The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025446	Salmonella enterica subsp. enterica serovar Agona strain USDA-ARS-USMARC-76333 chromosome, complete genome	4794633	930007	939286	4794633	protease,integrase	Dickeya_phage(16.67%)	9	931189:931203	944850:944864
WP_134941041.1|930007_931057_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.3e-08
WP_000125885.1|931053_933000_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-39
931189:931203	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|933129_933351_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|933674_933995_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934057.1|934025_936302_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.1e-164
WP_071591100.1|936497_936827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001747668.1|936798_937275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001117984.1|938549_938747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001747671.1|938908_939286_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	40.2	1.0e-19
944850:944864	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
NZ_CP025446	Salmonella enterica subsp. enterica serovar Agona strain USDA-ARS-USMARC-76333 chromosome, complete genome	4794633	1083525	1120761	4794633	plate,transposase	Enterobacteria_phage(20.0%)	29	NA	NA
WP_100148601.1|1083525_1084781_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	2.4e-17
WP_000623370.1|1085061_1085520_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001227394.1|1085643_1086015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001022123.1|1086023_1086464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000928422.1|1086483_1086996_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001216386.1|1087036_1087483_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_006496204.1|1087511_1087643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139255.1|1089927_1090770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002328.1|1090793_1091273_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000076070.1|1091291_1092653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137105.1|1092663_1096125_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000365805.1|1096203_1097616_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000089147.1|1097617_1098355_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614296.1|1098351_1101087_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.5	2.9e-84
WP_000343978.1|1101099_1101858_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246455.1|1101862_1103194_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_130549539.1|1103196_1103700_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000796942.1|1103726_1105013_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000509052.1|1105037_1106126_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393863.1|1106089_1107943_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611701.1|1107947_1108364_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_006496106.1|1108360_1109833_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000524265.1|1109881_1110094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031252.1|1110123_1110627_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142966.1|1111255_1111774_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_006496101.1|1111996_1114138_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	3.5e-24
WP_000014621.1|1114206_1118373_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	40.6	1.4e-21
WP_000739389.1|1118440_1119406_+	Sel1 repeat protein	NA	NA	NA	NA	NA
WP_109188131.1|1119599_1120761_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.8	1.2e-47
>prophage 3
NZ_CP025446	Salmonella enterica subsp. enterica serovar Agona strain USDA-ARS-USMARC-76333 chromosome, complete genome	4794633	2127290	2137797	4794633		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2127290_2128604_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565903.1|2128630_2129710_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648785.1|2129714_2130488_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018219.1|2130503_2131478_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973710.1|2131483_2132035_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	1.3e-52
WP_000857531.1|2132035_2132914_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023665.1|2132961_2133861_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	1.1e-29
WP_000697849.1|2133860_2134946_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	1.0e-101
WP_000981469.1|2135322_2136216_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111843.1|2136393_2137797_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 4
NZ_CP025446	Salmonella enterica subsp. enterica serovar Agona strain USDA-ARS-USMARC-76333 chromosome, complete genome	4794633	2213827	2222998	4794633	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2213827_2215861_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703143.1|2216101_2216560_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
WP_001197951.1|2216731_2217262_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2217318_2217786_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2217832_2218552_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272851.1|2218548_2220234_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	6.2e-279
WP_001240418.1|2220456_2221188_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2221247_2221355_+	protein YohO	NA	NA	NA	NA	NA
WP_000824850.1|2221335_2222067_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2222050_2222998_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 5
NZ_CP025446	Salmonella enterica subsp. enterica serovar Agona strain USDA-ARS-USMARC-76333 chromosome, complete genome	4794633	2692459	2789797	4794633	lysis,head,capsid,tRNA,terminase,integrase,portal,plate,tail	Salmonella_phage(74.07%)	92	2771492:2771507	2799386:2799401
WP_000083343.1|2692459_2693197_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2693327_2694662_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001747585.1|2694679_2695579_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2695681_2696269_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2696330_2696714_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179975.1|2697032_2697722_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	50.0	2.1e-55
WP_000997368.1|2697837_2698875_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2699078_2699498_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183644.1|2699570_2700251_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082651.1|2700304_2702965_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2703079_2704435_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264468.1|2704477_2704801_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807814.1|2704797_2706099_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	3.4e-43
WP_000985658.1|2706202_2706658_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	8.6e-34
WP_001235092.1|2712713_2715287_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992634.1|2715416_2716148_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2716144_2717125_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2717256_2717994_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2718265_2718604_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2718707_2718755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200080.1|2718854_2720015_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210991.1|2719975_2720884_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2720941_2722063_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_006496406.1|2722072_2723143_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	1.1e-90
WP_001212379.1|2723582_2724101_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030981.1|2724093_2725314_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2725470_2725818_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2725858_2726626_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2726670_2727219_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2727237_2727486_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2727738_2729100_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2729265_2730057_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2730076_2731363_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001294018.1|2731483_2732089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2732123_2732714_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2732837_2733716_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880958.1|2733801_2735463_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2735611_2735950_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2736115_2736406_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2736395_2736872_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2737021_2737504_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237691.1|2738118_2749593_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533865.1|2749657_2751067_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196133.1|2751063_2753244_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_072101449.1|2753251_2754415_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980498.1|2754966_2755185_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_006501166.1|2755253_2756354_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.6	9.0e-194
WP_000980409.1|2756350_2756836_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_006501165.1|2756832_2759640_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	98.3	0.0e+00
WP_000763316.1|2759632_2759752_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280962.1|2759766_2760069_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_001207653.1|2760123_2760639_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_006501164.1|2760648_2761821_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	3.7e-222
WP_006501163.1|2761923_2762481_-	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.9	9.4e-99
WP_077918804.1|2762450_2763530_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	91.8	1.2e-182
WP_001287104.1|2763536_2763944_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	85.2	6.7e-62
WP_006501158.1|2763947_2764565_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.1	1.6e-94
WP_045791118.1|2764534_2766109_-|tail	tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.9	3.3e-157
WP_001086802.1|2766105_2766711_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.1e-116
WP_006493508.1|2766703_2767612_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.7	7.2e-157
WP_006493507.1|2767598_2767958_-|plate	baseplate assembly protein W	plate	E5G6N7	Salmonella_phage	92.4	6.3e-56
WP_000993750.1|2767954_2768533_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
WP_000343939.1|2768601_2769048_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	3.8e-66
WP_001039964.1|2769040_2769472_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	4.0e-73
WP_001648763.1|2769567_2769996_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_000871620.1|2769992_2770367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006493502.1|2770371_2770881_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.2e-93
WP_000171565.1|2770861_2771077_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|2771080_2771284_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673541.1|2771283_2771748_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	7.9e-83
2771492:2771507	attL	TTGCCGTCCAGCATAT	NA	NA	NA	NA
WP_000059169.1|2771841_2772492_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	1.6e-113
WP_000730754.1|2772495_2773563_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	2.8e-192
WP_006493498.1|2773579_2774413_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.1	1.1e-127
WP_006493495.1|2774555_2776322_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.6	0.0e+00
WP_006493493.1|2776321_2777356_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	94.8	4.1e-188
WP_006493491.1|2777402_2778320_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_006493490.1|2778282_2779485_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	37.1	5.6e-64
WP_001749760.1|2779815_2780004_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	91.7	5.7e-24
WP_001749759.1|2780141_2780369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006493489.1|2780388_2782782_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	88.8	0.0e+00
WP_006493488.1|2782778_2783636_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.8	4.6e-113
WP_000785514.1|2783632_2783860_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	5.4e-21
WP_001178763.1|2783859_2784087_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
WP_000963476.1|2784154_2784496_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
WP_001528723.1|2784459_2784654_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
WP_000794278.1|2784738_2785014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006493486.1|2785100_2785610_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	3.5e-84
WP_000102106.1|2785642_2785885_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_023136550.1|2786004_2786637_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	96.7	5.8e-113
WP_006493482.1|2786638_2787655_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	5.0e-191
WP_006493480.1|2787661_2788888_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	65.4	3.6e-151
WP_001650427.1|2789215_2789797_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	55.8	1.5e-51
2799386:2799401	attR	ATATGCTGGACGGCAA	NA	NA	NA	NA
>prophage 6
NZ_CP025446	Salmonella enterica subsp. enterica serovar Agona strain USDA-ARS-USMARC-76333 chromosome, complete genome	4794633	3244792	3302598	4794633	holin,head,capsid,tRNA,terminase,integrase,portal,transposase,tail	Cronobacter_phage(62.79%)	63	3258789:3258812	3308510:3308533
WP_096322988.1|3244792_3246048_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
WP_001076978.1|3246159_3246813_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
WP_000566824.1|3247249_3247546_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_000928927.1|3247620_3247830_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_000171739.1|3248087_3248708_+	YqiJ family protein	NA	NA	NA	NA	NA
WP_000342880.1|3248726_3250406_+	flotillin family protein	NA	NA	NA	NA	NA
WP_107251209.1|3250486_3250705_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_000867682.1|3250864_3252298_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	8.8e-40
WP_000188316.1|3252345_3255189_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_000046217.1|3255306_3256608_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_001125344.1|3256849_3257464_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000708447.1|3257526_3258768_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
3258789:3258812	attL	TTGCCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
WP_001281933.1|3258875_3259697_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000355776.1|3259794_3260154_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272784.1|3260260_3260872_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_001264394.1|3261121_3262135_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3262362_3262578_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3262813_3264559_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3264708_3266556_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3266679_3267186_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_071785330.1|3267978_3268200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023250426.1|3268358_3270059_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	9.9e-224
WP_000200789.1|3270061_3270607_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267951.1|3270578_3271304_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_001215677.1|3271293_3271824_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_006548862.1|3271826_3273839_-|tail	phage tail fiber repeat-containing protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_006548865.1|3273848_3274436_-	protein phage	NA	F1BUK5	Cronobacter_phage	82.1	8.4e-90
WP_000136927.1|3274428_3275613_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.6	5.1e-179
WP_001002797.1|3275609_3275939_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_006548868.1|3275935_3277906_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.9	3.9e-264
WP_000411337.1|3278093_3278351_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_001270303.1|3278337_3278526_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
WP_000376370.1|3278497_3278830_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
WP_000175560.1|3278829_3279171_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3279167_3279461_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3279470_3279926_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3279922_3281050_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_006548875.1|3281046_3281754_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	7.5e-101
WP_000084220.1|3281750_3282257_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000447489.1|3282253_3282742_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.0	5.0e-64
WP_001218537.1|3282802_3283504_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550496.1|3283507_3284530_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018802.1|3284591_3285395_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.4	4.1e-79
WP_006548880.1|3285555_3287331_+	Terminase ATPase subunit from bacteriophage origin	NA	F1BUM5	Cronobacter_phage	82.4	4.1e-289
WP_000038208.1|3287327_3288389_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
WP_001552031.1|3288385_3288709_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353142.1|3288682_3288889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006560556.1|3289008_3291033_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.4	6.5e-299
WP_031604933.1|3291029_3292037_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	45.3	1.1e-70
WP_024141020.1|3292039_3292909_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.7	1.6e-129
WP_000551169.1|3292899_3293133_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3293200_3293602_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3293601_3294027_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3294016_3294244_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460878.1|3294253_3294757_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247711.1|3294787_3295009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514631.1|3295152_3295734_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_000568372.1|3295750_3296317_+	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_001145219.1|3296320_3297358_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000627044.1|3297347_3299129_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_000213690.1|3299386_3300154_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_001582501.1|3300385_3301033_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478462.1|3301029_3302598_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.2e-12
3308510:3308533	attR	TTGCCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
>prophage 7
NZ_CP025446	Salmonella enterica subsp. enterica serovar Agona strain USDA-ARS-USMARC-76333 chromosome, complete genome	4794633	4334848	4355270	4794633	plate,tail	Burkholderia_phage(45.0%)	25	NA	NA
WP_000587738.1|4334848_4335577_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_000084338.1|4336314_4336770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023785434.1|4336766_4337372_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_001747515.1|4337376_4339122_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.2e-51
WP_000359502.1|4339124_4339757_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000951740.1|4339749_4340865_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.2	2.9e-99
WP_001093501.1|4340855_4341215_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632050.1|4341378_4342926_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_000703629.1|4342925_4343855_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_000593184.1|4343851_4344214_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000679392.1|4344541_4345264_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000818151.1|4345273_4346317_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.3	8.5e-77
WP_001269716.1|4346304_4346514_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271418.1|4346513_4347467_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	3.9e-36
WP_001262488.1|4347466_4349821_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_001185654.1|4349917_4350046_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003644.1|4350005_4350323_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4350374_4350899_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729845.1|4350898_4352326_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.6	2.8e-195
WP_000875314.1|4352315_4352513_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449437.1|4352509_4352965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4353123_4353438_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270445.1|4353450_4354056_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	61.0	5.9e-62
WP_001226439.1|4354058_4354346_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615248.1|4354922_4355270_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 8
NZ_CP025446	Salmonella enterica subsp. enterica serovar Agona strain USDA-ARS-USMARC-76333 chromosome, complete genome	4794633	4631188	4675569	4794633	tRNA,integrase,transposase,tail	Enterobacteria_phage(18.18%)	47	4656986:4657001	4673533:4673548
WP_000252549.1|4631188_4631635_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000047544.1|4631709_4632096_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148570.1|4632172_4632634_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013055.1|4632646_4633582_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
WP_000249504.1|4633617_4633719_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_001518160.1|4633698_4633839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000666051.1|4633808_4634297_-	arginine repressor	NA	NA	NA	NA	NA
WP_000514438.1|4634483_4635887_-	YfcC family protein	NA	NA	NA	NA	NA
WP_000237031.1|4635942_4636947_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000428749.1|4637058_4637991_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000410847.1|4638001_4639222_-	arginine deiminase	NA	NA	NA	NA	NA
WP_000583453.1|4639897_4640350_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000103041.1|4640423_4641428_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002940.1|4641593_4642010_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000218447.1|4642021_4642834_+|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
WP_000826193.1|4643078_4643567_-	DUF3617 domain-containing protein	NA	NA	NA	NA	NA
WP_001747736.1|4643674_4644178_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001066989.1|4644372_4645560_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416337.1|4645701_4648557_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.4	9.3e-142
WP_000190703.1|4648556_4649039_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397158.1|4649136_4650648_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
WP_000584132.1|4651041_4652142_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001182242.1|4652141_4653224_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001244060.1|4653419_4654418_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001128356.1|4654481_4655801_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998688.1|4655862_4656627_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000453362.1|4656651_4657683_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
4656986:4657001	attL	TTTTCTGCTTTCCAGC	NA	NA	NA	NA
WP_000896759.1|4657899_4658430_+	gluconokinase	NA	NA	NA	NA	NA
WP_000152567.1|4658457_4659477_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	30.5	3.9e-42
WP_000772651.1|4659948_4661211_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	35.6	2.8e-66
WP_001066528.1|4661241_4661880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000455466.1|4662250_4662481_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_071591111.1|4662542_4663127_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001247004.1|4663119_4663479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027149.1|4663510_4663795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075576.1|4663791_4664175_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000211874.1|4664171_4666844_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	2.1e-58
WP_001066192.1|4667244_4668006_+	septation initiation protein	NA	NA	NA	NA	NA
WP_001185338.1|4668005_4668278_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	6.3e-08
WP_006501160.1|4668455_4668635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292737.1|4668654_4668966_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	66.0	2.4e-27
WP_001747644.1|4668980_4669100_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_001280979.1|4669092_4671726_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	31.3	5.8e-106
WP_000254751.1|4673027_4673276_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000016244.1|4673384_4673624_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
4673533:4673548	attR	GCTGGAAAGCAGAAAA	NA	NA	NA	NA
WP_001199743.1|4673626_4673935_+	CcdB family protein	NA	NA	NA	NA	NA
WP_096322988.1|4674314_4675569_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
