The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP037865	Pasteurella multocida subsp. multocida strain HN02 chromosome, complete genome	2333292	141807	152726	2333292		Mannheimia_phage(50.0%)	18	NA	NA
WP_016570077.1|141807_142464_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	61.2	5.9e-68
WP_071523618.1|142594_142801_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	67.6	6.0e-19
WP_139638716.1|142849_143299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139638717.1|143356_144109_+	Rha family transcriptional regulator	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	36.8	3.2e-33
WP_139638718.1|144066_144429_+	hypothetical protein	NA	A0A0P0IKQ2	Acinetobacter_phage	44.4	2.0e-17
WP_139638719.1|144921_145611_+	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.6	1.1e-32
WP_139639355.1|145620_146151_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	3.6e-55
WP_139638720.1|146140_146647_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	82.1	1.4e-77
WP_139638721.1|146806_147388_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	60.0	2.3e-55
WP_139639356.1|147441_147888_+	antitermination protein	NA	Q5TJL7	Enterobacteria_phage	32.6	4.5e-11
WP_014390733.1|148204_148501_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	71.4	8.4e-14
WP_139638722.1|148497_149028_+	glycoside hydrolase family protein	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	3.3e-45
WP_014667795.1|149000_149324_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_139638723.1|149229_149511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390736.1|149545_149980_-	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
WP_016533497.1|150008_150191_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	3.8e-09
WP_081274327.1|150515_150731_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_015691093.1|151229_152726_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	50.3	3.1e-56
>prophage 2
NZ_CP037865	Pasteurella multocida subsp. multocida strain HN02 chromosome, complete genome	2333292	174805	182634	2333292	tRNA,transposase	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_005721045.1|174805_176068_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.2	8.1e-98
WP_005721047.1|176206_177178_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.7	4.2e-46
WP_005721049.1|177188_179039_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_005721053.1|179064_179361_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.7	9.0e-08
WP_006253505.1|179754_180171_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_139616922.1|180217_181354_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_139638728.1|181476_182634_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.3	5.2e-91
>prophage 3
NZ_CP037865	Pasteurella multocida subsp. multocida strain HN02 chromosome, complete genome	2333292	196970	206355	2333292		Tupanvirus(33.33%)	9	NA	NA
WP_005721071.1|196970_197969_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
WP_005721076.1|197985_198966_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.9	1.0e-15
WP_005721077.1|199042_199828_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_005721078.1|199836_200655_-	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L3Z8	Tupanvirus	33.2	5.0e-16
WP_139639358.1|200889_202443_+	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	48.7	8.4e-20
WP_005721080.1|202518_203466_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.4	2.5e-43
WP_139638735.1|203535_204423_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005753554.1|204422_205040_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_139638736.1|205080_206355_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.2	8.8e-92
>prophage 4
NZ_CP037865	Pasteurella multocida subsp. multocida strain HN02 chromosome, complete genome	2333292	510061	518137	2333292		Haemophilus_phage(42.86%)	9	NA	NA
WP_005716452.1|510061_511117_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.3	4.6e-22
WP_139638817.1|511205_511337_-	TonB-dependent receptor domain protein	NA	NA	NA	NA	NA
WP_139638818.1|511552_512260_-	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	49.3	3.8e-52
WP_139638819.1|512434_512698_+	transcriptional regulator	NA	F6MII4	Haemophilus_phage	64.6	1.2e-19
WP_139638820.1|512742_513732_+	hypothetical protein	NA	M4M9R2	Vibrio_phage	43.9	3.3e-70
WP_139638821.1|513949_514312_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	43.4	3.2e-23
WP_139638822.1|514430_514853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139638823.1|514977_515514_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	68.6	6.5e-73
WP_139617238.1|517018_518137_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	32.8	1.1e-24
>prophage 5
NZ_CP037865	Pasteurella multocida subsp. multocida strain HN02 chromosome, complete genome	2333292	572712	648184	2333292	tRNA,protease,plate,tail,holin	Haemophilus_phage(26.67%)	60	NA	NA
WP_139639364.1|572712_573414_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005716148.1|573643_574057_-	YhcB family protein	NA	NA	NA	NA	NA
WP_139638840.1|574177_575938_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_139617216.1|576015_576732_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_139617215.1|576754_577456_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005716138.1|577594_578899_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_005716135.1|578976_580200_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_139638841.1|580916_582185_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_139638842.1|582245_584285_-	oligopeptidase A	NA	NA	NA	NA	NA
WP_005751513.1|584406_584769_+	YbaN family protein	NA	NA	NA	NA	NA
WP_139638843.1|584825_586397_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005716111.1|586448_587108_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	1.2e-41
WP_005716110.1|587171_587909_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_139638844.1|587957_588872_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_139638845.1|589015_589708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005716108.1|589783_590524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005751507.1|590752_591307_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_139638846.1|591430_593314_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.0	4.1e-13
WP_005726554.1|593393_593768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139638847.1|593829_594768_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_005716088.1|594879_595638_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_005716086.1|595926_596424_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_005716085.1|596439_596925_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_139617205.1|597309_598362_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A067ZJG7	Escherichia_phage	50.8	1.1e-87
WP_139638848.1|598371_599496_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_005722076.1|599610_601839_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_005722078.1|601877_602684_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_005722080.1|602670_603879_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_139638849.1|604080_604839_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005722084.1|604874_606284_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	36.5	5.8e-28
WP_005722087.1|606317_607319_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	37.0	8.2e-53
WP_005722090.1|607486_608362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005722092.1|608387_608975_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	38.1	2.3e-31
WP_005753984.1|608985_610536_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_005753986.1|610783_611845_+|protease	protease SohB	protease	A0A219YA27	Aeromonas_phage	23.3	2.3e-05
WP_139638850.1|612086_612905_+	OmpA family protein	NA	NA	NA	NA	NA
WP_005726416.1|612958_613825_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_139638851.1|614079_615582_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_139638852.1|615650_619247_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_139638853.1|619341_620475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139638854.1|621766_623362_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005722139.1|623696_625628_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	8.8e-128
WP_139638855.1|626144_627203_+|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	69.8	2.6e-134
WP_016533279.1|627205_627862_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	61.5	2.3e-67
WP_139638856.1|627940_628291_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	77.6	1.5e-46
WP_139638857.1|628305_629370_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	63.7	6.1e-123
WP_139638858.1|629366_629957_+	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	69.8	1.4e-73
WP_016570130.1|632549_632729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139638859.1|632874_632994_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_139638860.1|633057_633897_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	70.9	1.8e-114
WP_139638861.1|635257_635782_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_005722175.1|635816_636755_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	80.9	2.6e-125
WP_005722177.1|636938_638264_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_005722179.1|638314_639046_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_139638862.1|639045_643533_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_139638863.1|643608_644043_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_139617180.1|644184_645051_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
WP_139638864.1|645152_646580_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_005722182.1|647421_647733_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_005722184.1|647791_648184_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 6
NZ_CP037865	Pasteurella multocida subsp. multocida strain HN02 chromosome, complete genome	2333292	702708	708364	2333292	transposase	Haemophilus_phage(33.33%)	8	NA	NA
WP_005716039.1|702708_702918_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	57.1	1.4e-15
WP_139638886.1|702979_703246_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	62.5	2.4e-20
WP_139638887.1|703422_704106_+	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	34.3	9.3e-32
WP_005722169.1|704482_704836_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005596065.1|704906_705104_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_139638888.1|705501_706044_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.9e-14
WP_139616922.1|706764_707901_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_006253505.1|707947_708364_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
>prophage 7
NZ_CP037865	Pasteurella multocida subsp. multocida strain HN02 chromosome, complete genome	2333292	820946	830802	2333292	transposase	Escherichia_phage(25.0%)	16	NA	NA
WP_139616922.1|820946_822083_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_006253505.1|822129_822546_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_139638922.1|823679_824153_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.7	6.4e-40
WP_016533221.1|824411_824588_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	65.5	2.9e-14
WP_016533220.1|824635_825052_+	hypothetical protein	NA	A0A0R6PD76	Moraxella_phage	52.9	1.0e-33
WP_139638923.1|825089_825371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078819663.1|825276_825600_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_139639369.1|825602_825956_-	hypothetical protein	NA	Q7Y5V0	Haemophilus_phage	54.1	1.5e-30
WP_139638718.1|826235_826598_-	hypothetical protein	NA	A0A0P0IKQ2	Acinetobacter_phage	44.4	2.0e-17
WP_139638717.1|826555_827308_-	Rha family transcriptional regulator	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	36.8	3.2e-33
WP_071523829.1|827363_827561_-	hypothetical protein	NA	D0UIL7	Aggregatibacter_phage	71.1	9.5e-06
WP_016570079.1|827563_828016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064965013.1|828065_828272_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	51.5	2.2e-13
WP_139638924.1|828410_829046_+	LexA family transcriptional repressor	NA	G9L676	Escherichia_phage	44.3	4.6e-41
WP_139638925.1|829214_830252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139638926.1|830199_830802_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	47.9	1.9e-41
>prophage 8
NZ_CP037865	Pasteurella multocida subsp. multocida strain HN02 chromosome, complete genome	2333292	835105	846246	2333292	integrase	Mannheimia_phage(55.56%)	17	839778:839792	851997:852011
WP_139617319.1|835105_836059_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	40.1	9.0e-49
WP_139617320.1|836068_836854_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	62.1	2.1e-88
WP_139617321.1|836846_837458_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	75.9	8.2e-88
WP_139617322.1|837565_837949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139638928.1|837951_838854_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	47.5	8.4e-65
WP_081355597.1|838879_839329_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	45.7	9.2e-12
WP_139638929.1|839340_839826_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	51.5	2.4e-34
839778:839792	attL	ATCTTCAGTAACTCA	NA	NA	NA	NA
WP_139638930.1|839835_840066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139638931.1|840119_840416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691047.1|840460_840757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071522871.1|841387_841600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616948.1|841628_841937_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_139638932.1|841834_842926_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KGX2	Edwardsiella_phage	35.9	5.4e-58
WP_005726097.1|843268_843931_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	53.4	2.6e-31
WP_005721637.1|844029_844359_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_005721635.1|844471_845353_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005753777.1|845352_846246_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	25.5	4.1e-11
851997:852011	attR	TGAGTTACTGAAGAT	NA	NA	NA	NA
>prophage 9
NZ_CP037865	Pasteurella multocida subsp. multocida strain HN02 chromosome, complete genome	2333292	1348834	1358128	2333292	tail,protease	Mannheimia_phage(50.0%)	14	NA	NA
WP_139639091.1|1348834_1349026_-	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	70.5	1.3e-20
WP_139639092.1|1349147_1349546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139639093.1|1349574_1349757_+	hypothetical protein	NA	A0A0M3LQH8	Mannheimia_phage	63.6	1.3e-12
WP_139639094.1|1349878_1350454_+	DUF1834 family protein	NA	F6MIJ8	Haemophilus_phage	48.7	2.6e-27
WP_139639095.1|1350457_1350871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139639096.1|1350873_1351041_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	74.5	6.8e-13
WP_139639097.1|1351075_1351417_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	43.9	1.5e-14
WP_139639098.1|1351416_1351785_-|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	53.9	1.8e-26
WP_005725059.1|1352296_1352851_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_139639099.1|1353176_1354004_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	37.7	2.3e-32
WP_005719483.1|1354175_1354619_+	peptidoglycan-binding protein LysM	NA	J9QDY6	Clostridium_phage	44.3	1.4e-07
WP_139639100.1|1354832_1356131_+	trigger factor	NA	NA	NA	NA	NA
WP_005719487.1|1356295_1356877_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.4	2.4e-60
WP_139639102.1|1356892_1358128_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	3.4e-125
>prophage 10
NZ_CP037865	Pasteurella multocida subsp. multocida strain HN02 chromosome, complete genome	2333292	1419399	1427573	2333292	integrase	Escherichia_phage(33.33%)	8	1423903:1423962	1425827:1426333
WP_139639122.1|1419399_1420098_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	51.5	8.8e-62
WP_102955880.1|1420087_1420609_+	hypothetical protein	NA	Q71TB7	Escherichia_phage	36.5	5.6e-21
WP_139639123.1|1420870_1422109_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	25.1	4.8e-18
WP_005720081.1|1422172_1423789_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	49.1	3.4e-125
WP_139639124.1|1423856_1424411_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
1423903:1423962	attL	TTACTGACGCTTGGGAACAGCGGAAGTTGGGAATCTTTATTCAAGACTATATAGAAAAAA	NA	NA	NA	NA
WP_139617492.1|1424437_1425364_+|integrase	tyrosine-type recombinase/integrase	integrase	A8ATM2	Listeria_phage	47.7	8.9e-78
WP_139617493.1|1425335_1425860_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_005719320.1|1425947_1427573_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.4	7.1e-155
1425827:1426333	attR	TTTTTTCTATATAGTCTTGAATAAAGATTCCCAACTTCCGCTGTTCCCAAGCGTCAGTAAAAGCAAATAAAAAAAGCTGTCAAGCAACACCTGACAGCCTTAATTTATTACATCTTTACGCTTATTTTTTATTGTCTTTTGCCGCTTTGACAAAGCCAGCAAAGAGTGGGTGACCATCACGTGGCGTGGAGGTGAATTCTGGGTGGAATTGACACGCCACAAACCAAGGGTGGTTTGGTACCTCAATAATTTCCACTAATTTTTTATCTGCGGATAAGCCAGTAACTTTCAAGCCTGCTTTTTCCACTTGTGGACGTAAGACGTTATTGACTTCATAACGATGACGATGACGCTCTTCGATGGTTTCAGCACCATAAAGTTCACGTGCTTTGCTCCCTTCCATTAAATGACATTGTTGTGCACCTAAACGCATGGTGCCACCTAAATCAGAGGCATCAGTACGTGTTTCAATATTCCCTTCGGCATCTTGCCATTCGGTGATTAAGC	NA	NA	NA	NA
