The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	0	3216	4487548		Bacillus_phage(50.0%)	4	NA	NA
WP_079794689.1|111_897_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_038391818.1|984_1995_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.4	1.4e-07
WP_079794688.1|2002_2614_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000022514.1|2694_3216_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 2
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	7232	13789	4487548	tRNA	Escherichia_coli_phage(33.33%)	7	NA	NA
WP_000639244.1|7232_8051_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	79.5	2.6e-57
WP_000252974.1|8102_8498_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_038391836.1|8537_9281_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.4	3.5e-24
WP_038391839.1|9277_10249_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_079772768.1|10484_11231_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_079774077.1|11249_11819_-	VOC family protein	NA	NA	NA	NA	NA
WP_079794360.1|12055_13789_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	9.8e-86
>prophage 3
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	23393	27539	4487548		Bacillus_thuringiensis_phage(66.67%)	4	NA	NA
WP_000763861.1|23393_23783_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	2.2e-06
WP_079772776.1|23800_24850_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_079794354.1|24846_25713_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_079794353.1|25877_27539_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.3	2.5e-14
>prophage 4
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	42590	43256	4487548		Sphingomonas_phage(100.0%)	1	NA	NA
WP_079772783.1|42590_43256_-	YecA family protein	NA	H9NBT7	Sphingomonas_phage	65.5	8.5e-06
>prophage 5
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	51729	52482	4487548		Bacillus_virus(100.0%)	1	NA	NA
WP_001272978.1|51729_52482_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.5	4.2e-25
>prophage 6
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	78936	87971	4487548		Burkholderia_phage(40.0%)	9	NA	NA
WP_020844594.1|78936_80643_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.9	1.2e-19
WP_020844596.1|80819_81005_-	YodC family protein	NA	NA	NA	NA	NA
WP_141025565.1|81082_82000_-	DUF808 family protein	NA	NA	NA	NA	NA
WP_020844599.1|82168_83089_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785979.1|83077_83548_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	2.4e-31
WP_079794343.1|83528_84959_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.4	9.5e-103
WP_079794342.1|85031_85727_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.7	5.2e-06
WP_000107442.1|85864_86131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079794341.1|86777_87971_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.4	5.1e-110
>prophage 7
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	95992	96580	4487548	integrase	Salmonella_phage(100.0%)	1	86740:86754	96812:96826
86740:86754	attL	ACATATTCATATAAA	NA	NA	NA	NA
WP_079794327.1|95992_96580_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	I6R0M2	Salmonella_phage	32.0	1.4e-23
WP_079794327.1|95992_96580_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	I6R0M2	Salmonella_phage	32.0	1.4e-23
96812:96826	attR	ACATATTCATATAAA	NA	NA	NA	NA
>prophage 8
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	109561	110824	4487548	integrase	Enterobacteria_phage(100.0%)	1	95815:95874	121896:122073
95815:95874	attL	TCCAGTCAGAGGAGCCAAATTCCTGTTTCTATGCGTCTCAGAATGTCTCAATAGTGTTTT	NA	NA	NA	NA
WP_079794337.1|109561_110824_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	36.1	2.2e-66
WP_079794337.1|109561_110824_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	36.1	2.2e-66
121896:122073	attR	TCCAGTCAGAGGAGCCAAATTCCTGTTTCTATGCGTCTCAGAATGTCTCAATAGTGTTTTGATTCAGAGAGTTAGCGTAGAAACTTGTCTCAGCGGATATTGATTTATCTCTCCGCATCAGGACAAATTGGTGGTCTGATTTAGGGTCATTTCAGTTCGATAATGGCGTGACCACCAC	NA	NA	NA	NA
>prophage 9
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	115612	122661	4487548	integrase	Salmonella_phage(50.0%)	7	109313:109372	136864:136947
109313:109372	attL	CACACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTG	NA	NA	NA	NA
WP_079794332.1|115612_115762_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	84.2	3.6e-13
WP_079794331.1|116516_116912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079794330.1|116918_117758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079794361.1|118147_118327_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	73.6	5.6e-13
WP_079794329.1|118995_119862_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_079794328.1|119931_121431_-	hypothetical protein	NA	Q858T2	Yersinia_virus	27.3	7.3e-05
WP_079794327.1|122073_122661_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	I6R0M2	Salmonella_phage	32.0	1.4e-23
136864:136947	attR	CACACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCA	NA	NA	NA	NA
>prophage 10
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	140748	148171	4487548		Escherichia_phage(50.0%)	5	NA	NA
WP_079773670.1|140748_141921_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	88.2	5.1e-203
WP_001092543.1|142043_142808_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_020844640.1|142804_143383_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	37.6	1.9e-22
WP_079794754.1|143397_145674_-	thiosulfate reductase PhsA	NA	A0A077SK27	Escherichia_phage	27.1	3.8e-37
WP_141025588.1|147304_148171_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	51.6	3.4e-71
>prophage 11
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	155039	155939	4487548		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000886598.1|155039_155939_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	100.0	1.7e-12
>prophage 12
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	163397	170738	4487548	transposase	Paramecium_bursaria_Chlorella_virus(16.67%)	6	NA	NA
WP_079794749.1|163397_164564_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	4.8e-113
WP_171920735.1|164863_165322_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_079771868.1|165510_166917_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.2e-36
WP_171920736.1|167084_168455_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.0	2.9e-32
WP_079793772.1|168517_169948_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.5	1.1e-55
WP_079793773.1|169949_170738_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.5	4.7e-11
>prophage 13
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	175376	182874	4487548		Enterobacteria_phage(40.0%)	7	NA	NA
WP_079793778.1|175376_176480_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.1	2.0e-44
WP_079793779.1|176476_177673_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_079793780.1|177674_178073_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_079793781.1|178069_178945_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	9.2e-109
WP_079793782.1|178946_180020_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.4e-103
WP_079793783.1|180400_181294_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	6.2e-44
WP_079793784.1|181470_182874_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.5	1.3e-19
>prophage 14
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	188472	195177	4487548		Bacillus_phage(25.0%)	6	NA	NA
WP_171920737.1|188472_189843_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	2.2e-32
WP_079793789.1|189952_191395_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.7	1.4e-48
WP_079793790.1|191391_192615_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_079793791.1|192611_193085_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000744694.1|193087_194053_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	50.9	2.9e-87
WP_000048168.1|194055_195177_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.8	2.4e-133
>prophage 15
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	200356	209644	4487548		Streptococcus_phage(25.0%)	7	NA	NA
WP_000137241.1|200356_202513_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	31.7	8.3e-18
WP_020844685.1|202509_202959_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978072.1|202964_204104_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_079793794.1|204767_206348_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.6e-39
WP_038392094.1|206435_208292_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234781.1|208330_208912_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	2.1e-32
WP_000132082.1|209002_209644_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
>prophage 16
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	213935	215288	4487548		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_079793797.1|213935_215288_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.3	9.2e-07
>prophage 17
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	224569	228205	4487548	tRNA	Bacillus_phage(66.67%)	3	NA	NA
WP_079793801.1|224569_225973_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.7	3.6e-30
WP_000137858.1|225969_226692_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	1.7e-31
WP_000476042.1|226843_228205_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	95.9	9.4e-209
>prophage 18
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	243993	252582	4487548	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_079793808.1|243993_246027_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.8e-55
WP_079793809.1|246293_246752_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	70.6	4.2e-52
WP_079793810.1|246890_247361_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	91.0	4.2e-76
WP_079793811.1|247407_248127_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272843.1|248123_249809_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	89.3	4.6e-274
WP_001240383.1|250031_250772_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	88.1	1.3e-100
WP_001234243.1|250831_250939_+	protein YohO	NA	NA	NA	NA	NA
WP_079771908.1|250919_251651_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020844710.1|251634_252582_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.5	6.2e-10
>prophage 19
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	278613	280134	4487548		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000535909.1|278613_280134_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
>prophage 20
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	283888	284557	4487548		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139606.1|283888_284557_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	2.6e-55
>prophage 21
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	289994	291986	4487548		Acinetobacter_phage(100.0%)	1	NA	NA
WP_079793822.1|289994_291986_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	31.2	4.4e-13
>prophage 22
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	296104	296962	4487548		Catovirus(100.0%)	1	NA	NA
WP_038392179.1|296104_296962_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.5	6.9e-24
>prophage 23
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	308728	309301	4487548		Clostridioides_phage(100.0%)	1	NA	NA
WP_000241016.1|308728_309301_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	6.2e-13
>prophage 24
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	315230	322949	4487548		Vibrio_phage(50.0%)	7	NA	NA
WP_000203602.1|315230_316820_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.0	9.5e-19
WP_001094639.1|316823_317168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213350.1|317557_318748_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.4	1.2e-18
WP_020844752.1|318775_319471_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578105.1|319622_321383_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	3.8e-101
WP_000494190.1|321507_321792_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050810.1|321941_322949_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.0	1.0e-82
>prophage 25
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	333794	334415	4487548		Pithovirus(100.0%)	1	NA	NA
WP_171920740.1|333794_334415_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	W5SAS9	Pithovirus	28.6	2.2e-11
>prophage 26
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	341501	348709	4487548		uncultured_Caudovirales_phage(25.0%)	6	NA	NA
WP_015702934.1|341501_342749_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.5	4.1e-78
WP_079794048.1|342890_344534_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.2	3.4e-11
WP_079794047.1|344609_345260_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_079794046.1|345262_346324_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	60.5	3.7e-19
WP_000426098.1|346404_347457_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_038392206.1|347572_348709_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.6	3.9e-115
>prophage 27
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	352862	366903	4487548		Pseudomonas_phage(33.33%)	9	NA	NA
WP_020844780.1|352862_355709_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.2	2.7e-40
WP_020844781.1|355826_358463_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.6	6.9e-91
WP_079794045.1|358609_359338_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_001076505.1|359694_361980_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	1.0e-284
WP_000332021.1|362098_363229_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	9.6e-175
WP_000533924.1|363228_363483_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	71.6	1.5e-24
WP_000660254.1|363486_364677_-	MFS transporter	NA	NA	NA	NA	NA
WP_000176715.1|364838_365717_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079774501.1|365832_366903_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 28
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	372832	373783	4487548	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_020844789.1|372832_373783_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.9	5.6e-67
>prophage 29
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	377438	381543	4487548		Tupanvirus(66.67%)	3	NA	NA
WP_079794040.1|377438_378578_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	2.5e-29
WP_079794039.1|378580_379564_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	4.5e-35
WP_079794038.1|379560_381543_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.4	1.8e-22
>prophage 30
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	394110	395115	4487548		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000368550.1|394110_395115_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.5	2.7e-27
>prophage 31
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	414092	414692	4487548		Salmonella_phage(100.0%)	1	NA	NA
WP_000813870.1|414092_414692_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	5.3e-07
>prophage 32
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	428224	429244	4487548		Enterobacteria_phage(100.0%)	1	NA	NA
WP_079794026.1|428224_429244_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	1.1e-20
>prophage 33
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	432985	433759	4487548		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_024143350.1|432985_433759_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.6	1.0e-10
>prophage 34
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	438455	439973	4487548		Mollivirus(100.0%)	1	NA	NA
WP_079794019.1|438455_439973_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	6.3e-89
>prophage 35
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	446402	447539	4487548		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_079794016.1|446402_447539_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.5	1.0e-19
>prophage 36
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	456949	458035	4487548		Pandoravirus(100.0%)	1	NA	NA
WP_079774518.1|456949_458035_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	2.7e-89
>prophage 37
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	467212	468154	4487548		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000377762.1|467212_468154_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	89.1	4.4e-149
>prophage 38
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	482703	483624	4487548		Morganella_phage(100.0%)	1	NA	NA
WP_038392257.1|482703_483624_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.9	1.1e-75
>prophage 39
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	508044	517896	4487548		Lactobacillus_phage(25.0%)	9	NA	NA
WP_079794813.1|508044_508971_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	2.0e-08
WP_079794812.1|509060_510059_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_001519708.1|510055_510274_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_171920743.1|510275_512291_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.8	7.5e-146
WP_079794563.1|512362_513349_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_079794562.1|513578_514343_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_038392274.1|514506_515478_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.3	8.2e-74
WP_000487600.1|515861_516119_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623111.1|516168_517896_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
>prophage 40
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	521909	531402	4487548		Streptococcus_phage(20.0%)	11	NA	NA
WP_079794559.1|521909_522821_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.9	1.9e-56
WP_079794558.1|522871_523966_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.5	3.4e-28
WP_000763710.1|523955_524831_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_079773023.1|524830_525664_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_079794557.1|525663_526680_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517456.1|526839_527631_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.8	1.7e-16
WP_020844888.1|527829_528729_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	33.6	1.7e-25
WP_079794556.1|528822_529398_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_079794555.1|529458_529908_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406009.1|529894_530320_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102884.1|530532_531402_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	3.7e-17
>prophage 41
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	557192	559061	4487548		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_079794547.1|557192_559061_-	hypothetical protein	NA	A0A2H4J6N0	uncultured_Caudovirales_phage	27.9	3.3e-23
>prophage 42
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	572685	573399	4487548		Cyanophage(100.0%)	1	NA	NA
WP_001171631.1|572685_573399_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.6e-37
>prophage 43
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	576751	577891	4487548		Streptococcus_phage(100.0%)	1	NA	NA
WP_079794540.1|576751_577891_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	36.8	5.3e-40
>prophage 44
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	583471	588743	4487548		uncultured_Caudovirales_phage(25.0%)	6	NA	NA
WP_000185575.1|583471_583831_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	1.1e-18
WP_001192385.1|583857_584583_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000198340.1|584653_585943_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.6	5.1e-63
WP_000706207.1|586031_586658_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_079774559.1|587067_588105_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.1	5.9e-70
WP_079773053.1|588104_588743_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	5.6e-31
>prophage 45
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	595206	601690	4487548		Escherichia_phage(60.0%)	6	NA	NA
WP_000075922.1|595206_595398_+	YfgG family protein	NA	G9L6F2	Escherichia_phage	88.9	8.9e-25
WP_079794454.1|595647_596163_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	83.0	2.7e-47
WP_020844916.1|596178_596718_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	77.1	1.7e-20
WP_000131515.1|597042_598620_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_079794453.1|598689_600156_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	9.8e-87
WP_079794452.1|600316_601690_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	36.7	4.0e-42
>prophage 46
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	620845	626094	4487548		Escherichia_phage(66.67%)	5	NA	NA
WP_000963844.1|620845_621277_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	1.8e-17
WP_079794446.1|621397_622261_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_079794445.1|622260_623070_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_079794444.1|623062_623692_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	54.4	9.7e-60
WP_079794443.1|623688_626094_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	38.0	3.3e-140
>prophage 47
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	635594	642036	4487548		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133550.1|635594_636878_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	3.4e-35
WP_000523622.1|636931_637132_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124466.1|637143_637479_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_038392325.1|637480_639331_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.2	3.0e-101
WP_000384426.1|639343_639859_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028952.1|640055_640379_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
WP_000331704.1|640407_640794_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
WP_000775264.1|640821_642036_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
>prophage 48
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	652366	653620	4487548		Aeromonas_phage(100.0%)	1	NA	NA
WP_079794436.1|652366_653620_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	1.3e-100
>prophage 49
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	660830	673257	4487548	tRNA	Bacillus_phage(40.0%)	9	NA	NA
WP_079794433.1|660830_662300_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	1.3e-46
WP_000717694.1|662348_662687_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625587.1|662763_664101_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	36.5	1.0e-10
WP_020844946.1|664097_664862_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_162470501.1|664863_666294_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	27.0	5.7e-15
WP_079794432.1|666942_670830_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.9	2.1e-128
WP_024135092.1|670854_671085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079794431.1|671085_672630_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134571.1|672726_673257_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYZ2	Pandoravirus	27.8	9.8e-05
>prophage 50
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	677209	684118	4487548		Tupanvirus(66.67%)	8	NA	NA
WP_079794429.1|677209_677479_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_000986043.1|677609_677990_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818963.1|677989_678721_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_079773081.1|678732_679461_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_038392343.1|679472_680378_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|680374_681055_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_038392344.1|681327_682302_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790152.1|682318_684118_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.2	1.2e-22
>prophage 51
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	689997	694604	4487548	tRNA	uncultured_Mediterranean_phage(25.0%)	5	NA	NA
WP_079773085.1|689997_691317_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.5	6.0e-43
WP_000627811.1|691446_691830_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_038392351.1|692148_692838_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.1	4.6e-55
WP_000997356.1|692943_693981_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098730.1|694184_694604_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	39.6	3.4e-16
>prophage 52
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	699905	701766	4487548		Burkholderia_virus(50.0%)	2	NA	NA
WP_000268376.1|699905_701207_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	2.9e-42
WP_020844970.1|701310_701766_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	2.5e-33
>prophage 53
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	707676	710250	4487548		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235097.1|707676_710250_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	3.4e-127
>prophage 54
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	719760	722985	4487548		Escherichia_coli_O157_typing_phage(50.0%)	3	NA	NA
WP_079794405.1|719760_720831_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	52.0	1.8e-90
WP_079794406.1|721265_721772_+	YfiR family protein	NA	NA	NA	NA	NA
WP_079794407.1|721764_722985_+	diguanylate cyclase DgcN	NA	A0A127AWB9	Bacillus_phage	32.1	1.7e-12
>prophage 55
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	735490	735973	4487548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_079794424.1|735490_735973_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
>prophage 56
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	749534	751715	4487548		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_079794410.1|749534_751715_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	6.4e-18
>prophage 57
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	766278	770266	4487548		Klosneuvirus(50.0%)	4	NA	NA
WP_079794414.1|766278_767562_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.8	2.3e-31
WP_079778378.1|767674_769075_+	GABA permease	NA	NA	NA	NA	NA
WP_000126158.1|769117_769810_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_015702978.1|769816_770266_-	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
>prophage 58
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	775580	780636	4487548		Bacillus_phage(25.0%)	4	NA	NA
WP_038392382.1|775580_775991_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	38.5	5.6e-16
WP_079794415.1|775963_778108_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.4e-195
WP_038392384.1|778118_779078_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	2.5e-131
WP_020845039.1|779433_780636_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.3	9.3e-27
>prophage 59
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	790845	798231	4487548	tRNA	Bacillus_virus(20.0%)	6	NA	NA
WP_079772694.1|790845_791412_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	G3MA51	Bacillus_virus	26.3	9.2e-09
WP_000906486.1|792673_792859_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_079794419.1|793092_795723_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	4.2e-80
WP_079772692.1|795967_796468_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963140.1|796583_797645_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	4.0e-114
WP_020845048.1|797733_798231_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	5.7e-31
>prophage 60
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	803875	804841	4487548		Tetraselmis_virus(100.0%)	1	NA	NA
WP_079772689.1|803875_804841_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.7e-37
>prophage 61
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	828058	828880	4487548		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000083161.1|828058_828880_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A2R8FG22	Brazilian_cedratvirus	27.0	4.0e-13
>prophage 62
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	861716	868379	4487548		Vibrio_phage(50.0%)	5	NA	NA
WP_079794516.1|861716_863408_-	type III secretion system outer membrane ring protein InvG	NA	R9TEZ5	Vibrio_phage	29.1	1.0e-15
WP_077909628.1|863404_864055_-	AraC family transcriptional regulator InvF	NA	NA	NA	NA	NA
WP_024143391.1|864511_864955_+	invasion lipoprotein InvH	NA	NA	NA	NA	NA
WP_000784517.1|865378_865666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079794517.1|865811_868379_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.5	7.8e-31
>prophage 63
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	874342	884755	4487548		Escherichia_phage(50.0%)	12	NA	NA
WP_001276359.1|874342_874981_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	5.2e-85
WP_079794520.1|874977_876240_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	60.7	8.6e-132
WP_079794538.1|876233_877157_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	75.4	1.2e-114
WP_079794521.1|877349_878114_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.8e-69
WP_079794522.1|878131_878536_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079794523.1|878695_879289_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_079794524.1|879288_880716_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_000562972.1|880726_880963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079794525.1|881008_882001_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_079794526.1|882063_883197_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	6.5e-06
WP_000253541.1|883373_884000_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	4.8e-35
WP_001221542.1|883993_884755_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	7.1e-57
>prophage 64
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	887865	889897	4487548		Tupanvirus(50.0%)	2	NA	NA
WP_000046974.1|887865_888471_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.2	5.9e-30
WP_079794529.1|888457_889897_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.0	6.7e-32
>prophage 65
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	911048	914874	4487548		Vibrio_phage(33.33%)	3	NA	NA
WP_001199954.1|911048_911720_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.1	3.3e-13
WP_000036734.1|911855_913154_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	1.3e-130
WP_000210866.1|913236_914874_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.1	2.1e-154
>prophage 66
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	918296	923592	4487548		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_079793985.1|918296_919592_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.3	2.6e-35
WP_020845123.1|919649_922406_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.8	4.6e-53
WP_038392467.1|922449_923592_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.3	7.2e-45
>prophage 67
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	931016	935948	4487548		Vibrio_phage(100.0%)	4	NA	NA
WP_079793983.1|931016_931865_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	36.9	2.7e-41
WP_079793982.1|932248_932974_-	DNA repair protein	NA	NA	NA	NA	NA
WP_079793981.1|933642_934869_-	secretin	NA	NA	NA	NA	NA
WP_079793980.1|934865_935948_-	hypothetical protein	NA	O88128	Vibrio_phage	28.5	2.0e-12
>prophage 68
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	940379	941525	4487548		Vibrio_phage(100.0%)	1	NA	NA
WP_171920748.1|940379_941525_-	replication initiation factor domain-containing protein	NA	Q64EV8	Vibrio_phage	35.9	9.7e-50
>prophage 69
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	947678	948434	4487548		Bacillus_phage(100.0%)	1	NA	NA
WP_079793973.1|947678_948434_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.2	1.9e-09
>prophage 70
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	951730	968379	4487548	tRNA	environmental_halophage(16.67%)	10	NA	NA
WP_079793972.1|951730_952936_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	35.2	3.1e-70
WP_000184349.1|952935_953379_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_162007804.1|953746_954634_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_079773234.1|954684_955491_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.3	3.6e-14
WP_000678624.1|955601_956699_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000011918.1|957200_958454_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	4.2e-14
WP_000975199.1|958686_960018_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_079793971.1|960120_961956_-	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	24.7	1.1e-18
WP_079793969.1|961952_965498_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	22.2	6.8e-09
WP_079793968.1|965490_968379_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.3	8.7e-63
>prophage 71
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	973856	981012	4487548		Cronobacter_phage(33.33%)	6	NA	NA
WP_000816252.1|973856_974651_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.5	4.0e-119
WP_000204642.1|974657_975533_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957874.1|975949_978196_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.1	1.3e-10
WP_000564482.1|978208_978739_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_020845143.1|979421_980117_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895635.1|980298_981012_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	6.9e-46
>prophage 72
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	991551	994192	4487548		Aichi_virus(50.0%)	2	NA	NA
WP_079793961.1|991551_992970_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.7	1.2e-25
WP_000602481.1|993430_994192_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	6.5e-18
>prophage 73
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1001494	1014093	4487548	tRNA	Escherichia_phage(16.67%)	9	NA	NA
WP_079793960.1|1001494_1004338_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	47.0	5.9e-96
WP_038392507.1|1004412_1005030_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079774387.1|1006332_1007085_-	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	34.6	2.0e-11
WP_020845159.1|1007354_1007900_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003335.1|1007990_1009508_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	6.3e-89
WP_138993403.1|1009517_1010616_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_079793959.1|1010720_1012454_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	6.8e-63
WP_079773249.1|1012459_1013173_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_079793958.1|1013196_1014093_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.3	2.1e-31
>prophage 74
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1018008	1022373	4487548		Pandoravirus(50.0%)	2	NA	NA
WP_079774384.1|1018008_1019442_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.6	3.9e-32
WP_079793957.1|1019499_1022373_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.3	1.7e-260
>prophage 75
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1030744	1031977	4487548		Catovirus(100.0%)	1	NA	NA
WP_020845175.1|1030744_1031977_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.1	1.1e-102
>prophage 76
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1056848	1057556	4487548		Bacillus_virus(100.0%)	1	NA	NA
WP_038392550.1|1056848_1057556_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.7	3.4e-13
>prophage 77
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1070211	1071366	4487548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062146.1|1070211_1071366_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	64.2	5.1e-131
>prophage 78
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1087474	1088560	4487548		Geobacillus_virus(100.0%)	1	NA	NA
WP_000976284.1|1087474_1088560_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	38.1	1.3e-11
>prophage 79
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1094741	1098619	4487548		Ralstonia_phage(50.0%)	2	NA	NA
WP_171920749.1|1094741_1096970_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	2.5e-25
WP_171920805.1|1097104_1098619_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	25.3	2.3e-14
>prophage 80
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1112397	1115151	4487548		Enterobacteria_phage(100.0%)	1	NA	NA
WP_079794708.1|1112397_1115151_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	1.0e-84
>prophage 81
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1127743	1134386	4487548		Ralstonia_phage(100.0%)	4	NA	NA
WP_171920751.1|1127743_1129741_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.6e-23
WP_079794810.1|1129772_1130795_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_171920752.1|1131166_1132276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171920753.1|1132421_1134386_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	1.7e-25
>prophage 82
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1151453	1152926	4487548		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_079793492.1|1151453_1152926_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.1	7.1e-45
>prophage 83
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1172009	1176938	4487548		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
WP_079793486.1|1172009_1173653_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.7	2.8e-10
WP_000439339.1|1173954_1174449_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_000433057.1|1174519_1175035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079793485.1|1175125_1175539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079772996.1|1175525_1175930_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_020845251.1|1176053_1176938_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	48.2	1.5e-66
>prophage 84
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1182894	1193563	4487548		Staphylococcus_phage(20.0%)	8	NA	NA
WP_000013105.1|1182894_1183722_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.5e-63
WP_079793484.1|1183920_1185375_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_079772993.1|1185418_1185880_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	38.2	5.0e-21
WP_001274463.1|1186017_1188189_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	5.8e-104
WP_000010664.1|1188297_1189710_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_038392730.1|1189782_1190520_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_020845262.1|1190782_1193041_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.3	1.7e-85
WP_000731636.1|1193170_1193563_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	49.5	1.6e-20
>prophage 85
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1196878	1198771	4487548		Bacillus_virus(100.0%)	1	NA	NA
WP_020845263.1|1196878_1198771_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.4e-93
>prophage 86
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1203181	1205019	4487548		Erwinia_phage(50.0%)	2	NA	NA
WP_079793482.1|1203181_1203853_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	47.3	9.7e-42
WP_079793481.1|1203858_1205019_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.6	2.8e-89
>prophage 87
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1210701	1214157	4487548		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001077008.1|1210701_1211355_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	42.4	1.9e-42
WP_000566824.1|1211791_1212088_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_079774723.1|1212160_1212370_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_079774724.1|1212723_1214157_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.8	3.3e-39
>prophage 88
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1219383	1220643	4487548		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_079793474.1|1219383_1220643_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.1	1.6e-90
>prophage 89
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1226982	1232495	4487548	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_079793472.1|1226982_1227996_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	3.1e-108
WP_001144069.1|1228233_1228449_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918858.1|1228752_1230498_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	4.7e-72
WP_001519776.1|1230647_1232495_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 90
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1236870	1242110	4487548		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_079793471.1|1236870_1238436_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
WP_038392774.1|1238780_1240301_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	39.1	2.2e-33
WP_079774734.1|1240730_1242110_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	3.2e-31
>prophage 91
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1248309	1249278	4487548		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038392784.1|1248309_1249278_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	7.2e-38
>prophage 92
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1268149	1270444	4487548		Tetraselmis_virus(100.0%)	1	NA	NA
WP_079774744.1|1268149_1270444_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.2e-155
>prophage 93
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1276295	1277441	4487548		Streptococcus_phage(100.0%)	1	NA	NA
WP_079793462.1|1276295_1277441_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.0	5.9e-47
>prophage 94
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1288144	1296049	4487548		Streptococcus_phage(25.0%)	10	NA	NA
WP_000812280.1|1288144_1289008_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.3	5.6e-50
WP_079793458.1|1289072_1291124_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000057286.1|1291081_1291477_+	YraN family protein	NA	NA	NA	NA	NA
WP_000893481.1|1291498_1292089_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.9	7.1e-12
WP_000643279.1|1292098_1292674_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_079793457.1|1292768_1293806_-	permease	NA	NA	NA	NA	NA
WP_079772948.1|1293986_1294622_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_020845341.1|1294752_1295271_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.6	2.0e-10
WP_079772947.1|1295250_1295694_-	YhbP family protein	NA	NA	NA	NA	NA
WP_077915721.1|1295731_1296049_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.8	3.8e-12
>prophage 95
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1301753	1303646	4487548		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_141024817.1|1301753_1303646_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	5.9e-52
>prophage 96
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1309313	1321579	4487548	protease	Cafeteria_roenbergensis_virus(25.0%)	9	NA	NA
WP_000133073.1|1309313_1311995_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.1	7.4e-24
WP_001031043.1|1312019_1313522_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_024135124.1|1313549_1314002_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207651.1|1314632_1315976_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	3.1e-63
WP_079793454.1|1316273_1316615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272680.1|1316808_1317141_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_038392860.1|1317362_1318700_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_079772941.1|1318692_1319541_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.0	2.4e-21
WP_001107481.1|1319644_1321579_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.3	9.2e-117
>prophage 97
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1328301	1329769	4487548		Indivirus(50.0%)	2	NA	NA
WP_001047351.1|1328301_1329273_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	1.0e-07
WP_000444163.1|1329496_1329769_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.7	2.0e-17
>prophage 98
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1333868	1342584	4487548		Bacillus_virus(20.0%)	11	NA	NA
WP_000531681.1|1333868_1334681_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	7.4e-20
WP_079772935.1|1334892_1335870_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_038392880.1|1335883_1336870_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	3.3e-38
WP_020845355.1|1336890_1337457_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.8	3.6e-53
WP_000047849.1|1337453_1338029_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_079772933.1|1337997_1338552_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224104.1|1338558_1339284_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.1e-22
WP_079793451.1|1339331_1340765_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176589.1|1340787_1341075_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_000609333.1|1341192_1341684_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243747.1|1341729_1342584_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
>prophage 99
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1346270	1353929	4487548		Ralstonia_phage(33.33%)	5	NA	NA
WP_079793566.1|1346270_1348706_-	DUF4150 domain-containing protein	NA	A0A077K801	Ralstonia_phage	26.4	7.2e-34
WP_079793449.1|1348964_1349693_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719816.1|1349689_1350343_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_020845366.1|1350569_1352906_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.1	2.3e-37
WP_038392893.1|1352999_1353929_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.2	1.0e-17
>prophage 100
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1365970	1369999	4487548	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_000557490.1|1365970_1367461_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.5	2.7e-07
WP_079793444.1|1367576_1368470_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000382921.1|1368604_1369396_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366116.1|1369501_1369999_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
>prophage 101
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1373969	1375337	4487548	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000716685.1|1373969_1375337_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	5.1e-21
>prophage 102
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1393381	1394425	4487548		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1393381_1394425_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 103
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1406999	1410369	4487548		Ostreococcus_lucimarinus_virus(50.0%)	3	NA	NA
WP_000642606.1|1406999_1407884_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.5	3.4e-26
WP_000620012.1|1407966_1408131_+	DUF2556 family protein	NA	NA	NA	NA	NA
WP_079774968.1|1408278_1410369_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	35.3	6.4e-23
>prophage 104
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1424221	1428541	4487548	tRNA	Pandoravirus(33.33%)	6	NA	NA
WP_001063611.1|1424221_1424794_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.8	9.0e-12
WP_001129706.1|1424786_1425341_-	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_000460661.1|1425367_1425841_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_079794757.1|1425812_1426937_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000114989.1|1427068_1427578_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	8.8e-19
WP_079794758.1|1427593_1428541_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.1	5.8e-08
>prophage 105
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1448438	1454004	4487548		Tupanvirus(33.33%)	7	NA	NA
WP_000031748.1|1448438_1449623_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
WP_000124707.1|1449694_1451803_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.0	3.6e-58
WP_001138042.1|1451900_1452371_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|1452466_1452841_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903365.1|1452966_1453254_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_079794231.1|1453261_1453618_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_020845399.1|1453617_1454004_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	1.5e-18
>prophage 106
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1459967	1470068	4487548		Tupanvirus(25.0%)	10	NA	NA
WP_079771978.1|1459967_1461872_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.5	2.5e-74
WP_000047692.1|1461916_1462228_-	monooxygenase	NA	NA	NA	NA	NA
WP_001214119.1|1462426_1463491_+	hydrolase	NA	NA	NA	NA	NA
WP_000586565.1|1463490_1463709_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	41.8	2.8e-06
WP_001274692.1|1463760_1464630_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148914.1|1464673_1465078_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242758.1|1465383_1466016_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_020845407.1|1466064_1468161_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	88.4	9.4e-67
WP_000190018.1|1468201_1469419_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_079771981.1|1469504_1470068_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.4	8.4e-63
>prophage 107
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1487823	1488660	4487548		Vibrio_phage(100.0%)	1	NA	NA
WP_000742130.1|1487823_1488660_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	3.2e-66
>prophage 108
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1505692	1509497	4487548		Bacillus_phage(66.67%)	3	NA	NA
WP_001265683.1|1505692_1507312_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.9	7.6e-141
WP_024143431.1|1507428_1508781_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.9	1.6e-11
WP_001157751.1|1508777_1509497_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 109
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1516169	1517096	4487548	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_038393032.1|1516169_1517096_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.2e-68
>prophage 110
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1523176	1525570	4487548		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_079794218.1|1523176_1525570_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	4.7e-14
>prophage 111
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1535407	1537855	4487548		Dickeya_phage(100.0%)	1	NA	NA
WP_000993431.1|1535407_1537855_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 112
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1560439	1562247	4487548		Enterococcus_phage(50.0%)	2	NA	NA
WP_038393065.1|1560439_1561180_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	22.1	4.6e-08
WP_079794209.1|1561176_1562247_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	2.6e-20
>prophage 113
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1566033	1567516	4487548		Planktothrix_phage(50.0%)	2	NA	NA
WP_079794208.1|1566033_1566747_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.6	1.2e-13
WP_079794207.1|1566748_1567516_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.2	1.9e-12
>prophage 114
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1574612	1580426	4487548		Klosneuvirus(25.0%)	5	NA	NA
WP_079793860.1|1574612_1575878_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.7e-23
WP_001202408.1|1575996_1577490_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.1	5.4e-16
WP_000159621.1|1577609_1578464_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	7.0e-45
WP_079793861.1|1578709_1579765_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617730.1|1579757_1580426_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	1.5e-13
>prophage 115
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1583474	1589335	4487548		Dickeya_phage(40.0%)	5	NA	NA
WP_000964735.1|1583474_1584101_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	64.6	3.8e-32
WP_079793865.1|1584181_1586389_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	35.9	2.1e-109
WP_079793866.1|1586587_1588231_+	methyl-accepting chemotaxis citrate transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.7	1.6e-13
WP_001541054.1|1588254_1588500_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
WP_000187490.1|1588669_1589335_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	4.3e-58
>prophage 116
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1594663	1597408	4487548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_079793868.1|1594663_1597408_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	7.8e-21
>prophage 117
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1607691	1609734	4487548		Indivirus(100.0%)	1	NA	NA
WP_079772037.1|1607691_1609734_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.0	6.8e-46
>prophage 118
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1653841	1655835	4487548		Bacillus_virus(50.0%)	2	NA	NA
WP_000103557.1|1653841_1654855_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	9.6e-17
WP_001196501.1|1654851_1655835_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 119
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1674419	1680738	4487548		Escherichia_phage(33.33%)	6	NA	NA
WP_079793895.1|1674419_1676753_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.5	1.4e-71
WP_000747611.1|1676906_1677569_+	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_079793896.1|1677776_1678751_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.0	1.1e-17
WP_000190519.1|1678800_1679511_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_000455789.1|1679948_1680239_+	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_000014594.1|1680525_1680738_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 120
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1685253	1686249	4487548		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_020845527.1|1685253_1686249_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.3	4.5e-11
>prophage 121
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1701036	1702884	4487548		Tupanvirus(100.0%)	1	NA	NA
WP_079772085.1|1701036_1702884_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.7	9.0e-13
>prophage 122
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1709242	1710781	4487548		Vibrio_phage(100.0%)	1	NA	NA
WP_038393209.1|1709242_1710781_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	42.7	2.5e-08
>prophage 123
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1724550	1734054	4487548		Rhizobium_phage(20.0%)	9	NA	NA
WP_001273795.1|1724550_1724802_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
WP_001156176.1|1724888_1725320_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_079793909.1|1725567_1727112_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_079774276.1|1727121_1728405_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
WP_001135526.1|1728408_1729371_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000798184.1|1729357_1730392_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000645998.1|1730687_1731713_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	6.1e-19
WP_079793910.1|1731722_1732919_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.7	3.2e-35
WP_000587776.1|1733121_1734054_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	37.8	6.5e-36
>prophage 124
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1749144	1753710	4487548		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_038393229.1|1749144_1749624_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.4	1.5e-28
WP_079793917.1|1749664_1750474_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.6	2.0e-25
WP_001051798.1|1750571_1750739_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003024071.1|1750759_1750996_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_000447198.1|1751212_1751878_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000060542.1|1752053_1753274_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.6	2.5e-43
WP_000976075.1|1753251_1753710_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	4.3e-49
>prophage 125
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1759723	1764748	4487548		Pseudomonas_phage(33.33%)	4	NA	NA
WP_079793919.1|1759723_1761409_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.0	1.4e-23
WP_000046963.1|1761664_1762288_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	3.7e-19
WP_000135058.1|1762342_1762618_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280461.1|1762636_1764748_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 126
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1769139	1770531	4487548		environmental_Halophage(100.0%)	1	NA	NA
WP_038393237.1|1769139_1770531_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.2	1.9e-68
>prophage 127
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1779586	1783229	4487548		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_079793924.1|1779586_1782313_-	magnesium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	23.9	7.2e-35
WP_000392692.1|1782533_1783229_-	MgtC family protein	NA	G3MA03	Bacillus_virus	42.4	2.8e-15
>prophage 128
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1801709	1806852	4487548		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_171920807.1|1801709_1802366_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	61.5	6.2e-17
WP_079773746.1|1802470_1802791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171920766.1|1802796_1806852_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.6	7.7e-25
>prophage 129
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1812478	1817435	4487548		Micromonas_sp._RCC1109_virus(50.0%)	5	NA	NA
WP_079794764.1|1812478_1814167_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.5	7.1e-57
WP_024135144.1|1814274_1814373_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000117642.1|1815005_1815095_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_077915730.1|1815187_1816048_+	EamA family transporter	NA	NA	NA	NA	NA
WP_079773722.1|1816250_1817435_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	5.8e-13
>prophage 130
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1822725	1823676	4487548		Synechococcus_phage(50.0%)	2	NA	NA
WP_001246917.1|1822725_1823154_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	38.2	3.8e-15
WP_015703064.1|1823262_1823676_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	37.0	4.6e-18
>prophage 131
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1832471	1843698	4487548		Pithovirus(25.0%)	8	NA	NA
WP_000888553.1|1832471_1833092_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	W5SAS9	Pithovirus	29.1	1.3e-11
WP_038393265.1|1833097_1834498_-	heme-binding domain-containing protein	NA	NA	NA	NA	NA
WP_079793831.1|1834687_1835320_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_079793832.1|1835312_1837865_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.6	8.2e-73
WP_001230250.1|1837854_1839039_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_079793856.1|1839168_1839861_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.9	7.7e-18
WP_079793833.1|1839833_1840874_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_079793834.1|1840953_1843698_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.4	2.3e-36
>prophage 132
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1848268	1855836	4487548		Bacillus_virus(33.33%)	7	NA	NA
WP_079793839.1|1848268_1850683_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.8e-115
WP_079793840.1|1850711_1851785_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673474.1|1851932_1853033_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
WP_000059091.1|1853037_1854438_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000831330.1|1855098_1855239_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239725.1|1855255_1855615_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|1855578_1855836_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 133
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1862847	1869738	4487548		Moraxella_phage(33.33%)	7	NA	NA
WP_020845639.1|1862847_1864185_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	37.1	1.4e-63
WP_020845640.1|1864353_1865019_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000377780.1|1865113_1865839_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000063118.1|1865853_1866627_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	2.0e-14
WP_000212194.1|1866712_1867603_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741628.1|1867602_1868562_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_038393276.1|1868697_1869738_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	37.1	4.9e-48
>prophage 134
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1875327	1878768	4487548		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_079793857.1|1875327_1877157_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.9	3.6e-131
WP_000933756.1|1877397_1878768_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.1	3.1e-34
>prophage 135
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1890715	1891708	4487548		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_079793850.1|1890715_1891708_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	1.2e-48
>prophage 136
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1895008	1899003	4487548		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_000102335.1|1895008_1896877_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	5.1e-64
WP_000715938.1|1897070_1897490_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000339357.1|1897497_1899003_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.3	3.8e-17
>prophage 137
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1914478	1916125	4487548		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_038393289.1|1914478_1916125_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.7	1.1e-62
>prophage 138
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1925533	1931783	4487548		Vibrio_phage(25.0%)	5	NA	NA
WP_079773589.1|1925533_1926262_+	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	26.4	1.4e-17
WP_001238845.1|1926361_1928386_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	4.9e-113
WP_079794643.1|1928425_1929907_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_020845668.1|1930043_1931309_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.7	4.8e-42
WP_001280776.1|1931453_1931783_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 139
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1935919	1942083	4487548		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866681.1|1935919_1937050_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	5.1e-27
WP_079794642.1|1937046_1938309_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	28.6	1.8e-25
WP_079794641.1|1938308_1939376_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	3.1e-98
WP_038393317.1|1939408_1940290_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	1.0e-107
WP_141025577.1|1940267_1940948_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_079794639.1|1940952_1942083_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	1.5e-18
>prophage 140
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1958523	1962443	4487548		Bacillus_phage(100.0%)	3	NA	NA
WP_020845687.1|1958523_1959426_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	31.0	1.3e-25
WP_001213564.1|1959425_1960142_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_020845689.1|1960280_1962443_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.4	1.7e-116
>prophage 141
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1968052	1969882	4487548		Catovirus(100.0%)	1	NA	NA
WP_079794718.1|1968052_1969882_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	3.4e-81
>prophage 142
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1982664	1986098	4487548		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187564.1|1982664_1984305_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.3	1.0e-39
WP_000508972.1|1984509_1984764_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_038393349.1|1984767_1985316_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_079794725.1|1985318_1986098_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.6	4.5e-22
>prophage 143
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	1994925	1995540	4487548		Streptococcus_phage(100.0%)	1	NA	NA
WP_000378892.1|1994925_1995540_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	31.9	1.1e-18
>prophage 144
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2007734	2010521	4487548		Listeria_phage(100.0%)	1	NA	NA
WP_079794364.1|2007734_2010521_+	DNA polymerase I	NA	A0A060AM05	Listeria_phage	26.3	2.1e-45
>prophage 145
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2015974	2017024	4487548		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_000146198.1|2015974_2017024_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	1.5e-09
>prophage 146
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2029740	2032537	4487548		Staphylococcus_phage(50.0%)	3	NA	NA
WP_079794369.1|2029740_2030637_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	94.6	1.2e-63
WP_079794370.1|2030803_2031700_+	sugar kinase	NA	NA	NA	NA	NA
WP_000059686.1|2031733_2032537_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.4	6.4e-24
>prophage 147
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2038238	2041289	4487548		Escherichia_phage(100.0%)	1	NA	NA
WP_079794374.1|2038238_2041289_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.4	1.6e-06
>prophage 148
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2057388	2060904	4487548		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_000122637.1|2057388_2058009_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	9.3e-63
WP_079773447.1|2058078_2058750_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_020845738.1|2058832_2060206_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	1.1e-15
WP_001033730.1|2060202_2060904_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.9	6.9e-06
>prophage 149
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2074420	2079028	4487548		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_079794385.1|2074420_2075266_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.8	2.6e-15
WP_000051364.1|2075664_2075904_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872917.1|2076125_2076611_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_038393430.1|2076703_2077630_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293333.1|2077696_2079028_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.7	1.7e-45
>prophage 150
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2100203	2100866	4487548		Synechococcus_phage(100.0%)	1	NA	NA
WP_000424873.1|2100203_2100866_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	9.3e-29
>prophage 151
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2116948	2118793	4487548		Acinetobacter_phage(100.0%)	1	NA	NA
WP_079794398.1|2116948_2118793_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.5	1.1e-10
>prophage 152
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2127671	2130764	4487548		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_000023066.1|2127671_2128622_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	1.8e-28
WP_042917175.1|2128829_2129003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031748.1|2129579_2130764_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
>prophage 153
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2134894	2146306	4487548		Chrysochromulina_ericina_virus(33.33%)	6	NA	NA
WP_079794232.1|2134894_2138923_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	1.6e-22
WP_079794233.1|2138999_2143223_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
WP_079794234.1|2143452_2144598_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_079794235.1|2144594_2145365_-	thiazole synthase	NA	NA	NA	NA	NA
WP_038393470.1|2145366_2145567_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_000999782.1|2145550_2146306_-	thiazole biosynthesis adenylyltransferase ThiF	NA	A0A1V0SCZ9	Indivirus	32.3	1.7e-13
>prophage 154
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2151660	2153423	4487548		Klosneuvirus(50.0%)	3	NA	NA
WP_079773704.1|2151660_2152332_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	5.2e-19
WP_000940087.1|2152373_2152964_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044509.1|2153150_2153423_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
>prophage 155
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2158926	2160516	4487548		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_079794237.1|2158926_2160516_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.4	5.8e-69
>prophage 156
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2174668	2178352	4487548		Dickeya_phage(100.0%)	1	NA	NA
WP_079794152.1|2174668_2178352_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 157
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2198901	2200011	4487548		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179170.1|2198901_2200011_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	46.1	1.2e-15
>prophage 158
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2207287	2207896	4487548		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646081.1|2207287_2207896_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 159
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2216111	2218638	4487548		Salmonella_phage(50.0%)	2	NA	NA
WP_000918371.1|2216111_2217527_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.6	3.1e-199
WP_079794143.1|2217558_2218638_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.9	5.2e-29
>prophage 160
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2222732	2226336	4487548		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_079774928.1|2222732_2225558_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
WP_000168315.1|2225805_2226336_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	88.0	8.8e-54
>prophage 161
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2248738	2250805	4487548		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_038393511.1|2248738_2250805_+	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	23.1	2.4e-14
>prophage 162
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2255536	2256886	4487548		Moraxella_phage(100.0%)	1	NA	NA
WP_020845831.1|2255536_2256886_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	8.8e-159
>prophage 163
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2263099	2265058	4487548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_079774891.1|2263099_2265058_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	5.7e-90
>prophage 164
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2268932	2272354	4487548		Escherichia_phage(50.0%)	2	NA	NA
WP_079773547.1|2268932_2271080_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	1.2e-32
WP_000457027.1|2271445_2272354_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	36.0	3.8e-33
>prophage 165
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2275528	2278269	4487548		Burkholderia_virus(50.0%)	3	NA	NA
WP_079773543.1|2275528_2277031_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	30.5	5.9e-55
WP_000844399.1|2277100_2277190_+	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_077909633.1|2277198_2278269_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	24.1	1.0e-08
>prophage 166
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2296192	2296972	4487548		Cedratvirus(100.0%)	1	NA	NA
WP_079794130.1|2296192_2296972_-	heme ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	28.8	8.5e-13
>prophage 167
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2302563	2319644	4487548		Escherichia_phage(80.0%)	7	NA	NA
WP_141025558.1|2302563_2304996_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	81.3	0.0e+00
WP_079794127.1|2305009_2305636_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	91.8	1.9e-119
WP_079773529.1|2305628_2306402_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	78.3	9.7e-102
WP_079773528.1|2306476_2307070_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	71.9	5.5e-81
WP_079773527.1|2307153_2308554_-	DUF1996 domain-containing protein	NA	NA	NA	NA	NA
WP_079773559.1|2308892_2309813_+	YjiK family protein	NA	NA	NA	NA	NA
WP_079794126.1|2310050_2319644_-	Ig-like domain repeat protein	NA	A0A2P0VP35	Tetraselmis_virus	23.7	8.6e-06
>prophage 168
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2332712	2345559	4487548		uncultured_Caudovirales_phage(100.0%)	7	NA	NA
WP_171920809.1|2332712_2334059_-	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.6	1.2e-25
WP_079794797.1|2334206_2334692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171920772.1|2334688_2336263_-	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.7	3.3e-24
WP_079794799.1|2337291_2337693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171920773.1|2337708_2338836_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.2	2.8e-25
WP_171920774.1|2339296_2343427_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.8	1.9e-23
WP_171920775.1|2343477_2345559_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	1.7e-31
>prophage 169
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2354898	2356882	4487548		Cronobacter_phage(50.0%)	2	NA	NA
WP_000027827.1|2354898_2355192_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
WP_000719108.1|2355235_2356882_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	6.9e-190
>prophage 170
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2361976	2362510	4487548		Morganella_phage(100.0%)	1	NA	NA
WP_001238400.1|2361976_2362510_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	53.5	1.8e-46
>prophage 171
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2366238	2367216	4487548		Tupanvirus(100.0%)	1	NA	NA
WP_000004792.1|2366238_2367216_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.5	2.9e-26
>prophage 172
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2374564	2375110	4487548		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_038393565.1|2374564_2375110_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	2.0e-29
>prophage 173
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2379428	2382611	4487548		Vibrio_phage(50.0%)	2	NA	NA
WP_079793502.1|2379428_2380745_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.6e-16
WP_079793503.1|2380754_2382611_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	42.1	1.2e-60
>prophage 174
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2388234	2392664	4487548		Pithovirus(50.0%)	3	NA	NA
WP_000527979.1|2388234_2389533_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.2	2.4e-65
WP_020845904.1|2389756_2390182_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_079793505.1|2390219_2392664_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.4	3.8e-67
>prophage 175
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2396646	2397810	4487548		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943941.1|2396646_2397810_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.0	3.6e-84
>prophage 176
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2433786	2435542	4487548		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000055081.1|2433786_2434317_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	7.2e-56
WP_000853763.1|2434543_2435542_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
>prophage 177
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2448272	2451092	4487548		Cronobacter_phage(50.0%)	2	NA	NA
WP_038393600.1|2448272_2448737_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	56.4	1.2e-51
WP_000187812.1|2448953_2451092_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.3	3.4e-266
>prophage 178
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2454756	2460854	4487548		Enterobacteria_phage(33.33%)	6	NA	NA
WP_079793520.1|2454756_2455704_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.0	3.8e-15
WP_138993443.1|2455848_2455947_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_079793569.1|2456085_2458794_+	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	24.8	4.1e-46
WP_000047540.1|2458953_2459340_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_038393605.1|2459446_2459908_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013035.1|2459918_2460854_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.5	2.2e-52
>prophage 179
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2472877	2477828	4487548	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_000416355.1|2472877_2475733_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	4.6e-141
WP_020845956.1|2475732_2476176_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_079793526.1|2476316_2477828_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
>prophage 180
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2485668	2486688	4487548		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_079793529.1|2485668_2486688_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	29.9	2.7e-43
>prophage 181
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2497140	2498712	4487548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_079793532.1|2497140_2498712_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	2.1e-103
>prophage 182
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2526688	2527642	4487548	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_079793547.1|2526688_2527642_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.9	1.3e-63
>prophage 183
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2533038	2538377	4487548		Acinetobacter_phage(33.33%)	3	NA	NA
WP_079793552.1|2533038_2534508_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	2.5e-34
WP_079793553.1|2534583_2537007_-	DEAD/DEAH box helicase family protein	NA	A0A0K1LLU7	Rhodobacter_phage	23.7	8.8e-08
WP_079793554.1|2537249_2538377_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	26.2	5.0e-14
>prophage 184
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2544002	2545664	4487548		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_079793556.1|2544002_2545664_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 185
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2551409	2552471	4487548		Catovirus(100.0%)	1	NA	NA
WP_079793559.1|2551409_2552471_+	SIS domain-containing protein	NA	A0A1V0SAP4	Catovirus	21.3	4.7e-06
>prophage 186
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2556747	2558027	4487548		Shigella_phage(50.0%)	2	NA	NA
WP_000799926.1|2556747_2557485_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	2.6e-64
WP_079793562.1|2557487_2558027_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	64.5	4.9e-28
>prophage 187
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2564414	2565479	4487548		Bacillus_virus(100.0%)	1	NA	NA
WP_079793565.1|2564414_2565479_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	32.0	1.2e-14
>prophage 188
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2569282	2572181	4487548		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175970.1|2569282_2570872_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.8	3.1e-30
WP_038393733.1|2571273_2571891_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490276.1|2572019_2572181_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.8e-10
>prophage 189
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2577762	2579085	4487548		Geobacillus_virus(100.0%)	1	NA	NA
WP_079793768.1|2577762_2579085_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	2.6e-78
>prophage 190
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2586550	2591729	4487548		Enterococcus_phage(33.33%)	3	NA	NA
WP_079793764.1|2586550_2587798_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	2.0e-85
WP_000046767.1|2587915_2589583_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.9	2.6e-43
WP_141025547.1|2589791_2591729_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	38.8	1.2e-10
>prophage 191
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2594988	2595678	4487548		Bacillus_phage(100.0%)	1	NA	NA
WP_079774202.1|2594988_2595678_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	33.6	7.4e-29
>prophage 192
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2614767	2615721	4487548		Cyanophage(100.0%)	1	NA	NA
WP_020842578.1|2614767_2615721_+	transaldolase	NA	A0A127KMN5	Cyanophage	32.2	4.3e-11
>prophage 193
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2619141	2627555	4487548	holin	Micromonas_pusilla_virus(25.0%)	7	NA	NA
WP_000516126.1|2619141_2621058_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	48.9	5.8e-148
WP_001119010.1|2621143_2622283_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.2	1.3e-25
WP_079793755.1|2622561_2623509_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079774210.1|2623636_2623981_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_020842585.1|2624041_2624575_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	60.1	3.2e-56
WP_079772312.1|2624591_2625035_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_079793754.1|2625425_2627555_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	29.5	2.2e-34
>prophage 194
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2642893	2644387	4487548		Tetraselmis_virus(100.0%)	1	NA	NA
WP_020842600.1|2642893_2644387_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	29.4	2.9e-30
>prophage 195
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2648959	2655700	4487548	tRNA	uncultured_Caudovirales_phage(50.0%)	6	NA	NA
WP_020842602.1|2648959_2650126_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	2.6e-90
WP_079793744.1|2650187_2651093_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_001518655.1|2651302_2651566_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_020842603.1|2651668_2651887_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_038390334.1|2651894_2652833_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_079793743.1|2652865_2655700_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	25.6	6.1e-77
>prophage 196
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2661345	2662494	4487548		Halovirus(100.0%)	1	NA	NA
WP_000597286.1|2661345_2662494_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.7	7.0e-48
>prophage 197
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2668018	2673658	4487548		Hepacivirus(50.0%)	4	NA	NA
WP_079793740.1|2668018_2669572_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	24.6	8.9e-30
WP_001016214.1|2669634_2670852_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_079793739.1|2670963_2672106_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787070.1|2672140_2673658_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	22.2	1.1e-08
>prophage 198
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2681274	2683164	4487548		Catovirus(100.0%)	1	NA	NA
WP_079793734.1|2681274_2683164_+	sulfatase-like hydrolase/transferase	NA	A0A1V0SA98	Catovirus	26.4	1.7e-27
>prophage 199
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2686633	2688057	4487548		Bacillus_phage(50.0%)	2	NA	NA
WP_000624383.1|2686633_2687113_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	1.8e-29
WP_000257214.1|2687208_2688057_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	44.9	8.3e-06
>prophage 200
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2695779	2701232	4487548		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_079793730.1|2695779_2698686_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.4	2.9e-21
WP_079793729.1|2698880_2701232_-	DNA polymerase II	NA	B3GAM5	uncultured_virus	24.5	9.7e-20
>prophage 201
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2708482	2709190	4487548		Bacillus_virus(100.0%)	1	NA	NA
WP_079793728.1|2708482_2709190_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.7	1.4e-22
>prophage 202
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2718281	2719853	4487548		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000082868.1|2718281_2719853_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.9	5.9e-05
>prophage 203
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2751822	2752866	4487548		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_079793718.1|2751822_2752866_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.8	2.0e-102
>prophage 204
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2757123	2757687	4487548		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923238.1|2757123_2757687_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.1	2.2e-10
>prophage 205
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2771966	2773391	4487548		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_020842665.1|2771966_2773391_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	2.4e-42
>prophage 206
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2783240	2789909	4487548		Mamastrovirus(33.33%)	5	NA	NA
WP_079793705.1|2783240_2784851_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	59.8	1.7e-20
WP_079793704.1|2784927_2787318_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_079772471.1|2787523_2788060_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.5	5.1e-17
WP_000651587.1|2788211_2788874_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150623.1|2788982_2789909_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.2	1.5e-21
>prophage 207
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2793170	2794109	4487548	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000443194.1|2793170_2794109_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.8	3.2e-67
>prophage 208
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2805310	2806729	4487548		Bacillus_virus(100.0%)	1	NA	NA
WP_079793697.1|2805310_2806729_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	35.9	9.3e-26
>prophage 209
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2809790	2812220	4487548		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_171920810.1|2809790_2812220_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.0	4.2e-34
>prophage 210
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2817466	2818264	4487548		Planktothrix_phage(100.0%)	1	NA	NA
WP_079772431.1|2817466_2818264_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.0	7.8e-14
>prophage 211
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2824251	2824596	4487548		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001278668.1|2824251_2824596_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
>prophage 212
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2828575	2836506	4487548	protease	uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_000753957.1|2828575_2830003_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	5.5e-26
WP_079772443.1|2830155_2831313_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_079793688.1|2831413_2834377_-	viral enhancin protein	NA	A0A288QW20	Cyclophragma_undans_nucleopolyhedrovirus	25.3	1.5e-46
WP_000272194.1|2834570_2834957_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_079793687.1|2835204_2836506_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.5	7.4e-38
>prophage 213
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2846586	2847345	4487548		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000947407.1|2846586_2847345_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	41.5	1.2e-24
>prophage 214
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2856177	2860280	4487548		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569409.1|2856177_2856774_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.8	3.9e-26
WP_001294811.1|2856797_2860280_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	1.1e-208
>prophage 215
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2874263	2875295	4487548		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593981.1|2874263_2875295_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	41.0	3.6e-35
>prophage 216
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2885023	2889234	4487548		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_000644699.1|2885023_2886391_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	34.2	4.9e-08
WP_038390548.1|2886462_2887218_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_020842727.1|2887252_2887975_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_079794779.1|2887971_2888439_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	5.5e-52
WP_013991365.1|2888502_2889234_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	1.1e-38
>prophage 217
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2897860	2898439	4487548		Caulobacter_phage(100.0%)	1	NA	NA
WP_000284051.1|2897860_2898439_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
>prophage 218
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2901640	2902099	4487548	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000502119.1|2901640_2902099_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 219
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2906665	2912115	4487548		Streptococcus_phage(66.67%)	5	NA	NA
WP_001285272.1|2906665_2907769_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	2.4e-61
WP_079772125.1|2907780_2909031_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	6.8e-97
WP_038390565.1|2909963_2910827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038390566.1|2910859_2911312_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_141025574.1|2911380_2912115_+	type IV pilus major pilin	NA	Q8LTI3	Vibrio_virus	33.7	4.1e-17
>prophage 220
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2935953	2945662	4487548		Streptococcus_phage(33.33%)	6	NA	NA
WP_079794582.1|2935953_2938242_+	gold/copper-translocating P-type ATPase GolT	NA	E4ZFI9	Streptococcus_phage	32.7	3.0e-90
WP_001020591.1|2938253_2938724_+	Au(I) sensor transcriptional regulator GolS	NA	NA	NA	NA	NA
WP_001159472.1|2938813_2939008_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_000288511.1|2939276_2940530_+	MFS transporter	NA	NA	NA	NA	NA
WP_079773928.1|2940721_2942680_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	31.0	1.5e-79
WP_079794581.1|2942692_2945662_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	25.8	2.8e-80
>prophage 221
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2955626	2963724	4487548		Staphylococcus_phage(33.33%)	4	NA	NA
WP_079772149.1|2955626_2957513_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.6	2.4e-53
WP_079794673.1|2957606_2960684_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	80.1	0.0e+00
WP_000532932.1|2961286_2962003_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_141025581.1|2962635_2963724_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	77.2	1.9e-148
>prophage 222
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2979300	2980413	4487548		Bacillus_phage(100.0%)	1	NA	NA
WP_079794678.1|2979300_2980413_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	31.9	6.2e-17
>prophage 223
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	2984102	2994014	4487548		Bacillus_phage(60.0%)	7	NA	NA
WP_038390604.1|2984102_2985014_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.9	4.2e-104
WP_038390605.1|2985139_2986048_+	fructokinase	NA	NA	NA	NA	NA
WP_079794680.1|2986074_2987247_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_079794681.1|2987403_2990544_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.2	1.4e-10
WP_079794685.1|2990540_2991743_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	37.5	9.7e-08
WP_000113942.1|2991957_2992647_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	1.7e-36
WP_079794682.1|2992718_2994014_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.1	2.0e-27
>prophage 224
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3002266	3011090	4487548	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667309.1|3002266_3003394_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	9.5e-90
WP_000007630.1|3003416_3003749_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_071842320.1|3003776_3005624_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046647.1|3005634_3006606_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	1.0e-44
WP_000974819.1|3006699_3007047_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000751945.1|3007123_3007987_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_079794658.1|3008284_3008824_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543533.1|3008974_3009424_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_079794657.1|3009427_3010531_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.9	1.9e-50
WP_001021369.1|3010619_3011090_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.7	1.0e-29
>prophage 225
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3034088	3039131	4487548	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122257.1|3034088_3034712_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130293.1|3034838_3036110_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	4.3e-131
WP_001067726.1|3036295_3038650_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	1.6e-224
WP_001043544.1|3038858_3039131_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
>prophage 226
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3042430	3051786	4487548	transposase	Bacillus_phage(50.0%)	8	NA	NA
WP_079794650.1|3042430_3043126_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	66.7	1.0e-86
WP_079794649.1|3043189_3044890_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020842824.1|3044990_3045809_+	HMP-PP phosphatase	NA	NA	NA	NA	NA
WP_058107792.1|3045996_3046455_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.3e-13
WP_077915647.1|3046572_3047628_-	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_000884583.1|3047740_3048199_+	DNA-binding transcriptional regulator DecR	NA	NA	NA	NA	NA
WP_001235654.1|3048239_3050012_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	2.6e-49
WP_079794803.1|3050004_3051786_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.9e-40
>prophage 227
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3069398	3080231	4487548	transposase	Sodalis_phage(20.0%)	12	NA	NA
WP_079794198.1|3069398_3070322_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.1	6.2e-63
WP_000051160.1|3070391_3070559_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_171920780.1|3070571_3071099_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_079794196.1|3071167_3071545_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_079794195.1|3071697_3072249_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.9	2.7e-29
WP_079794194.1|3072363_3074295_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.1	3.9e-43
WP_000467098.1|3074340_3074670_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195018.1|3074669_3075275_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_141025560.1|3075384_3077259_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.6	3.0e-117
WP_001220230.1|3077479_3078124_+	adenylate kinase	NA	NA	NA	NA	NA
WP_079794192.1|3078300_3079263_+	ferrochelatase	NA	NA	NA	NA	NA
WP_079794206.1|3079259_3080231_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.4	8.6e-15
>prophage 228
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3088440	3093675	4487548		uncultured_virus(50.0%)	5	NA	NA
WP_079794205.1|3088440_3090942_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.9	1.8e-112
WP_038390646.1|3091067_3091484_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_079794190.1|3091484_3091937_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000906147.1|3091933_3092851_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_079772204.1|3092997_3093675_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.2	7.8e-23
>prophage 229
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3096962	3097649	4487548		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110588.1|3096962_3097649_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	3.8e-33
>prophage 230
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3104868	3111014	4487548	tRNA	Moumouvirus(33.33%)	5	NA	NA
WP_000912380.1|3104868_3106254_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.5e-44
WP_000190296.1|3106363_3106576_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_038390666.1|3106577_3107444_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	5.5e-29
WP_079794185.1|3108619_3109474_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_079794184.1|3109688_3111014_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.0	1.8e-103
>prophage 231
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3134862	3140981	4487548		Tupanvirus(50.0%)	3	NA	NA
WP_079794177.1|3134862_3138747_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	28.3	2.9e-61
WP_000096777.1|3138995_3140132_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140625.1|3140186_3140981_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.4	2.4e-07
>prophage 232
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3155502	3157328	4487548		uncultured_marine_virus(50.0%)	2	NA	NA
WP_038390698.1|3155502_3156120_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.3	9.5e-52
WP_079794170.1|3156092_3157328_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.8	7.0e-62
>prophage 233
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3160668	3167106	4487548		Escherichia_phage(50.0%)	6	NA	NA
WP_079772276.1|3160668_3162234_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	7.1e-43
WP_079772242.1|3162458_3163013_+	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_079794169.1|3163009_3165289_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	24.7	1.2e-43
WP_001250389.1|3165285_3165843_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.4	8.1e-26
WP_079772244.1|3165842_3166610_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000278498.1|3166677_3167106_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.6e-18
>prophage 234
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3182227	3183752	4487548		Morganella_phage(33.33%)	3	NA	NA
WP_000034825.1|3182227_3182437_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939754.1|3182489_3182873_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.6	9.8e-23
WP_038390708.1|3182963_3183752_+	deaminated glutathione amidase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	21.9	2.9e-05
>prophage 235
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3187706	3190179	4487548		Stx2-converting_phage(50.0%)	2	NA	NA
WP_000858710.1|3187706_3188918_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.7	1.5e-101
WP_079794165.1|3189057_3190179_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.8e-09
>prophage 236
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3196683	3202129	4487548	tRNA	Staphylococcus_phage(50.0%)	5	NA	NA
WP_079794164.1|3196683_3199266_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.1	6.0e-180
WP_171920781.1|3199569_3199737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044882.1|3199783_3200257_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_079794163.1|3200351_3201287_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631373.1|3201403_3202129_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	5.8e-32
>prophage 237
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3208058	3209105	4487548		Pseudomonas_phage(100.0%)	1	NA	NA
WP_079777763.1|3208058_3209105_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.4e-48
>prophage 238
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3212340	3215499	4487548	transposase	Saccharomonospora_phage(50.0%)	2	NA	NA
WP_058107792.1|3212340_3212799_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.3e-13
WP_079794486.1|3213834_3215499_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	4.7e-85
>prophage 239
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3220347	3227879	4487548	tRNA	Vibrio_phage(33.33%)	5	NA	NA
WP_079773562.1|3220347_3222300_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.9e-09
WP_038390722.1|3222565_3224233_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	95.8	0.0e+00
WP_079794488.1|3224737_3226144_+	chitoporin	NA	NA	NA	NA	NA
WP_000738511.1|3226193_3226526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079794489.1|3226574_3227879_-	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	35.0	5.3e-60
>prophage 240
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3233435	3234209	4487548		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773242.1|3233435_3234209_-	esterase	NA	A0A2K9VI81	Mycobacterium_phage	38.1	1.7e-05
>prophage 241
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3241577	3242255	4487548		Bacillus_phage(100.0%)	1	NA	NA
WP_079794492.1|3241577_3242255_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.1	9.9e-26
>prophage 242
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3245525	3247574	4487548		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_079794494.1|3245525_3247574_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.3	8.4e-28
>prophage 243
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3253703	3256645	4487548		Hokovirus(50.0%)	2	NA	NA
WP_079794499.1|3253703_3255125_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.9	7.8e-57
WP_079794500.1|3255163_3256645_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.9	2.5e-45
>prophage 244
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3260554	3268186	4487548	integrase	Escherichia_phage(25.0%)	7	3255876:3255888	3261552:3261564
3255876:3255888	attL	TGGCGATAAATTT	NA	NA	NA	NA
WP_000824703.1|3260554_3261121_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	54.4	2.0e-51
WP_024134961.1|3261696_3261918_+	hypothetical protein	NA	NA	NA	NA	NA
3261552:3261564	attR	AAATTTATCGCCA	NA	NA	NA	NA
WP_038390737.1|3261919_3262660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171920813.1|3263272_3264718_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	2.1e-49
WP_000192695.1|3264714_3266097_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.9	2.5e-31
WP_015702765.1|3266102_3266888_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_079794501.1|3266890_3268186_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.3e-13
>prophage 245
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3272842	3273988	4487548		Stygiolobus_rod-shaped_virus(100.0%)	1	NA	NA
WP_079794504.1|3272842_3273988_+	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	33.9	4.3e-05
>prophage 246
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3277993	3278785	4487548		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114041.1|3277993_3278785_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.8	8.0e-11
>prophage 247
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3304296	3307817	4487548		Vibrio_phage(33.33%)	4	NA	NA
WP_079794240.1|3304296_3305016_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	35.0	4.0e-25
WP_079794241.1|3305012_3305951_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	1.3e-23
WP_000784380.1|3306061_3306448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109237.1|3306764_3307817_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.0	9.8e-81
>prophage 248
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3312737	3319263	4487548		Tupanvirus(33.33%)	7	NA	NA
WP_001265455.1|3312737_3313754_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.0	2.8e-80
WP_079794242.1|3313967_3315440_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.9	8.8e-11
WP_020843667.1|3315507_3316296_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891513.1|3316424_3316574_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_079794243.1|3316739_3317513_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604020.1|3317512_3318202_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_020843670.1|3318204_3319263_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	1.5e-20
>prophage 249
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3328945	3330485	4487548	integrase	Salmonella_phage(50.0%)	2	3325795:3325809	3336413:3336427
3325795:3325809	attL	TGGCGTTGGCGATTA	NA	NA	NA	NA
WP_141025562.1|3328945_3329743_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	96.6	1.6e-120
WP_079794247.1|3330128_3330485_+	T3SS effector NleG family protein	NA	A0A0P0ZBX1	Stx2-converting_phage	40.7	1.0e-13
3336413:3336427	attR	TAATCGCCAACGCCA	NA	NA	NA	NA
>prophage 250
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3337798	3341227	4487548		Catovirus(50.0%)	3	NA	NA
WP_079794253.1|3337798_3339319_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.7	5.6e-85
WP_079773829.1|3339403_3339880_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_000205498.1|3339937_3341227_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	5.9e-19
>prophage 251
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3347923	3351190	4487548		Phage_Gifsy-2(50.0%)	2	NA	NA
WP_079794256.1|3347923_3350188_+	SPI-1 type III secretion system effector E3 ubiquitin transferase SlrP	NA	Q9MBL9	Phage_Gifsy-2	38.8	3.2e-12
WP_001246039.1|3350281_3351190_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.9	2.7e-26
>prophage 252
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3360962	3370269	4487548		Anomala_cuprea_entomopoxvirus(25.0%)	8	NA	NA
WP_079794259.1|3360962_3362699_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	4.6e-19
WP_038390784.1|3362691_3363687_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_020843708.1|3363686_3364361_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_020843709.1|3364588_3365944_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.7	8.5e-53
WP_001218673.1|3366153_3368298_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.0	7.4e-43
WP_079794260.1|3368327_3369302_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000849093.1|3369457_3369718_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146333.1|3370002_3370269_-	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	52.8	3.8e-13
>prophage 253
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3373759	3379081	4487548		Planktothrix_phage(33.33%)	6	NA	NA
WP_000569092.1|3373759_3374482_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.2	1.9e-35
WP_001159051.1|3374478_3375138_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843878.1|3375314_3376061_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100806.1|3376531_3377035_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	25.2	2.5e-05
WP_079794261.1|3377324_3378212_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000716762.1|3378565_3379081_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	34.7	2.9e-17
>prophage 254
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3384094	3385687	4487548		Tupanvirus(100.0%)	1	NA	NA
WP_000961438.1|3384094_3385687_+	ABC-F family ATPase	NA	A0A2K9L3Z8	Tupanvirus	29.0	1.4e-59
>prophage 255
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3393259	3395692	4487548		Citrobacter_phage(100.0%)	1	NA	NA
WP_079794266.1|3393259_3395692_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	43.5	2.1e-09
>prophage 256
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3399174	3401046	4487548		Planktothrix_phage(100.0%)	1	NA	NA
WP_079794282.1|3399174_3401046_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	26.8	7.0e-13
>prophage 257
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3408671	3410677	4487548		Stx2-converting_phage(50.0%)	2	NA	NA
WP_079773184.1|3408671_3409874_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	7.0e-99
WP_079773183.1|3409918_3410677_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	30.7	9.4e-17
>prophage 258
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3418253	3427421	4487548		Vibrio_phage(25.0%)	11	NA	NA
WP_000495514.1|3418253_3418517_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	3.5e-27
WP_079794275.1|3418686_3418977_+	YbjC family protein	NA	NA	NA	NA	NA
WP_001070124.1|3418960_3419683_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_079794276.1|3419741_3420644_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	31.6	1.2e-34
WP_000624815.1|3420740_3421217_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_079794277.1|3421565_3422678_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_038390820.1|3422763_3423897_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	3.2e-29
WP_038390821.1|3423906_3424860_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_020843754.1|3424856_3425702_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_079794278.1|3425774_3426248_+	YbjO family protein	NA	NA	NA	NA	NA
WP_079794279.1|3426290_3427421_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.8	7.4e-26
>prophage 259
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3435676	3436405	4487548		Planktothrix_phage(100.0%)	1	NA	NA
WP_079794746.1|3435676_3436405_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	3.9e-28
>prophage 260
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3440600	3441431	4487548		Roseobacter_phage(100.0%)	1	NA	NA
WP_038390827.1|3440600_3441431_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.1	2.5e-07
>prophage 261
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3445020	3446739	4487548		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815328.1|3445020_3446739_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	1.3e-29
>prophage 262
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3453555	3460590	4487548	transposase,protease	Dickeya_phage(16.67%)	6	NA	NA
WP_079794743.1|3453555_3454674_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.1	1.8e-08
WP_079794742.1|3454670_3456617_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.7	2.4e-40
WP_000447498.1|3456767_3456989_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520786.1|3457312_3457633_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_000934068.1|3457663_3459940_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	8.1e-165
WP_058107792.1|3460131_3460590_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.3e-13
>prophage 263
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3466076	3482645	4487548	tRNA	Bacillus_phage(25.0%)	10	NA	NA
WP_079794772.1|3466076_3467798_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.1	7.6e-14
WP_079774691.1|3467798_3469565_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	2.0e-22
WP_000537395.1|3469679_3470648_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	7.2e-62
WP_000228469.1|3471195_3471690_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_079794773.1|3471824_3475679_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.7e-88
WP_020843775.1|3475821_3476433_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067777.1|3476442_3477786_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.9	1.8e-79
WP_079771751.1|3478042_3479335_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	6.6e-95
WP_079794774.1|3479572_3482017_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.4	7.8e-222
WP_000213081.1|3482027_3482645_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	1.5e-76
>prophage 264
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3490773	3493988	4487548		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111035.1|3490773_3491514_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.8e-20
WP_001292826.1|3491705_3493988_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.9e-161
>prophage 265
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3498080	3499169	4487548		Streptococcus_phage(100.0%)	1	NA	NA
WP_079773361.1|3498080_3499169_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.8	1.7e-80
>prophage 266
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3504226	3508790	4487548		Bacillus_phage(100.0%)	3	NA	NA
WP_000167332.1|3504226_3504511_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
WP_079794478.1|3504740_3507005_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551247.1|3507041_3508790_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	1.9e-60
>prophage 267
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3523727	3529483	4487548	tRNA	Rhodobacter_phage(33.33%)	5	NA	NA
WP_000357051.1|3523727_3524276_+	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	1.2e-05
WP_079794473.1|3524303_3524951_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_079794472.1|3525012_3526203_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_038390857.1|3526387_3527479_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.5	1.1e-98
WP_079794471.1|3528082_3529483_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.6	3.2e-79
>prophage 268
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3532527	3535140	4487548		Acinetobacter_phage(100.0%)	1	NA	NA
WP_079773350.1|3532527_3535140_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.7	4.8e-20
>prophage 269
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3540463	3542371	4487548		Tupanvirus(100.0%)	1	NA	NA
WP_079794469.1|3540463_3542371_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	3.5e-52
>prophage 270
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3554887	3556942	4487548		Bacillus_phage(100.0%)	1	NA	NA
WP_079794464.1|3554887_3556942_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.1	1.1e-16
>prophage 271
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3562717	3566307	4487548	protease	uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_079794461.1|3562717_3563380_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.4	1.7e-46
WP_000416679.1|3564009_3564339_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001261974.1|3564364_3564595_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_141025568.1|3565734_3566307_+	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	46.7	1.2e-19
>prophage 272
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3578309	3578990	4487548		Bacillus_phage(100.0%)	1	NA	NA
WP_141025586.1|3578309_3578990_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	2.2e-33
>prophage 273
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3590757	3594344	4487548		Pandoravirus(33.33%)	4	NA	NA
WP_000977386.1|3590757_3591696_+	MBL fold metallo-hydrolase	NA	S4VYV9	Pandoravirus	28.8	8.0e-18
WP_079794734.1|3592104_3592467_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	42.6	1.6e-22
WP_000200902.1|3593118_3593424_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_079771734.1|3593423_3594344_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	46.7	2.5e-11
>prophage 274
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3600649	3600817	4487548		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001273663.1|3600649_3600817_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 275
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3612831	3613620	4487548		Erwinia_phage(100.0%)	1	NA	NA
WP_000533519.1|3612831_3613620_+	phosphate starvation-inducible protein PhoH	NA	A0A1B2ICF6	Erwinia_phage	69.9	2.1e-91
>prophage 276
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3617191	3618025	4487548		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001137624.1|3617191_3618025_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.5	3.3e-39
>prophage 277
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3622198	3622738	4487548		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_020843913.1|3622198_3622738_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	47.9	2.4e-27
>prophage 278
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3631824	3632745	4487548		Morganella_phage(100.0%)	1	NA	NA
WP_079773509.1|3631824_3632745_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.5	1.8e-54
>prophage 279
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3637390	3637636	4487548		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001217765.1|3637390_3637636_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	48.7	1.5e-13
>prophage 280
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3653681	3654632	4487548		Brevibacillus_phage(100.0%)	1	NA	NA
WP_079794565.1|3653681_3654632_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	32.5	7.4e-11
>prophage 281
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3669274	3670400	4487548		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_079794570.1|3669274_3670009_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	2.9e-15
WP_000103754.1|3670163_3670400_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 282
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3673674	3674316	4487548		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000535405.1|3673674_3674316_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.1	2.5e-26
>prophage 283
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3687712	3687970	4487548		Erwinia_phage(100.0%)	1	NA	NA
WP_000800157.1|3687712_3687970_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	7.3e-06
>prophage 284
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3694197	3701845	4487548		Planktothrix_phage(25.0%)	8	NA	NA
WP_020843956.1|3694197_3694899_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	5.4e-35
WP_000168097.1|3694898_3696143_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_079794575.1|3696170_3697082_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001191858.1|3697099_3697921_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	4.0e-21
WP_079794576.1|3698020_3699067_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000971934.1|3699091_3699871_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000799378.1|3699867_3700725_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.0	4.3e-10
WP_000531584.1|3700708_3701845_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.5	5.5e-29
>prophage 285
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3706917	3708288	4487548		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_079794577.1|3706917_3708288_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.1e-108
>prophage 286
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3711424	3712675	4487548		Phage_21(100.0%)	1	NA	NA
WP_000444467.1|3711424_3712675_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 287
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3719112	3722515	4487548		Escherichia_phage(60.0%)	5	NA	NA
WP_079794806.1|3719112_3719520_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	39.5	2.4e-19
WP_079773472.1|3719536_3720268_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	51.8	3.3e-59
WP_079794807.1|3720460_3721003_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.6	3.6e-71
WP_001277617.1|3721160_3721538_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	36.6	5.3e-13
WP_079773471.1|3721696_3722515_-	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	49.3	5.5e-63
>prophage 288
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3731750	3731990	4487548		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000497449.1|3731750_3731990_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	1.5e-32
>prophage 289
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3737728	3738286	4487548		Enterobacterial_phage(100.0%)	1	NA	NA
WP_171920790.1|3737728_3738286_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	33.3	5.3e-17
>prophage 290
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3741891	3742422	4487548		Escherichia_phage(100.0%)	1	NA	NA
WP_000929984.1|3741891_3742422_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	66.3	5.3e-35
>prophage 291
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3746909	3747707	4487548		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_079775073.1|3746909_3747707_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.5	3.6e-11
>prophage 292
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3763202	3766629	4487548		Bacillus_phage(100.0%)	3	NA	NA
WP_079794597.1|3763202_3764693_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.1	1.5e-10
WP_079794596.1|3764987_3765191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079794595.1|3765345_3766629_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	27.9	1.1e-09
>prophage 293
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3771589	3772447	4487548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077915663.1|3771589_3772447_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	31.7	3.5e-28
>prophage 294
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3782132	3793116	4487548		Staphylococcus_phage(25.0%)	9	NA	NA
WP_079794784.1|3782132_3783116_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.4	2.5e-06
WP_000719104.1|3783245_3784004_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_079794783.1|3784139_3785498_+	MFS transporter	NA	NA	NA	NA	NA
WP_079794782.1|3785601_3786258_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A1V0SEH9	Indivirus	28.8	4.3e-10
WP_038391149.1|3786283_3787300_-	asparaginase	NA	NA	NA	NA	NA
WP_171920791.1|3787435_3789292_-	signal peptide peptidase SppA	NA	K4HZZ6	Acidithiobacillus_phage	28.2	2.6e-07
WP_038391154.1|3789470_3790022_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001294905.1|3790139_3791183_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_079794789.1|3791187_3793116_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	1.8e-40
>prophage 295
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3796744	3797971	4487548		Klosneuvirus(100.0%)	1	NA	NA
WP_079794791.1|3796744_3797971_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.1	2.5e-27
>prophage 296
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3804666	3805494	4487548		Bacillus_virus(100.0%)	1	NA	NA
WP_079771829.1|3804666_3805494_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	3.8e-72
>prophage 297
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3811654	3813907	4487548		Tupanvirus(100.0%)	1	NA	NA
WP_079794316.1|3811654_3813907_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	49.7	2.7e-144
>prophage 298
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3824039	3841971	4487548	tRNA	Tupanvirus(22.22%)	18	NA	NA
WP_038391197.1|3824039_3825968_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	3.6e-129
WP_001574431.1|3825971_3826514_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001124225.1|3826609_3826807_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|3826856_3827213_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|3827333_3827378_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018575.1|3827514_3828498_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_079794313.1|3828513_3830901_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229266.1|3830905_3831205_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_079794312.1|3831407_3832388_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_079794311.1|3832479_3833031_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_079794310.1|3833030_3833780_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.2e-08
WP_079794309.1|3833856_3834321_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.4	1.6e-14
WP_079794308.1|3834629_3835343_+	anti-FlhDC factor YdiV	NA	NA	NA	NA	NA
WP_079794307.1|3835404_3836847_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.9	2.2e-54
WP_000089119.1|3836882_3837074_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_079794306.1|3837219_3838266_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	1.7e-80
WP_000370990.1|3838422_3839256_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_079794305.1|3839592_3841971_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.4	7.9e-171
>prophage 299
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3852243	3855453	4487548		Cedratvirus(50.0%)	3	NA	NA
WP_079794298.1|3852243_3852990_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	5.8e-11
WP_079794297.1|3852964_3854236_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_079774657.1|3854232_3855453_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.0	7.1e-91
>prophage 300
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3870597	3871326	4487548		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000122329.1|3870597_3871326_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.9	1.1e-46
>prophage 301
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3884683	3900033	4487548		Agrobacterium_phage(14.29%)	13	NA	NA
WP_079794286.1|3884683_3887197_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.1	2.0e-84
WP_038391261.1|3887219_3887795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079794285.1|3887920_3889885_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.0	2.4e-40
WP_079774667.1|3889884_3890406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844154.1|3890810_3892184_-	multidrug efflux MATE transporter MdtK	NA	NA	NA	NA	NA
WP_020844155.1|3892400_3893042_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.3	1.1e-23
WP_020844156.1|3893085_3894234_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	9.3e-85
WP_001182305.1|3894522_3895728_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_079771789.1|3895840_3896773_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190994.1|3896769_3897795_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	8.2e-32
WP_000102275.1|3898089_3898179_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_000007289.1|3898468_3899050_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	47.0	1.8e-44
WP_079771788.1|3899175_3900033_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	37.0	4.0e-16
>prophage 302
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3905257	3905779	4487548		Salmonella_phage(100.0%)	1	NA	NA
WP_038391289.1|3905257_3905779_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	59.8	3.4e-50
>prophage 303
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3912705	3913980	4487548	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_079774673.1|3912705_3913980_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.6	1.9e-86
>prophage 304
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3943368	3947792	4487548		Bacillus_phage(50.0%)	3	NA	NA
WP_079771771.1|3943368_3944670_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	1.5e-14
WP_079794625.1|3944781_3946482_-	amidohydrolase	NA	NA	NA	NA	NA
WP_079794626.1|3946640_3947792_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.8	5.6e-114
>prophage 305
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3965402	3984669	4487548		Escherichia_phage(45.45%)	19	NA	NA
WP_079771757.1|3965402_3966551_-	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.9	2.9e-25
WP_000379674.1|3966550_3967198_-	osmoprotectant ABC transporter permease OsmW	NA	NA	NA	NA	NA
WP_079794631.1|3967207_3968110_-	osmoprotectant ABC transporter substrate-binding protein OsmX	NA	NA	NA	NA	NA
WP_079771755.1|3968138_3968849_-	osmoprotectant ABC transporter permease OsmY	NA	NA	NA	NA	NA
WP_000206574.1|3969153_3969768_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.3	3.3e-28
WP_020844197.1|3969811_3970669_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	34.1	4.9e-22
WP_000213081.1|3970670_3971288_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	1.5e-76
WP_079794117.1|3971298_3973734_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	47.5	1.3e-205
WP_079794116.1|3973810_3976249_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.5	7.3e-220
WP_077915674.1|3976400_3976709_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_079794115.1|3976813_3977524_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000200001.1|3977554_3978115_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001066439.1|3978148_3978490_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000921381.1|3978639_3978966_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	50.0	1.4e-22
WP_000706281.1|3979087_3980302_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	3.7e-47
WP_079772919.1|3980313_3981333_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_079794114.1|3981386_3982766_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.1	1.0e-29
WP_079794113.1|3982929_3984396_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.7	4.9e-46
WP_000989267.1|3984465_3984669_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
>prophage 306
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	3993859	3994243	4487548		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091204.1|3993859_3994243_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	34.0	1.2e-09
>prophage 307
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4004947	4006066	4487548		Enterobacteria_phage(100.0%)	1	NA	NA
WP_079772909.1|4004947_4006066_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.7	2.3e-112
>prophage 308
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4042818	4043829	4487548		Tupanvirus(100.0%)	1	NA	NA
WP_000642438.1|4042818_4043829_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	6.6e-26
>prophage 309
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4050207	4051296	4487548		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038391447.1|4050207_4051296_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	75.5	5.3e-154
>prophage 310
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4059445	4060990	4487548		Escherichia_phage(100.0%)	1	NA	NA
WP_079794091.1|4059445_4060990_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	6.4e-20
>prophage 311
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4074716	4076837	4487548		Salmonella_phage(100.0%)	1	NA	NA
WP_079794081.1|4074716_4076837_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	3.4e-133
>prophage 312
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4098129	4100094	4487548		Phage_TP(100.0%)	1	NA	NA
WP_079794073.1|4098129_4100094_-	U32 family peptidase	NA	Q6DW11	Phage_TP	27.8	3.9e-22
>prophage 313
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4116198	4127640	4487548		uncultured_Caudovirales_phage(28.57%)	12	NA	NA
WP_079794059.1|4116198_4117707_-	carboxylesterase/lipase family protein	NA	S4VZJ7	Pandoravirus	32.7	2.3e-30
WP_079794058.1|4117756_4119100_-	VOC family protein	NA	NA	NA	NA	NA
WP_020844301.1|4119106_4119280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000414261.1|4119404_4120328_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079772852.1|4120389_4122003_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	1.3e-15
WP_000842136.1|4122172_4123291_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.6	5.2e-32
WP_001120767.1|4123322_4123598_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_141025555.1|4123720_4123978_-	M15 family metallopeptidase	NA	S4TRL9	Salmonella_phage	58.9	8.6e-15
WP_171920816.1|4124510_4124963_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_079777619.1|4125288_4125960_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	8.2e-81
WP_079794055.1|4125952_4127218_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	78.2	6.1e-194
WP_079772846.1|4127220_4127640_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.2	1.4e-33
>prophage 314
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4131573	4139616	4487548		Planktothrix_phage(33.33%)	6	NA	NA
WP_079772844.1|4131573_4132305_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	5.1e-28
WP_000560157.1|4132301_4132982_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000683310.1|4133247_4133910_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000527285.1|4134192_4134723_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	4.5e-18
WP_001178455.1|4134838_4135639_-	YdcF family protein	NA	NA	NA	NA	NA
WP_079794053.1|4135713_4139616_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	28.8	6.1e-51
>prophage 315
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4149640	4150630	4487548		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762203.1|4149640_4150630_+	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	42.2	4.7e-69
>prophage 316
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4155725	4167853	4487548	tRNA	Morganella_phage(16.67%)	9	NA	NA
WP_079772831.1|4155725_4156160_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	8.0e-29
WP_000159239.1|4156211_4156550_-	EamA family transporter	NA	NA	NA	NA	NA
WP_079793667.1|4156881_4160304_-	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	51.6	0.0e+00
WP_079793665.1|4160940_4161876_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	96.5	1.4e-142
WP_000123670.1|4161919_4163293_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	2.3e-53
WP_000644150.1|4163780_4164764_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_079793664.1|4164919_4166077_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.9	1.7e-09
WP_001046806.1|4166490_4167054_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000945023.1|4167337_4167853_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	7.8e-23
>prophage 317
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4179326	4180184	4487548		Streptococcus_phage(100.0%)	1	NA	NA
WP_171920817.1|4179326_4180184_+	helix-turn-helix domain-containing protein	NA	A0A1B0RXG1	Streptococcus_phage	28.1	5.8e-07
>prophage 318
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4196521	4300276	4487548	integrase,tail,holin,portal,capsid,transposase,head,terminase	Salmonella_phage(29.82%)	109	4244552:4244567	4297585:4297600
WP_138993519.1|4196521_4196662_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_141025544.1|4197625_4199719_-	ATP-binding cassette domain-containing protein	NA	F2Y165	Organic_Lake_phycodnavirus	25.2	1.4e-14
WP_171920799.1|4199727_4200978_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_020844359.1|4201100_4201661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079793645.1|4202094_4202799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079773377.1|4202795_4203221_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000208467.1|4205124_4205715_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079793644.1|4205793_4206507_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_079793643.1|4206779_4208018_+	ribokinase	NA	NA	NA	NA	NA
WP_024135024.1|4208114_4209092_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_079793642.1|4209091_4209991_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_079793641.1|4210005_4211418_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_079773381.1|4211414_4212626_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_038391585.1|4212627_4213683_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.7	6.1e-22
WP_079793640.1|4214632_4215538_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079793639.1|4215656_4216574_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
WP_079793638.1|4216754_4218368_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000219128.1|4218558_4219287_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_038391592.1|4219261_4220227_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_000078467.1|4220342_4220849_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_020844374.1|4220937_4222479_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_079774028.1|4222626_4223688_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_171920800.1|4223684_4225082_-	YcjX family protein	NA	NA	NA	NA	NA
WP_079773389.1|4225232_4226243_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000854573.1|4226273_4227179_-	OmpG family monomeric porin	NA	NA	NA	NA	NA
WP_000057948.1|4227255_4228335_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	9.6e-23
WP_000804180.1|4228345_4229005_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_141025543.1|4229001_4231272_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_079773390.1|4231268_4232324_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000690224.1|4232334_4233123_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_000733195.1|4233141_4234194_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_020844383.1|4234222_4235065_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_079793636.1|4235051_4235933_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_079793635.1|4235953_4237246_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_079793634.1|4237259_4238942_-	sugar phosphorylase	NA	NA	NA	NA	NA
WP_001097609.1|4239132_4239363_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_079773396.1|4239383_4239743_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_001274954.1|4239742_4239967_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_079773397.1|4240026_4240695_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_015702897.1|4240865_4241849_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_024143290.1|4241957_4243604_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_000583295.1|4243600_4244566_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
4244552:4244567	attL	TATGCCTTACGATAGC	NA	NA	NA	NA
WP_079793633.1|4244781_4245894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079773288.1|4245895_4246153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079793632.1|4246213_4247239_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D2W685	Pectobacterium_phage	46.8	4.7e-19
WP_079793631.1|4247388_4250751_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	73.8	0.0e+00
WP_079793630.1|4250841_4251468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079793629.1|4251539_4252217_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	68.0	8.8e-67
WP_079793628.1|4252114_4252849_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	73.9	2.2e-111
WP_079793627.1|4252860_4253556_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	68.8	1.6e-92
WP_069040880.1|4253564_4253897_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	70.6	9.1e-41
WP_079793626.1|4253897_4257206_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	64.6	0.0e+00
WP_020843855.1|4257456_4257819_-	hypothetical protein	NA	Q6UAW8	Klebsiella_phage	56.8	7.4e-28
WP_020843854.1|4257890_4258364_-|tail	phage tail fiber	tail	Q6UAX0	Klebsiella_phage	78.7	3.2e-63
WP_069720979.1|4258396_4258798_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	88.0	7.6e-58
WP_020843852.1|4258794_4259184_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	73.8	8.1e-49
WP_079773296.1|4259164_4259509_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	63.6	3.1e-36
WP_079773297.1|4259552_4259876_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q7Y407	Yersinia_phage	66.0	1.2e-32
WP_079793677.1|4259856_4260177_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	71.2	3.2e-19
WP_020843848.1|4260283_4261570_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	87.6	4.4e-208
WP_024143213.1|4261644_4262562_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	76.6	2.5e-128
WP_079773299.1|4262600_4263860_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.0	5.4e-219
WP_079793625.1|4264032_4265757_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	59.1	2.5e-198
WP_079775036.1|4265756_4266194_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	3.5e-32
WP_024143211.1|4266535_4266886_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	75.7	3.6e-48
WP_000819054.1|4266988_4267294_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	53.1	6.2e-20
WP_079773316.1|4267382_4267793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141025542.1|4268383_4269514_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	96.8	1.7e-211
WP_079773318.1|4269619_4270162_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_079793623.1|4270205_4270820_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.2	7.9e-107
WP_000226306.1|4270819_4271101_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001294877.1|4271087_4271477_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.8	1.4e-40
WP_079793622.1|4271690_4272905_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	80.8	1.1e-179
WP_171503638.1|4272959_4273661_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	67.2	2.2e-81
WP_079793676.1|4273731_4274157_-	pertussis toxin	NA	NA	NA	NA	NA
WP_079773321.1|4274941_4275121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079774850.1|4275131_4275632_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_079774851.1|4275858_4276221_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	69.1	2.4e-31
WP_079774852.1|4276366_4277896_+	DUF4041 domain-containing protein	NA	Q5G8X0	Enterobacteria_phage	96.5	3.1e-160
WP_079793621.1|4278356_4278926_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	71.0	1.1e-41
WP_079793620.1|4279194_4279866_-	antiterminator	NA	I6PDF8	Cronobacter_phage	57.1	1.2e-63
WP_079793618.1|4280255_4280858_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	97.5	7.0e-108
WP_079773733.1|4280892_4281141_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	98.8	2.1e-42
WP_079793617.1|4281257_4281491_-	DinI family protein	NA	H6WRY5	Salmonella_phage	94.8	1.5e-34
WP_079793616.1|4281677_4282463_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	62.4	8.3e-85
WP_000409416.1|4283060_4283228_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	75.5	6.6e-16
WP_079793615.1|4283351_4283783_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	55.8	7.4e-27
WP_024134978.1|4284065_4284392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079793614.1|4284493_4285294_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	82.8	1.9e-121
WP_079793613.1|4285297_4285771_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.5e-68
WP_079793612.1|4285770_4286304_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.7	2.0e-90
WP_023602525.1|4286300_4286702_-	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000788825.1|4286746_4287448_-	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.6	8.4e-129
WP_000024046.1|4287444_4288350_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_079793611.1|4288441_4288816_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.3e-61
WP_000145711.1|4288781_4289009_-	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_079793610.1|4289022_4289490_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.5	1.9e-68
WP_000439725.1|4289532_4289958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091280.1|4289959_4290394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000438989.1|4290420_4290627_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	9.6e-17
WP_020898611.1|4291025_4291184_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	96.2	2.6e-22
WP_023195475.1|4291205_4291556_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.8	2.0e-59
WP_000017131.1|4291682_4294598_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	97.2	0.0e+00
WP_079793609.1|4294560_4295718_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	3.6e-217
WP_079793608.1|4295760_4296000_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	94.9	2.4e-35
WP_079793606.1|4296221_4297439_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	3.6e-119
WP_001146140.1|4297585_4298476_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
4297585:4297600	attR	TATGCCTTACGATAGC	NA	NA	NA	NA
WP_001128870.1|4298475_4299468_+	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_020844398.1|4299469_4300276_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	6.1e-14
>prophage 319
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4305695	4309871	4487548		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_000485035.1|4305695_4307630_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	23.8	2.3e-06
WP_079793675.1|4307885_4309871_+	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	32.1	7.7e-18
>prophage 320
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4315491	4316082	4487548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176284.1|4315491_4316082_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.9e-42
>prophage 321
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4320986	4326428	4487548	protease	Tupanvirus(33.33%)	4	NA	NA
WP_000513582.1|4320986_4323584_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.9	5.4e-88
WP_000548615.1|4323986_4324238_+	YciN family protein	NA	NA	NA	NA	NA
WP_079774040.1|4324383_4325430_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.5	5.6e-20
WP_000559305.1|4325666_4326428_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	21.9	6.8e-07
>prophage 322
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4331397	4334355	4487548		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763475.1|4331397_4332993_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	39.1	3.8e-52
WP_079793599.1|4332996_4334355_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	1.1e-36
>prophage 323
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4346015	4348914	4487548		Lactobacillus_phage(33.33%)	3	NA	NA
WP_000059070.1|4346015_4346852_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	42.4	1.0e-08
WP_000993205.1|4346899_4347904_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	31.8	4.0e-15
WP_038391657.1|4347900_4348914_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	2.2e-13
>prophage 324
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4357279	4367982	4487548		Pectobacterium_bacteriophage(20.0%)	11	NA	NA
WP_000068090.1|4357279_4357897_-	thymidine kinase	NA	A0A0A0Q2F0	Pectobacterium_bacteriophage	53.7	6.0e-54
WP_001287383.1|4358434_4358848_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000729447.1|4358977_4359886_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	8.2e-60
WP_000193426.1|4360088_4361102_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001230582.1|4361192_4362098_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_024135027.1|4362206_4362665_+	YchJ family protein	NA	NA	NA	NA	NA
WP_079793593.1|4362715_4363558_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	6.3e-14
WP_079774045.1|4364426_4364993_+	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	45.3	2.9e-15
WP_038391666.1|4365059_4365737_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571674.1|4365736_4366447_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702634.1|4366443_4367982_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	4.8e-20
>prophage 325
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4379182	4384836	4487548		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
WP_001146391.1|4379182_4379413_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	42.7	3.8e-06
WP_020844438.1|4379679_4380780_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000811043.1|4380829_4381684_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	7.0e-45
WP_001257071.1|4381721_4382531_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000205403.1|4382534_4382924_-	SirB family protein	NA	NA	NA	NA	NA
WP_079793591.1|4382920_4383754_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804710.1|4383753_4384836_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	8.7e-08
>prophage 326
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4388186	4390941	4487548		Tupanvirus(50.0%)	2	NA	NA
WP_001518537.1|4388186_4389134_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
WP_020844441.1|4389258_4390941_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.1	3.9e-23
>prophage 327
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4426100	4433409	4487548	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_038391737.1|4426100_4427786_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	8.4e-34
WP_020844464.1|4427990_4428572_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_038391739.1|4428640_4429336_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_079793578.1|4429393_4431304_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	5.3e-93
WP_000158030.1|4431434_4431779_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457329.1|4431784_4431964_-	YoaH family protein	NA	NA	NA	NA	NA
WP_079793577.1|4432044_4433409_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.0	2.1e-43
>prophage 328
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4437495	4439055	4487548		Moraxella_phage(100.0%)	1	NA	NA
WP_079793575.1|4437495_4439055_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	7.3e-40
>prophage 329
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4446551	4446761	4487548		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4446551_4446761_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 330
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4452214	4454899	4487548	transposase	Saccharomonospora_phage(50.0%)	2	NA	NA
WP_171920801.1|4452214_4452673_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_079794700.1|4452850_4454899_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	3.0e-86
>prophage 331
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4462402	4463053	4487548		Escherichia_phage(100.0%)	1	NA	NA
WP_079774065.1|4462402_4463053_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.0	8.0e-57
>prophage 332
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4469555	4471263	4487548		Pectobacterium_phage(50.0%)	3	NA	NA
WP_000856226.1|4469555_4469786_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.7e-14
WP_079794696.1|4469893_4470550_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944290.1|4470573_4471263_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	3.6e-07
>prophage 333
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4479125	4480601	4487548		Cyanophage(100.0%)	1	NA	NA
WP_000301707.1|4479125_4480601_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	3.4e-79
>prophage 334
NZ_CP053416	Salmonella bongori strain 85-0051 chromosome, complete genome	4487548	4484549	4485869	4487548		Listeria_phage(100.0%)	1	NA	NA
WP_001184025.1|4484549_4485869_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
