|113887_114364_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002295624.1|115074_115197_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002326514.1|115351_115612_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	52.7	2.4e-12
WP_002305810.1|116055_116262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343760.1|116261_116513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343761.1|116528_116966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343762.1|117094_117295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326154.1|117769_118201_+	HicB family protein	NA	F0PIL2	Enterococcus_phage	64.2	1.3e-42
WP_002287525.1|118381_119530_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|119546_119951_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002326152.1|120134_121112_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	28.8	4.4e-27
WP_104775486.1|121146_122451_-	MFS transporter	NA	NA	NA	NA	NA
WP_002317769.1|122825_123998_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002324509.1|124166_124424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096638037.1|124795_125482_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	4.5e-127
WP_002336758.1|126224_126488_+	epsilon-antitoxin	NA	NA	NA	NA	NA
WP_104775436.1|126905_127604_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	48.9	4.0e-54
WP_104775435.1|127663_128539_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010722385.1|128624_130286_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_104775434.1|130278_131490_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010722383.1|131506_132367_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_104775433.1|132363_133200_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_010722380.1|133261_133942_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	90.7	2.7e-116
>prophage 2
NZ_CP040850	Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence	207651	139712	207310	207651	integrase,transposase	Streptococcus_phage(35.48%)	62	129802:129816	203801:203815
129802:129816	attL	TTTTAGAACGTTTAA	NA	NA	NA	NA
WP_001015311.1|139712_140392_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002294510.1|140468_140720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002325145.1|140770_141229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294513.1|142317_143802_+	ABC-F type ribosomal protection protein Lsa(E)	NA	A0A2H4UUX5	Bodo_saltans_virus	26.0	2.6e-26
WP_002294514.1|143855_144659_+	lincosamide nucleotidyltransferase Lnu(B)	NA	NA	NA	NA	NA
WP_002303393.1|146310_146535_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002303392.1|146549_147419_+	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	90.3	5.7e-151
WP_000662263.1|147399_148134_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_002294505.1|148166_149030_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	A0A1X9I6F2	Streptococcus_phage	100.0	8.7e-168
WP_002294507.1|149073_149601_+	adenine phosphoribosyltransferase	NA	A0A1X9I6E2	Streptococcus_phage	100.0	1.9e-93
WP_002294509.1|149732_150542_+	ANT(9) family aminoglycoside nucleotidyltransferase Spw	NA	NA	NA	NA	NA
WP_001015311.1|150819_151499_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002318473.1|151670_152996_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.4	5.9e-99
WP_002290348.1|152988_153339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295345.1|153479_153989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301591.1|155378_156464_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002287525.1|156684_157833_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|157849_158254_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002293041.1|158709_158907_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	78.5	3.9e-23
WP_002325668.1|159227_160181_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	4.8e-34
WP_002301108.1|160278_160833_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002346605.1|161329_162238_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002323245.1|163462_164635_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_002334003.1|164957_165611_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	3.1e-24
WP_080106440.1|165674_165815_-	RNA helicase	NA	NA	NA	NA	NA
WP_002334002.1|165900_167151_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	1.3e-55
WP_002326114.1|167343_168375_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.0e-26
WP_016180798.1|168355_169213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104775453.1|169209_170016_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_104775452.1|170021_170846_-	nucleotide pyrophosphatase	NA	NA	NA	NA	NA
WP_002326110.1|170835_171927_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_104775451.1|172104_172890_+	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002326108.1|172921_173305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104770950.1|173380_173512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016180796.1|173480_173705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080106442.1|173676_173919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104775450.1|174011_174785_-	radical SAM protein	NA	NA	NA	NA	NA
WP_113809318.1|174941_176103_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	4.6e-79
WP_104879369.1|176260_179410_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.3	1.4e-21
WP_104879370.1|179423_180647_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	31.2	1.6e-18
WP_002326177.1|180636_182232_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	51.3	6.2e-127
WP_002326143.1|182423_182723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324517.1|182847_183180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002328392.1|184809_185634_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_002328393.1|185846_188009_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	41.1	4.3e-06
WP_002328394.1|188289_190584_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_002328395.1|190576_191242_+	beta-phosphoglucomutase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	27.8	1.8e-11
WP_002323589.1|193809_194958_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002287522.1|194974_195379_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002326561.1|195589_196678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324630.1|196824_198015_+|transposase	IS256-like element ISLgar5 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	28.4	4.3e-24
WP_113795693.1|198133_199345_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002326559.1|199482_200427_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002295193.1|200440_201100_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	55.9	1.6e-52
WP_113836384.1|201187_202210_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002326556.1|202683_203274_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	33.1	8.3e-21
WP_002326555.1|203279_204113_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
203801:203815	attR	TTAAACGTTCTAAAA	NA	NA	NA	NA
WP_002326554.1|204293_205271_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_071858892.1|205299_205566_-	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	36.0	6.2e-08
WP_002331379.1|205983_206343_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	40.4	4.4e-17
WP_000384569.1|206508_206706_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000395511.1|206695_207310_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	46.8	5.5e-07
