The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040848	Pasteurella multocida strain EB104 chromosome, complete genome	2449276	99534	135327	2449276	tail,transposase,integrase	Pseudomonas_phage(54.84%)	46	125292:125306	135020:135034
WP_005755558.1|99534_100380_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	62.4	2.4e-101
WP_005755559.1|100531_100792_-	hypothetical protein	NA	B7SDP6	Haemophilus_phage	57.3	5.8e-19
WP_025248440.1|100857_103647_-|tail	phage tail protein	tail	A0A2D1GNP9	Pseudomonas_phage	46.0	2.0e-181
WP_014668240.1|103646_103847_-	hypothetical protein	NA	A0A2D2W288	Stenotrophomonas_phage	45.8	1.2e-08
WP_005755565.1|103850_104102_-	hypothetical protein	NA	A0A2D1GNV4	Pseudomonas_phage	59.2	4.6e-21
WP_014668241.1|104118_104928_-	DUF2163 domain-containing protein	NA	A0A2D1GNT2	Pseudomonas_phage	50.5	1.7e-77
WP_014668242.1|104941_106621_-	hypothetical protein	NA	J9STL4	Pseudomonas_phage	38.6	4.4e-91
WP_005755570.1|106628_107591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668243.1|107592_108585_-	hypothetical protein	NA	A0A2D1GMZ0	Marinobacter_phage	27.5	5.2e-23
WP_014668244.1|108594_111942_-	tape measure protein	NA	A0A2D1GNK1	Pseudomonas_phage	32.5	3.8e-118
WP_014668245.1|111954_112170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668246.1|112379_112805_-	hypothetical protein	NA	A0A2D1GNY5	Pseudomonas_phage	40.4	3.0e-20
WP_005755580.1|112865_113612_-	hypothetical protein	NA	A0A2D1GNQ7	Pseudomonas_phage	49.2	1.2e-59
WP_014668247.1|113604_113865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668248.1|113861_114308_-	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	30.9	1.5e-14
WP_005755584.1|114307_114814_-	DUF1320 domain-containing protein	NA	Q5ZQX5	Pseudomonas_phage	42.1	1.6e-28
WP_005755585.1|114823_115747_-	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	60.7	1.8e-102
WP_014668249.1|115807_116173_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_014668250.1|116169_117171_-	peptidase	NA	Q5ZQY0	Pseudomonas_phage	54.6	8.0e-40
WP_014668251.1|117388_117889_-	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	41.7	3.1e-32
WP_014668252.1|117986_119225_-	hypothetical protein	NA	J9STS2	Pseudomonas_phage	47.2	2.3e-105
WP_014668253.1|119208_120732_-	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	53.5	2.5e-149
WP_025248438.1|120734_122351_-	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	64.6	2.9e-185
WP_014668255.1|122350_122890_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	51.7	4.0e-46
WP_005755593.1|122901_123207_-	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	53.0	8.7e-22
WP_005755594.1|123208_123559_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	33.6	5.3e-07
WP_038641606.1|123655_123907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668258.1|124086_124686_-	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	55.7	2.7e-59
WP_014668259.1|124687_125059_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	53.2	2.6e-20
125292:125306	attL	CAGTAATTTTTACTC	NA	NA	NA	NA
WP_014668260.1|125300_125540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668261.1|125597_126188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025248437.1|126200_126728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005755617.1|126758_127169_-	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	39.4	8.9e-14
WP_025248436.1|127345_127573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005755620.1|127637_127874_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_014668263.1|127953_128139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005755623.1|128151_128466_+	hypothetical protein	NA	Q5ZR02	Pseudomonas_phage	41.1	5.8e-13
WP_014668264.1|128476_129421_+	hypothetical protein	NA	J9SND0	Pseudomonas_phage	31.5	2.3e-28
WP_014668265.1|129432_131202_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	46.5	1.8e-148
WP_014668266.1|131213_132392_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	54.8	4.6e-111
WP_014668267.1|132394_132718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005755632.1|132727_132949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005755634.1|133197_133818_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	60.2	1.2e-67
WP_005755637.1|133987_134215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668269.1|134211_134757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668270.1|134766_135327_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	29.7	8.2e-18
135020:135034	attR	GAGTAAAAATTACTG	NA	NA	NA	NA
>prophage 2
NZ_CP040848	Pasteurella multocida strain EB104 chromosome, complete genome	2449276	309719	319077	2449276		Sinorhizobium_phage(16.67%)	9	NA	NA
WP_014326205.1|309719_310994_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.8e-92
WP_005753554.1|311034_311652_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_014326206.1|311651_312539_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_025248491.1|312608_313556_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	39.0	1.5e-43
WP_005753553.1|313631_315185_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
WP_010906540.1|315419_316211_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	4.4e-17
WP_005724066.1|316219_317005_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_005724065.1|317081_318062_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-15
WP_014326208.1|318078_319077_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
>prophage 3
NZ_CP040848	Pasteurella multocida strain EB104 chromosome, complete genome	2449276	666317	675755	2449276	transposase	Lactococcus_phage(16.67%)	7	NA	NA
WP_010907422.1|666317_668720_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.2	5.2e-69
WP_005725044.1|668720_669458_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_038641419.1|669542_670103_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	61.8	1.6e-50
WP_010907420.1|670173_673005_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
WP_005719438.1|673176_673677_+	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	55.6	4.0e-40
WP_014325726.1|673859_674324_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
WP_005725034.1|674900_675755_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.3	5.8e-31
>prophage 4
NZ_CP040848	Pasteurella multocida strain EB104 chromosome, complete genome	2449276	853686	930781	2449276	tail,protease,integrase,tRNA,terminase,plate	Escherichia_phage(21.62%)	79	848797:848812	900435:900450
848797:848812	attL	AAAGTGCGGTCATTTT	NA	NA	NA	NA
WP_014326462.1|853686_854970_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	34.4	6.6e-63
WP_014326463.1|855598_856981_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_016504487.1|857016_857949_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_014326465.1|858169_860044_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.2	7.5e-15
WP_014326466.1|860094_860643_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_016504488.1|860660_861266_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.7	3.1e-23
WP_014326468.1|861354_862203_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_005724710.1|862204_862825_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.8	1.4e-71
WP_075270726.1|863764_864475_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	48.4	6.4e-52
WP_046338746.1|864650_864917_+	transcriptional regulator	NA	F6MII4	Haemophilus_phage	63.4	1.2e-19
WP_075270727.1|864961_866947_+	DDE endonuclease	NA	M4M9R2	Vibrio_phage	45.1	7.1e-157
WP_075270728.1|866957_867875_+	AAA family ATPase	NA	M4M9P4	Vibrio_phage	43.5	1.5e-61
WP_075270729.1|867877_868174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270730.1|868187_868415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270731.1|868429_868951_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	54.4	1.0e-46
WP_075270732.1|869036_869225_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158635963.1|869235_869403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270733.1|869432_870347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270734.1|870416_870917_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_075270735.1|870913_871456_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	43.7	2.4e-38
WP_075270736.1|871455_871818_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	44.2	2.9e-24
WP_075270737.1|871936_872359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270738.1|872483_873020_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	69.7	1.3e-73
WP_064775722.1|873030_873258_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	72.4	6.0e-20
WP_064775721.1|873254_873515_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_064775719.1|873632_873962_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_074865631.1|873958_874261_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	61.5	2.2e-25
WP_075270739.1|874283_874856_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	44.0	1.7e-34
WP_075270740.1|874842_876150_+|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	65.7	6.5e-151
WP_075270741.1|876151_877567_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	45.8	2.0e-113
WP_016533207.1|877567_878839_+	mu gp30-like protein	NA	J9STS2	Pseudomonas_phage	49.1	2.5e-54
WP_016533208.1|878967_879432_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	38.8	6.8e-10
WP_016533209.1|879682_880786_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	42.0	4.6e-73
WP_016533210.1|880804_881731_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	47.9	1.0e-73
WP_016533211.1|881796_882114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533212.1|882113_882548_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	37.8	4.0e-20
WP_016533213.1|882559_883057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533214.1|883066_884452_+|tail	tail sheath-like protein	tail	A4JWK5	Burkholderia_virus	44.3	2.0e-97
WP_016533215.1|884462_884981_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	45.0	3.9e-38
WP_016533216.1|885073_885343_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_016533217.1|885363_885498_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_016533218.1|885513_885747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570132.1|885781_888130_+|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	38.8	1.1e-71
WP_016533316.1|888129_889062_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_016533315.1|889042_889273_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	47.8	7.2e-13
WP_016533314.1|889265_890330_+	regulator-like protein	NA	NA	NA	NA	NA
WP_016533313.1|890316_890886_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_016533312.1|890940_891306_+|plate	phage baseplate-like protein	plate	NA	NA	NA	NA
WP_016533311.1|891305_892412_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	36.4	3.6e-57
WP_016533310.1|892404_892974_+|tail	phage tail protein	tail	A4JWL7	Burkholderia_virus	44.8	4.5e-40
WP_016570130.1|895521_895701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718857.1|897893_898613_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	34.2	2.0e-16
WP_005724708.1|898756_900250_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_014326471.1|900469_901333_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
900435:900450	attR	AAAATGACCGCACTTT	NA	NA	NA	NA
WP_005724701.1|901444_901975_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_014326472.1|901990_903322_+	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	29.1	4.6e-43
WP_010907311.1|903402_904353_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.7	3.9e-28
WP_005751979.1|905070_906255_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.3	8.3e-12
WP_014326473.1|906377_907718_-	phospholipase	NA	NA	NA	NA	NA
WP_005751981.1|907782_909249_-	gluconate permease	NA	NA	NA	NA	NA
WP_014326474.1|909260_910208_-	SDR family oxidoreductase	NA	A0A0N7KVW3	Yellowstone_lake_phycodnavirus	26.0	3.4e-08
WP_014326475.1|910346_912146_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005723974.1|912147_912822_-	cyclase family protein	NA	NA	NA	NA	NA
WP_014326476.1|912837_913620_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_005751985.1|913621_914254_-	aldolase	NA	A0A077SK32	Escherichia_phage	60.0	2.2e-64
WP_016504417.1|914250_915492_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	53.5	3.2e-115
WP_116538863.1|915494_916400_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	72.9	8.9e-115
WP_005717875.1|916614_917376_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	52.4	7.9e-64
WP_116538864.1|917433_918894_-	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_014326479.1|919052_919514_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005754896.1|919588_920773_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_005752716.1|921230_921977_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014326482.1|923258_923747_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_014668377.1|923761_925072_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_014326484.1|925121_925967_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014326485.1|925992_927396_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_014326486.1|927405_928347_+	sugar kinase	NA	NA	NA	NA	NA
WP_005754908.1|928365_929004_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_005757558.1|929065_930781_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP040848	Pasteurella multocida strain EB104 chromosome, complete genome	2449276	1592278	1636552	2449276	tail,coat,integrase,terminase,capsid	Mannheimia_phage(48.65%)	67	1592127:1592172	1646285:1646330
1592127:1592172	attL	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
WP_014390695.1|1592278_1593451_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	53.1	2.0e-111
WP_014390696.1|1593826_1594282_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	47.1	4.6e-27
WP_041423219.1|1594326_1594680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391445.1|1594688_1595186_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_014391447.1|1595320_1595920_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	37.6	4.6e-19
WP_064964852.1|1595970_1596759_-	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.6	4.2e-20
WP_016570064.1|1596830_1597184_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_116538880.1|1597256_1597709_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	52.9	1.4e-36
WP_075271319.1|1597708_1598248_-	HNH endonuclease	NA	U5XJH2	Phormidium_phage	44.1	4.8e-07
WP_116538881.1|1598247_1598907_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	74.9	1.2e-95
WP_014391451.1|1598893_1599847_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	72.8	1.2e-122
WP_014391452.1|1599848_1600136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538882.1|1600148_1600385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538883.1|1600356_1600656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|1600722_1601034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538953.1|1601095_1601752_-	KilA-N domain-containing protein	NA	K7PH30	Enterobacteria_phage	46.6	2.7e-20
WP_064964923.1|1602675_1603473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538884.1|1603691_1604072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391457.1|1604249_1604522_+	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	78.9	5.5e-36
WP_014391458.1|1604514_1604703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391459.1|1604999_1605194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391460.1|1605174_1605345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271373.1|1605357_1605588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041423181.1|1606096_1606621_-	DUF2730 family protein	NA	A0A0M3LP99	Mannheimia_phage	60.4	1.3e-22
WP_014391463.1|1606592_1606988_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	77.8	2.2e-57
WP_099803111.1|1607007_1607697_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	56.2	9.6e-69
WP_099803112.1|1607818_1608019_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101750067.1|1608067_1608520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390721.1|1608571_1609255_+	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	67.9	9.5e-77
WP_075271368.1|1609251_1609467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538885.1|1609463_1610222_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	85.3	1.5e-46
WP_078819893.1|1610218_1611574_+	AAA family ATPase	NA	A0A0M3LQC0	Mannheimia_phage	52.2	5.2e-127
WP_078819892.1|1611576_1612002_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	59.3	5.6e-43
WP_014667790.1|1612075_1612291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538886.1|1612283_1612886_+	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	4.8e-32
WP_116538887.1|1612887_1613349_+	antitermination protein	NA	NA	NA	NA	NA
WP_064964938.1|1613478_1614036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391475.1|1614152_1614413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078737811.1|1614409_1614940_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	51.4	2.0e-45
WP_116538954.1|1614912_1615236_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_116538955.1|1615659_1615995_+	DUF2829 domain-containing protein	NA	F8WPN8	Bacillus_phage	45.3	1.9e-14
WP_016533412.1|1616103_1616481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533413.1|1616604_1616841_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016533414.1|1616837_1617134_-	hypothetical protein	NA	S5M7P0	Sinorhizobium_phage	43.0	1.9e-13
WP_016533415.1|1617266_1617968_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_016533416.1|1617954_1618383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538889.1|1618698_1619289_+	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	39.5	3.7e-21
WP_116538890.1|1619291_1620563_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	61.4	4.3e-147
WP_116538891.1|1620572_1621976_+	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	59.8	6.8e-154
WP_079157879.1|1621965_1623567_+|capsid	minor capsid protein	capsid	A0A0M3LQ07	Mannheimia_phage	52.1	4.7e-151
WP_079157866.1|1623569_1623788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064965033.1|1623762_1624197_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	D0UIJ3	Aggregatibacter_phage	60.1	7.7e-40
WP_079157867.1|1624233_1624632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079157868.1|1624807_1625593_+	hypothetical protein	NA	A0A1V0DY60	Dinoroseobacter_phage	36.5	1.1e-25
WP_075271385.1|1625610_1626768_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	43.6	1.3e-81
WP_015691075.1|1626824_1627061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538892.1|1627077_1627545_+	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	55.7	1.4e-34
WP_015691077.1|1627546_1627921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533105.1|1627922_1628324_+	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.4	2.1e-39
WP_015691079.1|1628323_1628716_+	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	46.2	5.5e-29
WP_116538893.1|1628728_1629745_+	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	69.3	1.1e-129
WP_016533103.1|1629817_1630234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538894.1|1630602_1630932_+|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	50.9	1.9e-27
WP_116538895.1|1631003_1631699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538896.1|1634533_1635238_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	64.4	1.0e-81
WP_116538956.1|1635242_1635986_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	60.8	7.9e-85
WP_102827078.1|1635928_1636552_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	55.3	9.6e-52
1646285:1646330	attR	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
>prophage 6
NZ_CP040848	Pasteurella multocida strain EB104 chromosome, complete genome	2449276	1661056	1741583	2449276	tail,head,transposase,tRNA,capsid,plate	Shigella_phage(26.83%)	86	NA	NA
WP_014325706.1|1661056_1663126_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005751822.1|1663155_1663536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325707.1|1663666_1664290_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_014325708.1|1664307_1664571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005723293.1|1664601_1665504_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016504292.1|1665785_1667039_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_005723289.1|1667149_1668007_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_005717448.1|1668259_1669273_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_005717447.1|1669343_1669790_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_005717446.1|1669944_1670406_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005723284.1|1670507_1671854_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005723282.1|1671936_1672188_+	YhdT family protein	NA	NA	NA	NA	NA
WP_014325712.1|1672177_1673611_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005717441.1|1673753_1674635_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_005723278.1|1674911_1675916_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005723276.1|1675896_1676196_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_025248417.1|1676420_1680314_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	53.2	1.5e-113
WP_139625263.1|1680762_1681317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325718.1|1683585_1684611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016504262.1|1685075_1687505_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_116538899.1|1687650_1688388_-	ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	32.5	1.9e-14
WP_014325720.1|1688399_1689344_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005717426.1|1689356_1690145_-	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014325721.1|1690452_1691007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325722.1|1691487_1692567_+	endonuclease	NA	NA	NA	NA	NA
WP_010907004.1|1692656_1694312_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	34.9	7.4e-83
WP_005723242.1|1694529_1695084_-	DUF5358 domain-containing protein	NA	NA	NA	NA	NA
WP_025248418.1|1695231_1696989_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_005723238.1|1697173_1698835_+	putative transporter	NA	NA	NA	NA	NA
WP_005723236.1|1698882_1699173_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_014325723.1|1699417_1700728_+	porin	NA	NA	NA	NA	NA
WP_014325724.1|1700790_1701333_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.7	4.8e-23
WP_005757181.1|1701342_1702011_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_005717387.1|1702076_1702805_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	38.1	4.9e-31
WP_005826050.1|1703085_1703346_+	hypothetical protein	NA	F6MIM3	Haemophilus_phage	100.0	6.4e-42
WP_116538957.1|1703386_1704172_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	95.4	5.3e-148
WP_116538900.1|1704310_1704595_-	DNA helicase UvrD	NA	Q776W9	Haemophilus_phage	62.5	2.8e-22
WP_116538901.1|1704573_1705122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538902.1|1705124_1707344_-	hypothetical protein	NA	A0A1Y0SVL0	Pasteurella_phage	33.4	7.3e-86
WP_079157915.1|1707346_1707946_-	YmfQ family protein	NA	A0A2I7S9L6	Vibrio_phage	33.5	1.1e-23
WP_116538903.1|1707936_1709004_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	43.1	9.3e-71
WP_005752473.1|1709003_1709414_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	38.7	3.5e-18
WP_116538904.1|1709424_1709973_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	47.0	2.2e-31
WP_116538905.1|1710004_1710484_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	39.0	1.2e-14
WP_116538906.1|1710487_1711255_-|tail	phage tail protein	tail	A0A0C4UQS1	Shigella_phage	37.4	4.1e-44
WP_116538907.1|1711254_1712619_-	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	27.5	2.3e-34
WP_116538908.1|1712628_1714521_-	tape measure protein	NA	A0A2I7S9D9	Vibrio_phage	34.4	1.2e-55
WP_116538909.1|1714610_1714994_-	hypothetical protein	NA	C9DGP9	Escherichia_phage	52.1	6.4e-22
WP_005752480.1|1714997_1715351_-|tail	tail protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	32.7	1.7e-08
WP_116538910.1|1715361_1716825_-|tail	phage tail protein	tail	A0A0C4UQS0	Shigella_phage	50.6	4.0e-125
WP_005738156.1|1716824_1717016_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_079157925.1|1717027_1717582_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_161976779.1|1717578_1717998_-	DUF1320 family protein	NA	NA	NA	NA	NA
WP_116538912.1|1717997_1718402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005825910.1|1718490_1719414_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	55.1	7.5e-93
WP_116538913.1|1719413_1720478_-	hypothetical protein	NA	A0A0C4UQU6	Shigella_phage	48.0	2.1e-70
WP_116538914.1|1720706_1721141_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_139625264.1|1721309_1721576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538916.1|1721715_1723050_-|capsid	minor capsid protein	capsid	C9DGN7	Escherichia_phage	42.1	4.3e-89
WP_161976780.1|1723036_1724611_-	DUF935 family protein	NA	A0A0C4UQR8	Shigella_phage	52.8	1.2e-146
WP_116538960.1|1724598_1726113_-	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	61.4	1.2e-156
WP_116538917.1|1726169_1726739_-	DUF3486 family protein	NA	A0A2I7S9D1	Vibrio_phage	45.9	1.7e-42
WP_005752497.1|1726772_1727066_-	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	65.6	1.4e-24
WP_005752500.1|1727062_1727392_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_116538918.1|1727388_1727616_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_116538919.1|1727608_1727827_-	hypothetical protein	NA	F6MIK2	Haemophilus_phage	61.2	2.5e-07
WP_116538920.1|1727744_1728017_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_005752503.1|1728019_1728238_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	88.4	9.2e-26
WP_116538921.1|1728240_1728789_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	70.6	3.3e-72
WP_116538922.1|1728868_1729384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538923.1|1729392_1729827_-	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	43.3	4.2e-22
WP_116538924.1|1730030_1730585_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	53.0	1.3e-44
WP_116538925.1|1730571_1731120_-	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_116538926.1|1731256_1731673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005752512.1|1731674_1731860_-	hypothetical protein	NA	F6MIJ2	Haemophilus_phage	96.4	6.4e-20
WP_005752513.1|1731859_1732078_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_116538927.1|1732153_1732450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116538928.1|1732446_1732971_-	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	92.5	2.3e-83
WP_005825938.1|1732995_1733313_-	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	45.2	1.5e-13
WP_161976781.1|1733315_1734233_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	46.2	2.8e-63
WP_116538929.1|1734267_1734774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116538930.1|1734874_1736866_-|transposase	transposase	transposase	C9DGL1	Escherichia_phage	44.7	9.3e-149
WP_079157945.1|1736877_1737090_-	DNA-binding protein	NA	A0A0M3LPY8	Mannheimia_phage	70.6	1.9e-20
WP_116538931.1|1737303_1737843_+	DNA-binding protein	NA	A0A0M3LP76	Mannheimia_phage	69.1	7.4e-16
WP_014325726.1|1738200_1738665_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
WP_116538932.1|1738790_1741583_-	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	33.6	5.4e-78
