The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040782	Bacillus thuringiensis strain HM-311 chromosome, complete genome	5489489	266149	274098	5489489		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|266149_266434_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|266472_268107_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_000743911.1|268513_270052_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_000833096.1|270436_271762_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000929884.1|271907_272609_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	3.3e-40
WP_089149772.1|272592_274098_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.2	2.7e-31
>prophage 2
NZ_CP040782	Bacillus thuringiensis strain HM-311 chromosome, complete genome	5489489	319653	328029	5489489		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|319653_320961_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170538.1|321049_321769_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	1.4e-49
WP_000278823.1|321761_322016_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666787.1|322012_322696_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055571.1|322679_324899_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.3	6.7e-164
WP_000879023.1|324883_326299_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262444.1|326404_327445_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.6e-67
WP_000088593.1|327441_328029_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	3.1e-28
>prophage 3
NZ_CP040782	Bacillus thuringiensis strain HM-311 chromosome, complete genome	5489489	1204084	1263457	5489489	transposase,integrase,bacteriocin,coat	Bacillus_phage(30.77%)	58	1247294:1247313	1265644:1265663
WP_085960089.1|1204084_1205429_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	2.8e-112
WP_000421886.1|1205570_1206341_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_080029703.1|1206482_1207034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001277741.1|1207092_1207551_-	exosporium protein ExsY	NA	NA	NA	NA	NA
WP_000899662.1|1207676_1208036_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_033672524.1|1208137_1208323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149681.1|1208400_1208904_-	exosporium protein ExsF	NA	NA	NA	NA	NA
WP_001277698.1|1209071_1209542_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_000191198.1|1209684_1211751_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	31.3	1.7e-76
WP_000543304.1|1211851_1212274_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000765863.1|1212275_1212794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089149682.1|1212887_1213619_-	esterase family protein	NA	NA	NA	NA	NA
WP_000806939.1|1213822_1214734_+	DMT family transporter	NA	NA	NA	NA	NA
WP_089149703.1|1214810_1215158_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_089149683.1|1215230_1215629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000107210.1|1215784_1217263_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_001176172.1|1217701_1217890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061883900.1|1218293_1219712_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000636359.1|1219708_1220296_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	47.4	1.4e-47
WP_089149684.1|1220292_1221318_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.8	4.6e-51
WP_000447789.1|1221319_1222081_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	41.8	4.8e-37
WP_089149685.1|1222077_1222692_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_089149686.1|1222688_1223882_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_086409345.1|1223885_1224662_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000946131.1|1224735_1225095_+	DUF4029 domain-containing protein	NA	NA	NA	NA	NA
WP_000996243.1|1225209_1226709_+	lactate permease	NA	NA	NA	NA	NA
WP_001142359.1|1226972_1228088_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	43.2	6.7e-80
WP_074626135.1|1228336_1229020_+	YukJ family protein	NA	NA	NA	NA	NA
WP_047385758.1|1229034_1229868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046945132.1|1230062_1230848_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_061883903.1|1230867_1232103_+	YARHG domain-containing protein	NA	NA	NA	NA	NA
WP_042990049.1|1232149_1232572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089149687.1|1232771_1234106_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000996782.1|1234266_1234677_+	DUF3908 family protein	NA	NA	NA	NA	NA
WP_089149688.1|1234707_1236249_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_089149689.1|1236264_1238214_-	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_001061558.1|1238210_1240130_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
WP_000569894.1|1240254_1241514_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_089149690.1|1241647_1244515_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_000428506.1|1245338_1245548_+	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	41.1	1.3e-05
WP_001109911.1|1245550_1245928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001178294.1|1245956_1246139_+	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
WP_001042764.1|1246269_1246632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169497.1|1247054_1247651_+	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
1247294:1247313	attL	ATTTGAAAAGCTAGAAGAAG	NA	NA	NA	NA
WP_089149691.1|1248341_1250408_+	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	30.9	3.9e-73
WP_089149692.1|1250660_1250975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089149693.1|1251075_1252038_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_089149694.1|1253234_1253840_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	29.9	6.1e-19
WP_089149695.1|1254183_1254534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089149697.1|1254897_1255509_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_089149698.1|1255784_1256468_-	metalloendopeptidase	NA	NA	NA	NA	NA
WP_089149699.1|1256451_1256685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089149700.1|1256681_1256966_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_089149701.1|1257404_1257995_+	restriction endonuclease	NA	A0A076YJ23	Mesorhizobium_phage	58.9	3.1e-68
WP_089149702.1|1258013_1258676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149704.1|1258710_1259847_-	hypothetical protein	NA	A0A1P8BMM5	Lactococcus_phage	21.9	1.1e-13
WP_139032724.1|1261132_1262477_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.1	2.3e-111
WP_139032725.1|1262536_1263457_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	28.6	2.9e-28
1265644:1265663	attR	ATTTGAAAAGCTAGAAGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP040782	Bacillus thuringiensis strain HM-311 chromosome, complete genome	5489489	1859416	1867467	5489489		Bacillus_phage(83.33%)	7	NA	NA
WP_089148980.1|1859416_1860661_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	44.4	3.6e-13
WP_001194306.1|1860760_1861525_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_089148981.1|1861765_1863526_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.2	2.4e-273
WP_000612415.1|1863610_1864288_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.6	3.0e-123
WP_139032735.1|1864284_1865358_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.5	1.4e-186
WP_061664158.1|1865585_1866305_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_089148982.1|1866594_1867467_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	4.3e-66
>prophage 5
NZ_CP040782	Bacillus thuringiensis strain HM-311 chromosome, complete genome	5489489	2196559	2204317	5489489	integrase	Bacillus_phage(50.0%)	10	2194655:2194671	2212640:2212656
2194655:2194671	attL	TTAAAAGAAAGTATGCA	NA	NA	NA	NA
WP_089148461.1|2196559_2197696_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	35.4	2.1e-52
WP_089148462.1|2197952_2198390_+	helix-turn-helix domain-containing protein	NA	A0A142F1P0	Bacillus_phage	60.0	2.8e-37
WP_001205804.1|2198726_2199071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089148463.1|2199440_2199827_+	hypothetical protein	NA	A0A142F1P2	Bacillus_phage	38.4	1.7e-14
WP_089148464.1|2199910_2200417_+	zinc-finger domain-containing protein	NA	G9J2C6	Bacillus_phage	39.8	1.9e-10
WP_089148465.1|2200416_2201181_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	56.1	8.4e-74
WP_089148466.1|2201656_2201893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089148467.1|2202595_2202784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089148468.1|2203242_2203473_-	CGEA protein	NA	NA	NA	NA	NA
WP_089148469.1|2204029_2204317_+	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	44.4	3.2e-10
2212640:2212656	attR	TGCATACTTTCTTTTAA	NA	NA	NA	NA
>prophage 6
NZ_CP040782	Bacillus thuringiensis strain HM-311 chromosome, complete genome	5489489	2279985	2337236	5489489	protease,integrase,holin,portal,terminase,capsid,coat,tail,head,plate	Bacillus_phage(93.02%)	67	2304705:2304721	2322309:2322325
WP_074594855.1|2279985_2280882_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002005064.1|2280881_2281541_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_089148509.1|2281798_2282404_+	PRK06770 family protein	NA	NA	NA	NA	NA
WP_000425906.1|2282474_2283341_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000726549.1|2283470_2284514_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001057956.1|2284593_2285025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000285238.1|2285311_2286436_+	choloylglycine hydrolase	NA	NA	NA	NA	NA
WP_000921852.1|2286487_2286751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001263004.1|2287877_2288567_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000528662.1|2288825_2289713_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001027685.1|2289746_2290343_+	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_000834795.1|2290564_2292319_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	6.9e-47
WP_001243553.1|2292311_2294108_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	1.9e-55
WP_074594850.1|2294176_2294320_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_001257879.1|2294776_2295280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001123247.1|2295665_2295950_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_089148510.1|2296330_2297437_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	69.1	4.4e-124
WP_089148511.1|2297641_2297821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089148512.1|2298324_2299518_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVK2	Bacillus_phage	59.0	6.6e-126
WP_000427704.1|2300036_2300396_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	43.9	7.8e-22
WP_044797971.1|2300565_2300769_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	59.7	4.4e-14
WP_089148513.1|2300974_2301241_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	88.2	7.8e-35
WP_089148514.1|2301615_2302365_+	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	85.9	4.4e-91
WP_089148515.1|2302312_2303176_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	93.3	2.5e-130
WP_089148516.1|2303178_2303373_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	85.9	6.9e-25
WP_089148517.1|2303389_2303668_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.3	3.3e-12
WP_089148518.1|2303660_2304020_+	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	55.2	4.1e-31
WP_000717826.1|2304038_2304206_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_089148519.1|2304231_2304483_+	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	50.0	2.0e-16
WP_089148520.1|2304502_2304958_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	48.6	5.4e-20
2304705:2304721	attL	TTGCTGATATTGTAAAA	NA	NA	NA	NA
WP_089148521.1|2304997_2305192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089148522.1|2305374_2305683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089148523.1|2305719_2306700_+	site-specific DNA-methyltransferase	NA	A0A2H4JD00	uncultured_Caudovirales_phage	61.2	9.3e-118
WP_089148524.1|2307453_2307690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089148525.1|2307905_2308961_+	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_089148527.1|2310512_2310704_+	hypothetical protein	NA	A0A0S2MV77	Bacillus_phage	95.0	1.2e-26
WP_089148529.1|2311023_2311494_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	92.3	1.1e-76
WP_089148530.1|2311490_2312033_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	88.3	7.3e-88
WP_089148531.1|2312673_2313111_-|coat	spore coat protein G	coat	NA	NA	NA	NA
WP_089148532.1|2313410_2313635_+	hypothetical protein	NA	A0A1B1P745	Bacillus_phage	77.0	8.8e-24
WP_089148533.1|2313641_2313830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089148534.1|2313840_2314062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001258413.1|2314073_2314421_+	hypothetical protein	NA	A0A1B1P757	Bacillus_phage	55.3	1.2e-24
WP_089148535.1|2314423_2314732_+	hypothetical protein	NA	A0A1B1P767	Bacillus_phage	91.3	5.1e-46
WP_001170969.1|2314839_2315160_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	82.1	5.1e-41
WP_089148590.1|2315203_2316823_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	60.2	6.1e-191
WP_089148536.1|2316837_2318010_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	83.4	1.6e-185
WP_086391596.1|2317990_2318707_+|protease	Clp protease ClpP	protease	A0A2H4JC91	uncultured_Caudovirales_phage	53.0	9.1e-54
WP_089148537.1|2318749_2319913_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	42.9	3.3e-85
WP_089148538.1|2320053_2320350_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	94.9	2.4e-45
WP_089148539.1|2320330_2320687_+|head	phage head closure protein	head	A0A1B1P760	Bacillus_phage	97.5	1.8e-58
WP_089148591.1|2320703_2321081_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	99.2	6.2e-62
WP_089148540.1|2321067_2321508_+	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	99.3	3.5e-72
WP_033693050.1|2321495_2322080_+	hypothetical protein	NA	A0A1B1P778	Bacillus_phage	88.7	6.0e-96
WP_089148541.1|2322151_2322613_+	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	98.7	2.6e-78
2322309:2322325	attR	TTGCTGATATTGTAAAA	NA	NA	NA	NA
WP_089148542.1|2322791_2324372_+	hypothetical protein	NA	A0A1B1P775	Bacillus_phage	99.2	1.4e-134
WP_089148543.1|2324626_2327722_+	hypothetical protein	NA	A0A1B1P764	Bacillus_phage	90.8	1.6e-235
WP_089148544.1|2327723_2328407_+|tail	phage tail protein	tail	A0A1B1P761	Bacillus_phage	93.4	2.4e-120
WP_089148545.1|2328406_2330812_+	endopeptidase	NA	A0A1B1P770	Bacillus_phage	93.3	0.0e+00
WP_089148546.1|2330826_2332002_+|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	79.9	1.3e-171
WP_001115042.1|2332082_2332322_+	peptidase	NA	A0A1B1P7E0	Bacillus_phage	100.0	7.4e-37
WP_000792639.1|2332364_2332595_+|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	92.1	1.2e-31
WP_089148547.1|2332611_2333544_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	90.4	7.7e-170
WP_089148548.1|2333597_2334032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089148549.1|2334752_2335541_+	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	51.8	8.7e-66
WP_089148550.1|2335629_2336403_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_089148551.1|2336444_2337236_+	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	67.2	8.4e-101
>prophage 7
NZ_CP040782	Bacillus thuringiensis strain HM-311 chromosome, complete genome	5489489	2553965	2623931	5489489	protease,integrase,holin,portal,terminase,capsid,tail,head	Bacillus_phage(58.54%)	68	2575169:2575187	2629980:2629998
WP_089149655.1|2553965_2555075_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.7	9.8e-148
WP_089149654.1|2555680_2556889_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	43.1	2.7e-74
WP_000367267.1|2557334_2557685_-	helix-turn-helix transcriptional regulator	NA	A0A288WFW4	Bacillus_phage	37.1	1.4e-15
WP_001192731.1|2557871_2558096_+	helix-turn-helix transcriptional regulator	NA	A0A288WG89	Bacillus_phage	45.1	4.7e-09
WP_000522182.1|2558136_2558403_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	75.3	3.2e-28
WP_089149652.1|2558778_2559753_+	DnaD domain protein	NA	D2XR43	Bacillus_phage	47.5	8.8e-60
WP_089149651.1|2559756_2560035_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	61.0	8.7e-13
WP_001125948.1|2560027_2560387_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	52.5	8.3e-32
WP_000754942.1|2560405_2560573_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	64.2	8.9e-13
WP_000109497.1|2560598_2560850_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	8.4e-07
WP_046946251.1|2560870_2561353_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	47.7	7.5e-20
WP_000267631.1|2561392_2561656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139032828.1|2563758_2564982_+	collagen-like repeat preface domain-containing protein	NA	A0A2R8FCV3	Brazilian_cedratvirus	36.3	5.8e-16
WP_089149649.1|2565296_2565551_+	hypothetical protein	NA	A0A1B1P779	Bacillus_phage	78.3	1.7e-34
WP_089149648.1|2565732_2566197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032829.1|2566390_2567182_-	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	33.9	2.5e-20
WP_089149646.1|2567365_2567830_-	exosporium protein D	NA	NA	NA	NA	NA
WP_089149645.1|2568892_2569087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141549.1|2571299_2571515_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	78.9	7.7e-25
WP_089149642.1|2572584_2573067_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	81.9	1.9e-71
WP_089149641.1|2573066_2573609_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	1.1e-88
WP_089149640.1|2574243_2574972_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
2575169:2575187	attL	TTTTTCTTAGCTTGATGGG	NA	NA	NA	NA
WP_139032830.1|2575968_2576226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149637.1|2576398_2576620_+	hypothetical protein	NA	B5LPQ8	Bacillus_virus	87.0	2.5e-26
WP_089149636.1|2576633_2576897_+	hypothetical protein	NA	A0A1B1P745	Bacillus_phage	45.2	1.2e-06
WP_089149635.1|2576862_2577198_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	92.8	5.5e-54
WP_089149634.1|2577321_2577633_+|terminase	terminase	terminase	D2XR14	Bacillus_phage	97.1	2.3e-46
WP_089149633.1|2577629_2579297_+|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	90.3	4.2e-304
WP_089149632.1|2579308_2580469_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	82.2	3.3e-178
WP_089149631.1|2580452_2581235_+|protease	Clp protease ClpP	protease	R9TLM7	Paenibacillus_phage	52.4	4.3e-57
WP_089149630.1|2581238_2582393_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	90.4	1.1e-199
WP_000381900.1|2582398_2582692_+	hypothetical protein	NA	D2XR19	Bacillus_phage	94.8	1.8e-45
WP_002024166.1|2582693_2583047_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	96.6	2.3e-58
WP_089149629.1|2583048_2583393_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	86.6	1.2e-48
WP_089149628.1|2583389_2583719_+	hypothetical protein	NA	D2XR22	Bacillus_phage	93.6	1.0e-52
WP_001004911.1|2583719_2584307_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	82.6	3.0e-87
WP_000415911.1|2584311_2584674_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	86.7	9.2e-55
WP_139032752.1|2584904_2586119_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	85.5	7.6e-186
WP_089149806.1|2586373_2586631_+	hypothetical protein	NA	D2XR26	Bacillus_phage	83.3	1.4e-33
WP_089148844.1|2586853_2589019_+|tail	phage tail tape measure protein	tail	A0A2H4JC82	uncultured_Caudovirales_phage	82.4	1.3e-79
WP_089148843.1|2589060_2590518_+|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	59.3	7.5e-172
WP_089148842.1|2590514_2594819_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	55.5	0.0e+00
WP_089148841.1|2594830_2595211_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	75.8	6.3e-46
WP_089148840.1|2595245_2595671_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	97.9	2.8e-71
WP_089148839.1|2595670_2596489_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P783	Bacillus_phage	94.5	2.2e-157
WP_033693045.1|2596675_2596882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032753.1|2597247_2598909_+	DUF3893 domain-containing protein	NA	NA	NA	NA	NA
WP_000732212.1|2599137_2599905_+	DUF3959 family protein	NA	NA	NA	NA	NA
WP_000878369.1|2600581_2600785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362072.1|2601113_2601326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565702.1|2601535_2602540_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000282694.1|2602685_2603090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000062091.1|2603250_2604486_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000106397.1|2604753_2606037_+	MFS transporter	NA	NA	NA	NA	NA
WP_001069256.1|2606026_2606659_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	44.4	4.1e-26
WP_000046095.1|2606729_2606885_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_000289125.1|2606987_2607485_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061884232.1|2607625_2608840_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000954441.1|2608948_2609527_+	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_000766388.1|2609702_2610554_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001088564.1|2611004_2612792_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_000743782.1|2613026_2615153_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_000932162.1|2615598_2616786_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	25.3	3.1e-06
WP_000864394.1|2616877_2617558_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_089148838.1|2617967_2618288_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_139032754.1|2618318_2619716_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_089148836.1|2619712_2622082_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_089148835.1|2622065_2623931_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2629980:2629998	attR	CCCATCAAGCTAAGAAAAA	NA	NA	NA	NA
>prophage 8
NZ_CP040782	Bacillus thuringiensis strain HM-311 chromosome, complete genome	5489489	3659812	3670286	5489489	bacteriocin	Bacillus_phage(45.45%)	14	NA	NA
WP_000413738.1|3659812_3660433_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_000976239.1|3660523_3661327_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_089149543.1|3661327_3661870_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102628.1|3661862_3662186_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000392444.1|3662555_3662786_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	73.7	1.5e-23
WP_046946488.1|3662847_3663744_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	51.4	1.1e-77
WP_001051373.1|3664020_3664863_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	47.7	3.0e-32
WP_139032834.1|3664985_3665972_-	lysozyme family protein	NA	A0A218KCJ1	Bacillus_phage	47.5	3.2e-33
WP_000464427.1|3666210_3666597_-	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	69.8	2.2e-46
WP_000511417.1|3667004_3667892_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	67.8	3.5e-95
WP_001189064.1|3668044_3668239_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	71.0	5.9e-16
WP_000531300.1|3668250_3669009_-	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	69.4	4.1e-97
WP_000283431.1|3669211_3669424_-	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_000241485.1|3669614_3670286_+	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	4.4e-34
>prophage 9
NZ_CP040782	Bacillus thuringiensis strain HM-311 chromosome, complete genome	5489489	3744336	3853125	5489489	protease,integrase,holin,tRNA,portal,transposase,terminase,capsid,coat,tail,head	Bacillus_phage(52.08%)	109	3746183:3746200	3843880:3843897
WP_001288799.1|3744336_3744879_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_000870461.1|3745004_3745436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005391.1|3745439_3746969_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
3746183:3746200	attL	GTAACGTAATTTCTTTAT	NA	NA	NA	NA
WP_074593595.1|3747101_3747287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000190155.1|3747397_3748264_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_000625417.1|3748250_3750008_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_000688039.1|3750232_3751156_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_000404341.1|3751214_3751475_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_001221095.1|3751624_3752419_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000099769.1|3752581_3754147_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_001283860.1|3754627_3755659_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	74.0	1.1e-137
WP_000990698.1|3755802_3757041_-	competence/damage-inducible protein CinA	NA	NA	NA	NA	NA
WP_001052968.1|3757061_3757640_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_089149561.1|3757704_3758631_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|3758652_3759438_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_000114454.1|3759577_3759826_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_000759623.1|3759901_3760615_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000411968.1|3760718_3762005_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.9	1.7e-10
WP_000772411.1|3762005_3763280_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.0	2.9e-55
WP_000008857.1|3763477_3764437_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001085260.1|3764437_3765496_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000456911.1|3765488_3767021_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.7e-12
WP_000730604.1|3767138_3768215_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	34.1	1.7e-48
WP_000114182.1|3768304_3769030_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085960089.1|3769588_3770934_-|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	2.8e-112
WP_001118802.1|3771004_3773386_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_000605023.1|3773598_3773802_-	ribonuclease	NA	NA	NA	NA	NA
WP_000139806.1|3773798_3774548_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_000823089.1|3774650_3776321_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000564763.1|3777057_3777936_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000692450.1|3777947_3779180_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000414846.1|3779203_3780250_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_089149762.1|3780400_3780637_-	dipicolinate synthase	NA	NA	NA	NA	NA
WP_089149763.1|3780826_3782545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149764.1|3782559_3783048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149765.1|3783541_3784351_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	91.8	6.7e-154
WP_065703361.1|3784350_3784776_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	96.5	1.4e-70
WP_089149766.1|3784863_3786237_-	PQQ-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_089149767.1|3786355_3786733_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	71.2	1.1e-45
WP_089149768.1|3786754_3791074_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	61.7	0.0e+00
WP_089149769.1|3791070_3792546_-|tail	phage tail protein	tail	A0A0A7AQV1	Bacillus_phage	81.7	1.5e-244
WP_089149770.1|3792587_3794777_-	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	64.7	2.9e-42
WP_089149806.1|3794994_3795252_-	hypothetical protein	NA	D2XR26	Bacillus_phage	83.3	1.4e-33
WP_139032788.1|3795506_3796718_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	85.9	1.8e-187
WP_089148399.1|3796948_3797305_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.6	2.8e-40
WP_089148398.1|3797311_3797905_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	90.3	5.3e-100
WP_089148397.1|3797905_3798235_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	97.2	1.3e-55
WP_089148396.1|3798231_3798576_-	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	92.9	4.1e-52
WP_089148395.1|3798577_3798931_-|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	94.8	1.1e-57
WP_029442425.1|3798932_3799226_-	hypothetical protein	NA	D2XR19	Bacillus_phage	91.8	3.5e-44
WP_089148394.1|3799231_3800386_-|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	91.9	2.1e-201
WP_089148393.1|3800389_3801172_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	59.1	1.7e-58
WP_089148392.1|3801155_3802319_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	81.2	2.7e-180
WP_089148391.1|3802327_3803986_-|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.5	3.0e-257
WP_000124846.1|3803982_3804318_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	3.0e-07
WP_089148390.1|3804470_3804806_-	alpha/beta hydrolase	NA	D2XR61	Bacillus_phage	92.8	1.5e-54
WP_089148389.1|3804792_3805056_-	hydrolase	NA	NA	NA	NA	NA
WP_089148388.1|3805847_3806363_-	DUF3231 family protein	NA	NA	NA	NA	NA
WP_089148387.1|3806708_3807011_+	WGxxGxxG-CTERM domain-containing protein	NA	NA	NA	NA	NA
WP_000434821.1|3807771_3807972_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	2.4e-20
WP_044795331.1|3808093_3808636_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.8	5.9e-90
WP_089148386.1|3808635_3809100_-	ArpU family transcriptional regulator	NA	D2XR57	Bacillus_phage	93.5	4.6e-75
WP_089148385.1|3809284_3809614_-	hypothetical protein	NA	I7I4E2	Bacillus_phage	52.1	1.4e-12
WP_089148384.1|3809710_3809977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089148383.1|3810376_3811702_+	collagen-like protein	NA	A0A285PWR0	Cedratvirus	67.9	1.5e-41
WP_089148382.1|3812590_3813106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088338601.1|3813143_3813338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089148381.1|3813375_3813567_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	63.5	1.9e-14
WP_089148380.1|3813639_3814002_-	cell division protein SepF	NA	D2XR47	Bacillus_phage	90.0	1.1e-55
WP_089148379.1|3813976_3814165_-	hypothetical protein	NA	D2XR45	Bacillus_phage	83.6	3.7e-15
WP_089148405.1|3814167_3815490_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	95.2	1.8e-236
WP_089148378.1|3815486_3816431_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	61.6	7.7e-85
WP_089148377.1|3816710_3816995_-	hypothetical protein	NA	D2XR42	Bacillus_phage	53.2	3.3e-23
WP_000215316.1|3817175_3817397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089148376.1|3817410_3817998_-	sporulation sigma factor-processing peptidase	NA	D2XR41	Bacillus_phage	69.7	6.5e-74
WP_002082295.1|3818088_3818337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063221106.1|3818372_3818564_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_089148375.1|3818742_3819180_+	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	59.2	1.6e-32
WP_089148374.1|3819192_3819624_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	79.6	1.3e-60
WP_089148373.1|3819707_3820382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089148372.1|3820391_3821132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089148371.1|3821361_3822909_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.8	7.0e-144
WP_000954738.1|3823363_3824266_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_001239758.1|3824436_3824688_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000593000.1|3824823_3826065_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	4.4e-56
WP_000868228.1|3826151_3827051_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000076737.1|3827204_3829343_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001229392.1|3829503_3829773_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_089148370.1|3829873_3830845_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_089148369.1|3830888_3831812_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000776437.1|3831898_3832255_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000582368.1|3832270_3832552_-	DUF503 family protein	NA	NA	NA	NA	NA
WP_000036343.1|3832548_3834609_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.9	3.8e-20
WP_001286524.1|3834613_3834925_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000071127.1|3834925_3835198_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000102604.1|3835209_3836316_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000359096.1|3836333_3836804_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000060003.1|3837140_3841442_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	39.6	4.1e-24
WP_000814290.1|3841566_3843267_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001090243.1|3843376_3844633_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
3843880:3843897	attR	GTAACGTAATTTCTTTAT	NA	NA	NA	NA
WP_000790373.1|3844650_3845793_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000813592.1|3845816_3846608_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000971296.1|3846625_3847402_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	9.0e-23
WP_000531501.1|3847487_3848045_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000042668.1|3848047_3848770_-	UMP kinase	NA	NA	NA	NA	NA
WP_001018578.1|3848836_3849724_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_000111485.1|3849827_3850529_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000421290.1|3850876_3851656_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_000550078.1|3851733_3853125_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.5	3.6e-46
>prophage 10
NZ_CP040782	Bacillus thuringiensis strain HM-311 chromosome, complete genome	5489489	3922106	3993897	5489489	protease,integrase,tRNA,portal,terminase,capsid,tail,head	Bacillus_phage(76.47%)	86	3978927:3978943	3982707:3982723
WP_089148361.1|3922106_3924872_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	27.1	1.8e-86
WP_001131611.1|3925218_3925725_-	septum site-determining protein DivIVA	NA	NA	NA	NA	NA
WP_002164155.1|3925814_3926582_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_000214233.1|3926597_3926861_-	YggT family protein	NA	NA	NA	NA	NA
WP_000119129.1|3926867_3927338_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_000218005.1|3927357_3928032_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001209016.1|3928028_3928847_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_000236748.1|3928967_3929249_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000197755.1|3929412_3930192_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.9	3.4e-46
WP_000976948.1|3930349_3931069_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	3.3e-19
WP_000261975.1|3931088_3932006_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_000888984.1|3932266_3933421_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_001087556.1|3933460_3934768_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_001065790.1|3935168_3935939_-	cell division protein DivIB	NA	NA	NA	NA	NA
WP_089148360.1|3936037_3936943_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_001265422.1|3937155_3938250_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_000753519.1|3938346_3939438_-	stage V sporulation protein E	NA	NA	NA	NA	NA
WP_000860130.1|3939528_3940881_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000893057.1|3940881_3941856_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_089148359.1|3941878_3943354_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_001266234.1|3943538_3945455_-	stage V sporulation protein D	NA	NA	NA	NA	NA
WP_061884859.1|3945536_3947633_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_000182804.1|3947705_3948068_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_000472508.1|3948083_3949016_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_089148358.1|3949384_3951001_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
WP_139032836.1|3951080_3951965_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_000506692.1|3952258_3952732_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_089148356.1|3952765_3953272_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	33.9	5.1e-11
WP_001984764.1|3953401_3953575_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_000872149.1|3953636_3954137_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_089148355.1|3954236_3954515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002178874.1|3954423_3955041_-	hypothetical protein	NA	Q2LIA9	Bacillus_phage	88.6	3.2e-100
WP_089148404.1|3954982_3956164_-	cell division protein FtsK	NA	A0A288WGQ0	Bacillus_phage	89.8	5.8e-207
WP_061132202.1|3956281_3956464_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	7.9e-23
WP_089148354.1|3956466_3956769_-	hypothetical protein	NA	A0A288WG38	Bacillus_phage	87.9	1.5e-45
WP_089148353.1|3956952_3957174_+	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	90.4	3.8e-27
WP_089148352.1|3957166_3957658_+	hypothetical protein	NA	Q3HL01	Bacillus_phage	88.3	1.5e-71
WP_089148351.1|3957864_3958362_+	protein phosphatase 2C	NA	NA	NA	NA	NA
WP_089148350.1|3958465_3959284_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	97.8	4.4e-161
WP_000159647.1|3959283_3959490_-	hypothetical protein	NA	D2XR32	Bacillus_phage	94.1	1.8e-31
WP_089148349.1|3959492_3959774_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	97.8	1.0e-40
WP_139032789.1|3959788_3960748_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLC8	Bacillus_phage	96.2	8.7e-177
WP_089148347.1|3960900_3961350_-	hypothetical protein	NA	A0A2H4J6F8	uncultured_Caudovirales_phage	97.3	2.3e-79
WP_089148346.1|3961372_3965443_-	hypothetical protein	NA	A0A0S2GLH1	Bacillus_phage	72.8	0.0e+00
WP_089148345.1|3965439_3966915_-|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	80.2	2.5e-239
WP_089148344.1|3966956_3969896_-	hypothetical protein	NA	A0A1B1P764	Bacillus_phage	84.1	6.0e-152
WP_089148343.1|3970114_3971578_-	hypothetical protein	NA	D2XR25	Bacillus_phage	94.8	5.2e-205
WP_000415940.1|3971810_3972155_-	hypothetical protein	NA	D2XR24	Bacillus_phage	98.2	3.4e-59
WP_089148342.1|3972161_3972758_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	97.0	6.9e-108
WP_000172094.1|3972758_3973091_-	hypothetical protein	NA	D2XR22	Bacillus_phage	90.0	2.0e-48
WP_089148341.1|3973087_3973432_-	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	94.6	2.4e-52
WP_089148340.1|3973433_3973787_-|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	96.6	1.7e-58
WP_089148339.1|3973788_3974082_-	hypothetical protein	NA	D2XR19	Bacillus_phage	88.7	2.2e-43
WP_000234859.1|3974094_3975258_-|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	95.1	2.6e-207
WP_089148338.1|3975277_3976054_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	2.5e-57
WP_089148403.1|3976037_3977144_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.9	9.0e-186
WP_089148337.1|3977209_3978868_-|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.2	2.3e-257
WP_000124846.1|3978864_3979200_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	3.0e-07
3978927:3978943	attL	CTTCTAATCCAAGTGCA	NA	NA	NA	NA
WP_089148336.1|3979352_3979688_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	95.5	4.5e-56
WP_000964490.1|3979680_3979911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089148335.1|3979915_3980254_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	67.3	3.2e-17
WP_089148334.1|3980389_3980602_-	hypothetical protein	NA	H0USV9	Bacillus_phage	94.3	8.6e-29
WP_089148333.1|3980588_3980918_-	hypothetical protein	NA	A0A0S2MVB8	Bacillus_phage	70.6	5.3e-33
WP_089148331.1|3981326_3981917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001012146.1|3982129_3982672_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	2.9e-89
WP_060851588.1|3982671_3983154_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	8.5e-72
3982707:3982723	attR	CTTCTAATCCAAGTGCA	NA	NA	NA	NA
WP_078187667.1|3983463_3983586_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_089148330.1|3983597_3983948_-	hypothetical protein	NA	A0A218KDG0	Bacillus_phage	50.4	1.5e-25
WP_000266071.1|3983976_3984258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046945205.1|3984390_3984618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089148329.1|3984895_3985345_-	adenine methyltransferase	NA	S5MUL8	Brevibacillus_phage	73.2	1.0e-66
WP_089148328.1|3985379_3985691_-	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	94.2	3.6e-47
WP_089148327.1|3986212_3986632_+	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	92.9	1.3e-60
WP_089148326.1|3986864_3987320_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	47.4	1.6e-19
WP_089148325.1|3987335_3987761_-	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	40.4	5.4e-14
WP_089148324.1|3987773_3988028_-	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	92.9	4.2e-38
WP_000805174.1|3988042_3988216_-	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	100.0	1.2e-25
WP_089148323.1|3988241_3988436_-	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	82.8	2.9e-23
WP_089148322.1|3988450_3989254_-	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	98.5	9.6e-145
WP_089148321.1|3989222_3990095_-	DnaD domain protein	NA	W8CYG5	Bacillus_phage	44.4	8.2e-57
WP_089148320.1|3990091_3990277_-	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	72.4	9.2e-19
WP_000284332.1|3990526_3990727_-	helix-turn-helix domain-containing protein	NA	A0A0U4IIS1	Bacillus_phage	48.0	3.9e-07
WP_089148319.1|3990763_3991006_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000153812.1|3991224_3991593_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	39.6	4.1e-10
WP_089148318.1|3992018_3993116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091277.1|3993552_3993897_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	36.6	4.7e-16
>prophage 11
NZ_CP040782	Bacillus thuringiensis strain HM-311 chromosome, complete genome	5489489	5105707	5177427	5489489	protease,holin,portal,terminase,capsid,tail,head	Bacillus_phage(37.25%)	79	NA	NA
WP_001267308.1|5105707_5106088_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000394732.1|5106203_5106653_-	DUF4275 family protein	NA	NA	NA	NA	NA
WP_089148676.1|5106713_5109590_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
WP_061884745.1|5109595_5111572_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_033690032.1|5111722_5112154_-	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_000025199.1|5112198_5112819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260359.1|5112815_5113577_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089148675.1|5113676_5113907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538364.1|5114063_5114261_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000438406.1|5114596_5115619_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_001099987.1|5115770_5116664_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	2.5e-08
WP_001219187.1|5116715_5117084_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089148674.1|5117088_5117634_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_061884750.1|5117899_5119534_+	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	36.6	3.5e-77
WP_000637523.1|5119636_5119948_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000944620.1|5120013_5121729_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.4	4.1e-60
WP_000388611.1|5122039_5123224_-	membrane protein	NA	NA	NA	NA	NA
WP_002005957.1|5123333_5124818_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	27.2	5.5e-21
WP_000645027.1|5124888_5125782_-	cell division ABC transporter permease FtsX	NA	NA	NA	NA	NA
WP_000594321.1|5125771_5126458_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.9	3.1e-27
WP_086408265.1|5126552_5126798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000727971.1|5126742_5127066_-	cytochrome c-551	NA	NA	NA	NA	NA
WP_096001716.1|5127506_5128605_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_000579370.1|5128749_5131257_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_000671186.1|5131529_5132072_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003303412.1|5132394_5132592_-	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	69.4	4.4e-19
WP_089148673.1|5132718_5133423_-	ComF family protein	NA	NA	NA	NA	NA
WP_089148671.1|5134592_5135426_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	83.3	5.7e-124
WP_089148670.1|5135556_5135865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089148669.1|5136691_5137189_+	hypothetical protein	NA	A0A1B2APY6	Phage_Wrath	88.5	3.4e-76
WP_033690498.1|5137368_5137608_-	DNA-binding protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	97.5	2.6e-34
WP_089148668.1|5138158_5139091_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	83.9	9.7e-157
WP_000373879.1|5139090_5139516_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	99.3	2.8e-71
WP_089148727.1|5139629_5139905_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A1B1P7E8	Bacillus_phage	81.2	2.3e-34
WP_089148667.1|5139922_5144800_-	hypothetical protein	NA	A0A2H4JF18	uncultured_Caudovirales_phage	46.2	0.0e+00
WP_089148666.1|5144796_5146278_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	79.7	1.0e-240
WP_089148665.1|5146318_5149939_-	DUF2207 domain-containing protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	85.1	4.6e-186
WP_089148664.1|5150169_5150532_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	85.0	2.3e-53
WP_089148663.1|5150536_5151133_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	97.5	9.7e-110
WP_089148662.1|5151133_5151463_-	hypothetical protein	NA	D2XR22	Bacillus_phage	94.5	7.8e-53
WP_089148726.1|5151459_5151804_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	79.8	2.3e-47
WP_089148661.1|5151805_5152150_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_089148660.1|5152136_5152430_-	hypothetical protein	NA	A0A0S2SXS0	Bacillus_phage	57.3	4.4e-23
WP_089148659.1|5152422_5152602_-	hypothetical protein	NA	A0A0S2SXV2	Bacillus_phage	66.1	4.3e-13
WP_089148658.1|5152619_5153792_-|capsid	phage major capsid protein	capsid	A0A0S2SXJ6	Bacillus_phage	80.0	1.6e-156
WP_089148657.1|5153784_5154357_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0S2SXJ4	Bacillus_phage	70.0	3.5e-72
WP_089148656.1|5154349_5155519_-|portal	phage portal protein	portal	A0A1S5SFK2	Streptococcus_phage	58.1	7.2e-133
WP_089148655.1|5155541_5157260_-|terminase	terminase large subunit	terminase	A0A0S2SXJ7	Bacillus_phage	86.5	2.0e-301
WP_089148654.1|5157256_5157643_-|terminase	P27 family phage terminase small subunit	terminase	A0A0S2SXN4	Bacillus_phage	87.8	3.4e-55
WP_089148653.1|5157729_5157987_-	hypothetical protein	NA	A0A1B1P7D2	Bacillus_phage	49.3	1.7e-10
WP_089148652.1|5157970_5158270_-	HNH endonuclease	NA	A0A0S2SXR6	Bacillus_phage	65.1	4.6e-28
WP_089148651.1|5158283_5158556_-	hydrolase	NA	NA	NA	NA	NA
WP_016716807.1|5158757_5158961_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016716806.1|5159056_5159587_+	pilus biosynthesis protein HicB	NA	A0A090DBV2	Clostridium_phage	51.1	7.5e-29
WP_089148650.1|5159659_5159872_-	hypothetical protein	NA	A0A2H4J825	uncultured_Caudovirales_phage	72.9	5.8e-25
WP_089148649.1|5160050_5160446_-	hypothetical protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	86.3	2.8e-57
WP_089148648.1|5160547_5161732_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.9	1.6e-34
WP_089148647.1|5161755_5162562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016716801.1|5162664_5162865_-	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	53.0	6.9e-12
WP_089148646.1|5162947_5163385_-	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	85.5	3.5e-64
WP_089148645.1|5163418_5163958_-	nuclease	NA	A0A2H4J819	uncultured_Caudovirales_phage	91.6	9.1e-91
WP_089148644.1|5163958_5164393_-	hypothetical protein	NA	A0A2H4J832	uncultured_Caudovirales_phage	93.8	4.8e-74
WP_089148643.1|5164689_5167074_-	DNA primase	NA	A0A2H4JEX8	uncultured_Caudovirales_phage	94.7	0.0e+00
WP_089148642.1|5167143_5167578_-	DUF669 domain-containing protein	NA	A0A0S2SXX0	Bacillus_phage	71.5	9.4e-54
WP_089148641.1|5167577_5168507_-	AAA family ATPase	NA	A0A0S2SY47	Bacillus_phage	51.0	5.1e-89
WP_089148640.1|5168509_5169058_-	hypothetical protein	NA	A0A2H4JFP8	uncultured_Caudovirales_phage	76.4	6.0e-74
WP_089148639.1|5169035_5169320_-	hypothetical protein	NA	A0A2H4J9A3	uncultured_Caudovirales_phage	93.6	8.8e-45
WP_089148638.1|5169319_5169523_-	hypothetical protein	NA	A0A1B2APY4	Phage_Wrath	94.0	1.0e-26
WP_089148637.1|5169617_5169968_-	hypothetical protein	NA	A0A1B2AQ59	Phage_Wrath	83.6	2.5e-49
WP_089148636.1|5169968_5170196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089148635.1|5170383_5170611_-	hypothetical protein	NA	A0A1B1P7N2	Bacillus_phage	97.3	7.8e-36
WP_087994265.1|5170623_5170860_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JE95	uncultured_Caudovirales_phage	93.6	3.4e-34
WP_089148634.1|5171056_5171713_+	helix-turn-helix domain-containing protein	NA	A0A1B1P7L1	Bacillus_phage	93.1	3.8e-115
WP_089148633.1|5171731_5173087_+	recombinase family protein	NA	A0A1B1P7M0	Bacillus_phage	94.5	1.4e-241
WP_089148632.1|5173118_5173520_-	helicase	NA	NA	NA	NA	NA
WP_139032805.1|5173646_5175077_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1V0DZX6	Clostridioides_phage	41.6	9.1e-13
WP_000400857.1|5175225_5175540_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000684725.1|5175712_5176555_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.3	3.6e-17
WP_000926664.1|5176791_5177427_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.6	3.1e-37
>prophage 1
NZ_CP040783	Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence	435240	99244	161997	435240	transposase,protease	Bacillus_phage(50.0%)	56	NA	NA
WP_000762752.1|99244_99643_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	3.1e-51
WP_139032842.1|99709_99919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149166.1|100008_100293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089149165.1|101111_101399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003303969.1|101614_102547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089149164.1|102550_103534_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_089149163.1|103792_107137_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_002006391.1|107154_107628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291941.1|107735_109013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089149162.1|110724_111147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097031.1|111151_112606_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_000572539.1|112640_113381_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_139032843.1|113993_114215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089149161.1|115942_116890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149160.1|116922_118416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149159.1|118431_118881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149158.1|118905_119301_+	DUF4320 family protein	NA	NA	NA	NA	NA
WP_089149157.1|119498_120728_+	cell surface protein	NA	NA	NA	NA	NA
WP_089149156.1|123887_124748_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_000264624.1|125598_127032_+	CpaF family protein	NA	NA	NA	NA	NA
WP_089149155.1|127024_127957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149154.1|127958_128825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956358.1|128866_129070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000879955.1|129136_129340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000879960.1|129412_129619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149153.1|129707_130253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001088462.1|130249_130873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149152.1|131317_131890_-	thiamine biosynthesis protein ThiJ	NA	NA	NA	NA	NA
WP_089149151.1|132638_132824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149150.1|132913_134035_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	5.2e-173
WP_000486797.1|134882_135107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090324.1|135307_135514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139032844.1|135611_135926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149147.1|136928_137822_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_089149146.1|137902_138172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089149145.1|139374_140244_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089149144.1|140335_141523_+	MFS transporter	NA	NA	NA	NA	NA
WP_089149143.1|141928_142609_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	42.6	7.1e-40
WP_089149142.1|143179_143596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149141.1|143662_144013_+	PrgI family protein	NA	NA	NA	NA	NA
WP_089149140.1|144013_144928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149139.1|144930_147042_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_089149138.1|147072_151077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149137.1|151073_153278_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A7KUS1	Bacillus_phage	37.5	2.0e-14
WP_000757467.1|153294_153870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149136.1|154034_154418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149135.1|154414_154714_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_089149134.1|154842_155151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149133.1|155190_155916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342851.1|155966_156212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149132.1|156543_157227_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_089149131.1|157398_157656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089149130.1|157680_158826_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_089149129.1|158865_159348_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_139032845.1|160062_160926_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_089149127.1|161067_161997_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP040783	Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence	435240	180038	185398	435240	transposase,integrase	Bacillus_phage(50.0%)	6	176203:176218	189371:189386
176203:176218	attL	AAACTCAACAAGAAAA	NA	NA	NA	NA
WP_089149113.1|180038_180311_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.8	2.8e-24
WP_000762772.1|181068_181473_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.4	2.4e-51
WP_000920508.1|181476_182565_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q332I1	Clostridium_botulinum_C_phage	69.6	1.0e-141
WP_000843058.1|182985_183264_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A1B1P791	Bacillus_phage	31.1	1.1e-10
WP_000019021.1|183815_184142_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	35.7	5.3e-09
WP_001021538.1|184354_185398_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	22.7	3.8e-08
189371:189386	attR	AAACTCAACAAGAAAA	NA	NA	NA	NA
>prophage 3
NZ_CP040783	Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence	435240	406197	413394	435240		Catovirus(33.33%)	6	NA	NA
WP_089149335.1|406197_407403_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L470	Tupanvirus	34.5	1.1e-46
WP_000699379.1|407402_408365_-	NAD-dependent epimerase/dehydratase family protein	NA	M1IGU2	Acanthocystis_turfacea_Chlorella_virus	31.2	3.8e-31
WP_000465151.1|408361_409387_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2P1ELS8	Moumouvirus	33.9	6.5e-37
WP_001124412.1|409830_410598_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.6	9.5e-09
WP_089149336.1|410887_412177_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	30.7	4.8e-05
WP_001071530.1|412602_413394_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	34.3	3.2e-07
>prophage 1
NZ_CP040784	Bacillus thuringiensis strain HM-311 plasmid p2, complete sequence	61297	0	26061	61297	portal,integrase,capsid,tail,terminase	Paenibacillus_phage(53.33%)	24	25403:25416	26171:26184
WP_139032853.1|1497_1695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032854.1|2073_2316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032855.1|2342_3128_-	cell wall hydrolase	NA	A0A0N9SGH1	Paenibacillus_phage	50.0	2.7e-35
WP_095021904.1|3214_3568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032856.1|3602_3806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032857.1|3805_4321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032858.1|4526_10070_-	hypothetical protein	NA	A0A0N9SIL8	Paenibacillus_phage	47.2	1.1e-109
WP_139032859.1|10168_11623_-|tail	phage tail protein	tail	A8ATW0	Listeria_phage	21.1	1.9e-21
WP_139032860.1|11624_14921_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	32.7	3.6e-73
WP_139032861.1|14934_15219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032862.1|15242_15653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032863.1|15770_16331_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	59.3	3.0e-52
WP_139032864.1|16343_16715_-	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	35.8	1.3e-16
WP_139032865.1|16714_17122_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	45.7	9.5e-24
WP_139032866.1|17118_17451_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	53.6	4.5e-24
WP_139032867.1|17450_17855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032868.1|17935_19072_-	DUF5309 family protein	NA	A0A2H4J2M3	uncultured_Caudovirales_phage	59.1	9.8e-111
WP_139032869.1|19181_19841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032870.1|19994_20960_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	40.5	1.5e-51
WP_139032871.1|20963_22592_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	48.9	1.4e-131
WP_139032872.1|22636_23125_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	41.5	1.3e-16
WP_139032873.1|23202_24963_-|terminase	phage terminase large subunit	terminase	A0A2H4J484	uncultured_Caudovirales_phage	58.5	2.1e-192
WP_139032874.1|24976_25396_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	57.0	5.2e-33
25403:25416	attL	GCCCCCTTTCGATA	NA	NA	NA	NA
WP_139032875.1|25512_26061_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	49.5	4.8e-39
WP_139032875.1|25512_26061_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	49.5	4.8e-39
26171:26184	attR	GCCCCCTTTCGATA	NA	NA	NA	NA
>prophage 2
NZ_CP040784	Bacillus thuringiensis strain HM-311 plasmid p2, complete sequence	61297	35847	60963	61297		Paenibacillus_phage(37.5%)	32	NA	NA
WP_139032887.1|35847_36420_-	AAA family ATPase	NA	A0A0N9SJZ0	Paenibacillus_phage	41.9	2.9e-26
WP_139032888.1|36687_37428_-	hypothetical protein	NA	A0A0A0RMW1	Bacillus_phage	40.7	1.3e-10
WP_139032917.1|37472_38264_-	thymidine kinase	NA	A0A0K1Y4R8	Klebsiella_phage	45.5	3.4e-33
WP_139032889.1|38767_39070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032890.1|39126_39495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032891.1|39940_40288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098559887.1|40450_40843_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_139032892.1|40835_41153_-	hypothetical protein	NA	A0A1I9SAE6	Rhodococcus_phage	45.9	3.3e-08
WP_139032893.1|41365_42565_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_139032894.1|42599_43244_-	deoxynucleoside kinase	NA	S5M586	Bacillus_phage	34.1	5.0e-27
WP_139032895.1|43240_43762_-	crossover junction endodeoxyribonuclease RuvC	NA	S6CQM9	Streptococcus_phage	37.3	1.2e-15
WP_139032896.1|43743_44859_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	46.0	3.8e-59
WP_139032897.1|45453_46242_-	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	39.5	7.7e-38
WP_098559835.1|46241_46430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032898.1|46426_46729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032899.1|46795_47869_-	hypothetical protein	NA	A0A0N9RTM8	Paenibacillus_phage	55.8	1.4e-106
WP_139032900.1|47933_48284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032901.1|49234_51013_-	DNA polymerase I	NA	A0A0N9S7Z3	Paenibacillus_phage	52.9	7.8e-163
WP_139032902.1|51175_51910_-	hypothetical protein	NA	S4U6E6	Listeria_phage	29.3	1.8e-12
WP_139032903.1|52004_52541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032904.1|52537_53161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032905.1|53993_54401_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_139032906.1|54412_54835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139032907.1|54853_55828_-	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	41.5	9.2e-49
WP_139032908.1|55843_57202_-	hypothetical protein	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	43.5	3.7e-96
WP_139032909.1|57364_57604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032910.1|57578_58349_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	53.5	1.9e-65
WP_139032911.1|58362_58752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032918.1|58914_59190_-	helix-turn-helix domain-containing protein	NA	A0A142F1P0	Bacillus_phage	46.7	1.4e-15
WP_139032912.1|59375_59627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032913.1|59638_59920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139032914.1|59934_60963_-	ParM/StbA family protein	NA	A0A068EQ96	Bacillus_phage	27.9	3.7e-08
