The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034553	Burkholderia cepacia ATCC 25416 chromosome 1, complete sequence	3781435	430245	468749	3781435	transposase,protease,plate	Burkholderia_phage(50.0%)	36	NA	NA
WP_027788532.1|430245_430773_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.0	9.7e-21
WP_080981881.1|431076_431322_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	90.1	1.5e-32
WP_138143304.1|431925_433323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080981880.1|433567_433699_+	AlpA family phage regulatory protein	NA	E5E3Y1	Burkholderia_phage	88.1	8.2e-14
WP_027788530.1|433893_434628_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080981879.1|434629_435715_-	histidine kinase	NA	NA	NA	NA	NA
WP_027788528.1|436129_436672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788527.1|437026_437230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788526.1|437289_438090_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027788525.1|438923_439232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138143305.1|439909_440251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788523.1|440512_440836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788522.1|441123_441705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788521.1|441808_442297_+	DUF4265 domain-containing protein	NA	NA	NA	NA	NA
WP_049096227.1|442350_442803_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_027788519.1|442792_443152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049096226.1|443148_443844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788517.1|443936_444719_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011350756.1|444715_446062_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027788516.1|446164_446776_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_027788515.1|447149_447788_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_027788514.1|447832_448348_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006477094.1|448363_449854_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006477093.1|449924_450428_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_021161818.1|450772_451258_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027788513.1|451335_453171_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_027788512.1|453134_454235_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_027788511.1|454561_457231_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.8	3.5e-90
WP_027788510.1|457270_458392_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_027788509.1|458477_459407_-	OmpA family protein	NA	NA	NA	NA	NA
WP_027788508.1|459411_460401_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_027788507.1|460397_464342_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_021161809.1|464643_465489_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027788506.1|465610_466570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788505.1|466776_467802_+	transporter	NA	NA	NA	NA	NA
WP_027788504.1|467798_468749_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP034553	Burkholderia cepacia ATCC 25416 chromosome 1, complete sequence	3781435	1121100	1129390	3781435		Bacillus_phage(16.67%)	8	NA	NA
WP_027788058.1|1121100_1122501_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.8e-77
WP_051363294.1|1122508_1123459_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.5	7.6e-16
WP_027788057.1|1123522_1124515_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	1.5e-27
WP_021157453.1|1124588_1124936_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027788056.1|1125150_1126053_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.2	3.7e-52
WP_080982007.1|1126131_1127475_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_021157450.1|1127518_1128442_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.9	6.7e-41
WP_027788054.1|1128469_1129390_-	alpha/beta hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	27.2	8.7e-17
>prophage 3
NZ_CP034553	Burkholderia cepacia ATCC 25416 chromosome 1, complete sequence	3781435	1734765	1744003	3781435		Pseudomonas_phage(22.22%)	14	NA	NA
WP_027787629.1|1734765_1735725_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.6	1.0e-28
WP_006476104.1|1735782_1735998_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_027787628.1|1736137_1736335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787627.1|1736389_1736635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787626.1|1736859_1737129_-	pyocin activator PrtN family protein	NA	I6NSR8	Burkholderia_phage	61.4	1.3e-21
WP_027787625.1|1737125_1737908_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	40.4	4.9e-37
WP_027787624.1|1737904_1738393_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	50.6	1.6e-38
WP_027787623.1|1738389_1738827_-	hypothetical protein	NA	A0A097EYP5	Mycobacterium_phage	48.1	6.8e-20
WP_138143316.1|1739232_1739520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787622.1|1739516_1740596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787621.1|1740588_1741356_-	hypothetical protein	NA	A0A1J0GVP2	Pseudoalteromonas_phage	45.1	1.9e-65
WP_027787620.1|1741419_1742175_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	53.0	4.7e-69
WP_027787619.1|1742600_1742990_-	hypothetical protein	NA	A0A1S6L2W9	Erwinia_phage	73.7	2.7e-44
WP_027787618.1|1743007_1744003_-	RNA-directed DNA polymerase	NA	H7BVN7	unidentified_phage	35.7	3.2e-41
>prophage 4
NZ_CP034553	Burkholderia cepacia ATCC 25416 chromosome 1, complete sequence	3781435	1747716	1825962	3781435	portal,tail,terminase,plate,head,tRNA,capsid,integrase	Burkholderia_phage(38.1%)	108	1787875:1787923	1832900:1832948
WP_158605810.1|1747716_1748463_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	35.0	2.9e-18
WP_063623143.1|1748608_1748926_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_034195786.1|1749697_1749997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787610.1|1750367_1751222_+	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	65.9	5.5e-90
WP_081040784.1|1751218_1752304_+	helix-turn-helix domain-containing protein	NA	A4JX55	Burkholderia_virus	48.6	1.5e-63
WP_027787607.1|1752300_1752846_+	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	46.0	2.6e-29
WP_099318686.1|1752857_1753250_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027787606.1|1753246_1753513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787605.1|1753509_1753953_+	DUF1364 family protein	NA	Q3HR02	Burkholderia_phage	87.8	9.2e-73
WP_027787604.1|1753955_1754288_+	hypothetical protein	NA	A4JX59	Burkholderia_virus	70.0	2.6e-40
WP_051363288.1|1754284_1754524_+	hypothetical protein	NA	A4JX60	Burkholderia_virus	42.3	3.7e-12
WP_051363303.1|1754810_1755020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081040786.1|1755483_1755918_+	DUF4406 domain-containing protein	NA	L7TKQ2	Pseudomonas_virus	56.2	4.5e-24
WP_027787599.1|1755914_1756235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081040814.1|1756309_1756618_+	hypothetical protein	NA	A0A1L7N0Z9	Ralstonia_phage	49.5	5.5e-24
WP_027787597.1|1756642_1756867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787596.1|1756863_1757232_+	DUF2591 family protein	NA	F8TVJ2	EBPR_siphovirus	38.4	5.4e-10
WP_027787595.1|1757240_1757477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057056459.1|1757504_1758077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787593.1|1758354_1758657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787592.1|1758658_1759237_+|tail	phage tail protein	tail	A0A067ZG41	Vibrio_phage	32.1	1.0e-10
WP_027787591.1|1759441_1760035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081040788.1|1760087_1762124_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.7	5.5e-96
WP_027787589.1|1762131_1762377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787588.1|1762376_1764047_+|portal	phage portal protein	portal	V5Q9Y6	Xylella_phage	35.8	1.1e-73
WP_027787587.1|1764043_1764910_+	S49 family peptidase	NA	G8DCP1	Silicibacter_phage	52.1	1.6e-49
WP_051363286.1|1764938_1765559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051363285.1|1765601_1766534_+|head	head decoration protein	head	NA	NA	NA	NA
WP_027787586.1|1766642_1767707_+|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	37.5	1.8e-53
WP_027787585.1|1767707_1768040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787584.1|1768036_1768594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787583.1|1768605_1768803_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_027787582.1|1768799_1770302_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	46.5	3.9e-107
WP_034195783.1|1770365_1770737_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_051363284.1|1770739_1771027_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_027787579.1|1771172_1772930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787578.1|1772933_1774391_+	DNA circularization N-terminal domain-containing protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	24.4	2.1e-12
WP_027787577.1|1774394_1775477_+	hypothetical protein	NA	B5TK72	Pseudomonas_phage	32.9	1.7e-43
WP_027787576.1|1775473_1776076_+|plate	phage baseplate assembly protein V	plate	A0A192Y8K5	Salmonella_phage	31.9	2.3e-10
WP_034195782.1|1776072_1776522_+	phage GP46 family protein	NA	B5TAA8	Burkholderia_phage	31.3	1.3e-10
WP_081040790.1|1776522_1777635_+|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	26.9	1.0e-19
WP_081040791.1|1777646_1778288_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_138143318.1|1778300_1779212_+	hypothetical protein	NA	O22004	Shigella_phage	46.2	1.8e-06
WP_051363283.1|1779227_1779764_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_099318693.1|1781666_1782371_+	lysozyme	NA	A0A059VA40	Pseudomonas_phage	42.2	2.6e-29
WP_027787569.1|1782448_1783084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034195779.1|1783086_1783281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787568.1|1783323_1784007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787567.1|1784003_1784312_+	hypothetical protein	NA	A0A1B2IBL3	Erwinia_phage	54.4	6.7e-22
WP_027787566.1|1784308_1784908_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_027787565.1|1784926_1785142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787564.1|1785549_1786629_-|integrase	tyrosine-type recombinase/integrase	integrase	I6NSG1	Burkholderia_phage	54.5	2.1e-110
WP_081040793.1|1786749_1787790_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
1787875:1787923	attL	AGGATTGTGATTCCTGTCGTCGTGGGTTCGAGTCCCATCAGCCACCCCA	NA	NA	NA	NA
WP_080981894.1|1788010_1789105_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027787562.1|1789032_1789239_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_027787561.1|1789241_1790255_-	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	62.5	1.6e-117
WP_111946790.1|1790251_1791010_-	hypothetical protein	NA	Q8W6Q9	Burkholderia_virus	52.9	1.5e-30
WP_027787560.1|1791006_1791402_-	hypothetical protein	NA	Q6JII6	Burkholderia_virus	70.2	1.7e-46
WP_027787559.1|1791412_1792408_-	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	34.6	1.7e-45
WP_027787558.1|1792751_1793108_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_027787557.1|1793122_1793587_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_027787556.1|1793617_1793980_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_027787555.1|1794069_1794693_-	hypothetical protein	NA	A9YX18	Burkholderia_phage	92.6	3.7e-19
WP_027787554.1|1794689_1796456_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	35.8	3.0e-74
WP_027787553.1|1796468_1797527_-	hypothetical protein	NA	H2BD49	Pseudomonas_phage	54.9	1.1e-76
WP_027787552.1|1797541_1798351_-	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	61.3	6.1e-91
WP_167562609.1|1798350_1798515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787551.1|1798511_1798694_-	hypothetical protein	NA	A9YWW6	Burkholderia_phage	73.0	1.0e-06
WP_027787550.1|1798693_1799023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034195891.1|1799157_1799583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787548.1|1799616_1799997_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_081040797.1|1800830_1801229_-	hypothetical protein	NA	C7BGF7	Burkholderia_phage	76.5	6.8e-51
WP_027787547.1|1801313_1801568_+	Cro/Cl family transcriptional regulator	NA	C7BGF8	Burkholderia_phage	60.0	8.8e-20
WP_027787546.1|1801564_1801792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138143319.1|1801791_1802082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787544.1|1802193_1802418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787543.1|1802414_1802627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080981926.1|1802689_1803739_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	59.0	4.4e-33
WP_027787542.1|1803735_1804101_+	hypothetical protein	NA	Q3HQZ9	Burkholderia_phage	80.5	4.8e-51
WP_080981927.1|1804236_1804530_+	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	63.3	4.4e-23
WP_027787540.1|1804526_1805120_+	hypothetical protein	NA	A9YWZ1	Burkholderia_phage	77.4	6.1e-80
WP_027787539.1|1805227_1805407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787538.1|1805403_1806057_+	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	85.9	2.1e-105
WP_027787537.1|1806077_1806557_+	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	83.6	3.3e-68
WP_027787536.1|1806558_1808160_+	bacteriophage TerL protein	NA	A9YWZ6	Burkholderia_phage	89.6	1.7e-289
WP_027787535.1|1808156_1809740_+	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	61.0	4.6e-151
WP_138143324.1|1809723_1810320_+|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	77.2	1.5e-81
WP_027787533.1|1810321_1811626_+	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	47.3	1.6e-72
WP_027787532.1|1811638_1812127_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	56.8	4.7e-38
WP_027787531.1|1812137_1813175_+	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	67.7	1.1e-124
WP_027787530.1|1813184_1813622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787529.1|1813677_1814061_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	75.6	1.2e-52
WP_027787528.1|1814089_1814572_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	84.9	1.6e-70
WP_027787527.1|1814575_1814947_+	hypothetical protein	NA	A9YX28	Burkholderia_phage	87.0	2.2e-59
WP_027787526.1|1814951_1815542_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	79.0	2.8e-85
WP_027787525.1|1815551_1817363_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	38.8	4.6e-94
WP_027787524.1|1817378_1817819_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	58.2	4.9e-42
WP_034195778.1|1817821_1818355_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	40.0	1.8e-22
WP_034195777.1|1818351_1818537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787522.1|1818529_1820386_+	glucosaminidase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	41.4	1.6e-38
WP_027787521.1|1820382_1820982_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	40.1	3.1e-23
WP_027787520.1|1820981_1821296_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	47.0	1.6e-18
WP_027787519.1|1821295_1822288_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	67.3	3.6e-101
WP_027787518.1|1822284_1822941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787517.1|1822953_1823697_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	78.1	6.4e-103
WP_027787516.1|1823705_1824059_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	72.6	1.6e-40
WP_027787515.1|1824055_1825243_+|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	70.4	3.4e-146
WP_027787514.1|1825245_1825962_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	68.2	8.7e-81
1832900:1832948	attR	AGGATTGTGATTCCTGTCGTCGTGGGTTCGAGTCCCATCAGCCACCCCA	NA	NA	NA	NA
>prophage 5
NZ_CP034553	Burkholderia cepacia ATCC 25416 chromosome 1, complete sequence	3781435	2150354	2190059	3781435	transposase,protease,plate	Leptospira_phage(16.67%)	32	NA	NA
WP_088611350.1|2150354_2151454_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	2.9e-35
WP_138143282.1|2152130_2154620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088611304.1|2155030_2156240_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.4	1.0e-97
WP_027787261.1|2156593_2157853_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.5	1.5e-43
WP_138143283.1|2158690_2159104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787260.1|2159114_2160002_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_027787258.1|2160022_2160910_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027787257.1|2160911_2162249_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027787256.1|2162245_2163349_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_027787255.1|2163345_2164698_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_080982084.1|2164694_2165444_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_027787253.1|2165953_2166208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080982120.1|2166146_2166548_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_027787252.1|2166772_2167618_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_006485265.1|2168031_2168598_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_006491801.1|2168717_2169458_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_027787251.1|2169592_2170774_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_027787250.1|2170873_2172739_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_027787249.1|2173098_2173938_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_027787248.1|2173944_2175153_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_021163132.1|2175194_2176019_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_027787247.1|2176123_2178370_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	29.3	4.8e-77
WP_006478692.1|2178425_2178641_-	YdcH family protein	NA	NA	NA	NA	NA
WP_027787246.1|2178718_2179471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787245.1|2179631_2181956_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_034195767.1|2182372_2183401_+	sesquiterpene cyclase	NA	NA	NA	NA	NA
WP_027787243.1|2183423_2185340_-	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	32.7	1.1e-77
WP_021163124.1|2185616_2186213_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011352252.1|2186219_2187566_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	36.6	2.6e-70
WP_027787242.1|2187679_2188828_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_011352254.1|2188931_2189123_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_027787241.1|2189159_2190059_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 6
NZ_CP034553	Burkholderia cepacia ATCC 25416 chromosome 1, complete sequence	3781435	2467115	2559051	3781435	tail,transposase,plate,holin,portal,tRNA,head,terminase,protease,capsid,integrase	uncultured_Caudovirales_phage(25.64%)	91	2503521:2503543	2547321:2547343
WP_027787063.1|2467115_2468525_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_027787062.1|2468805_2469732_+	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	27.2	1.7e-07
WP_027787061.1|2469876_2470551_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	40.8	1.2e-20
WP_027787060.1|2470679_2472302_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.8e-20
WP_021162484.1|2472298_2473396_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_027787059.1|2473444_2474488_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_148668953.1|2474538_2475222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148668954.1|2476006_2476231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787057.1|2476546_2476912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011352504.1|2477241_2477574_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_021162482.1|2477574_2478183_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_021162481.1|2478182_2480189_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027787056.1|2480192_2481080_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027787055.1|2481350_2482880_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_138143286.1|2483474_2483852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787053.1|2484249_2484648_-	heme-binding protein	NA	NA	NA	NA	NA
WP_027787052.1|2484640_2485417_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_034195760.1|2485485_2486418_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027787050.1|2487040_2488294_-	aspartate kinase	NA	NA	NA	NA	NA
WP_027787049.1|2488637_2490059_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_006478433.1|2490105_2491077_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_027787048.1|2491180_2492008_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_027787047.1|2492051_2493449_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.9	4.1e-42
WP_027787046.1|2493683_2494406_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_021162660.1|2494445_2495027_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	38.5	1.2e-11
WP_006751616.1|2495115_2495607_+	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	29.6	1.7e-06
WP_027787045.1|2495634_2496435_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_021162662.1|2496493_2497267_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_027787044.1|2497574_2498399_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_027787043.1|2498679_2499483_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_027787042.1|2499808_2501431_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_100199223.1|2501584_2502328_-	AAA family ATPase	NA	NA	NA	NA	NA
2503521:2503543	attL	CCAATGATGCAGCAGTACCTGCG	NA	NA	NA	NA
WP_027787040.1|2503702_2504419_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_049096236.1|2504639_2505590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787038.1|2505783_2507262_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.8	4.5e-15
WP_081040819.1|2507486_2507810_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	48.0	1.4e-17
WP_059633410.1|2508215_2508827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080982199.1|2508714_2509185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787035.1|2509174_2509672_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_158605805.1|2509678_2510062_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_027787034.1|2510283_2511069_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	83.2	9.7e-134
WP_027787033.1|2511239_2511734_-	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	59.5	2.0e-39
WP_027787032.1|2511730_2512225_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	86.6	7.6e-76
WP_027787031.1|2512227_2512512_-|holin	holin	holin	C7BGD7	Burkholderia_phage	95.7	3.8e-40
WP_027787030.1|2512588_2513638_-	phage late control D protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.5	3.6e-83
WP_027789299.1|2513647_2513854_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	1.5e-14
WP_027787029.1|2513828_2514707_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.5	8.9e-35
WP_027787028.1|2514717_2517159_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	38.1	3.5e-57
WP_027787027.1|2517239_2517542_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	39.0	2.7e-07
WP_027787026.1|2517638_2518142_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	54.3	2.1e-44
WP_027787025.1|2518152_2519322_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	71.8	2.5e-157
WP_027787024.1|2519406_2520186_-|tail	tail assembly chaperone	tail	E5E3Q6	Burkholderia_phage	57.1	1.2e-56
WP_088611304.1|2521777_2522987_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.4	1.0e-97
WP_034195755.1|2523527_2524106_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	44.1	5.6e-30
WP_027787018.1|2524095_2524992_-|plate	baseplate J/gp47 family protein	plate	A0A218M4K5	Erwinia_phage	41.0	3.9e-46
WP_034195754.1|2524988_2525324_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	48.1	3.9e-23
WP_027787016.1|2525323_2525524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787015.1|2525583_2526264_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	28.5	4.9e-17
WP_027787014.1|2526267_2526792_-	hypothetical protein	NA	Q75QM3	Wolbachia_phage	41.2	1.1e-24
WP_027787013.1|2526781_2527312_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	31.0	9.2e-11
WP_027787012.1|2527314_2527602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787011.1|2527603_2528599_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	62.7	7.3e-118
WP_027787010.1|2528672_2529017_-|head	head decoration protein	head	NA	NA	NA	NA
WP_027787009.1|2529047_2530124_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	38.5	3.4e-52
WP_027787008.1|2530120_2531614_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.4	5.8e-135
WP_027787007.1|2531610_2531817_-	hypothetical protein	NA	A0A219Y8X9	Aeromonas_phage	52.1	8.5e-05
WP_034195753.1|2531830_2533942_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	1.1e-179
WP_027787004.1|2535482_2536325_-	DUF4747 family protein	NA	NA	NA	NA	NA
WP_027787003.1|2536690_2537278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787002.1|2537498_2540006_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	39.8	4.9e-94
WP_099318678.1|2540055_2540541_-	hypothetical protein	NA	K7ZPX8	Xanthomonas_citri_phage	33.5	2.1e-09
WP_027787000.1|2540818_2541202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034195752.1|2541203_2541761_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	47.1	3.5e-29
WP_080982019.1|2542120_2542549_+	transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	63.5	3.4e-16
WP_027786997.1|2543006_2543225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027786996.1|2543275_2543638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027786995.1|2543637_2545122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051363300.1|2545199_2545586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080982086.1|2545594_2545837_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	63.2	4.9e-20
WP_027786993.1|2545814_2547089_-|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	57.8	1.6e-146
WP_049098137.1|2547248_2549939_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.6	4.8e-23
2547321:2547343	attR	CCAATGATGCAGCAGTACCTGCG	NA	NA	NA	NA
WP_034195751.1|2549919_2551191_+	membrane protein	NA	NA	NA	NA	NA
WP_027786990.1|2551170_2551713_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027786989.1|2551745_2552966_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_034195863.1|2553197_2553461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027786988.1|2553574_2554351_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_027786987.1|2554355_2555501_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_027786986.1|2555612_2556518_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_027786985.1|2556566_2557169_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011352534.1|2557177_2558380_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_027786984.1|2558388_2559051_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 1
NZ_CP034554	Burkholderia cepacia ATCC 25416 chromosome 2, complete sequence	3396958	1080423	1089405	3396958	transposase	Burkholderia_virus(33.33%)	8	NA	NA
WP_021157319.1|1080423_1082286_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.2	1.1e-07
WP_027787261.1|1082531_1083791_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.5	1.5e-43
WP_027790962.1|1083981_1085223_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_027790963.1|1085236_1086553_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	56.6	6.9e-132
WP_027790964.1|1086676_1087588_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	46.8	2.5e-72
WP_027790965.1|1087964_1088168_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	5.4e-20
WP_021157316.1|1088448_1088673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027790966.1|1088994_1089405_+	TIGR02594 family protein	NA	A0A249Y3Q7	Serratia_phage	41.0	4.9e-28
>prophage 2
NZ_CP034554	Burkholderia cepacia ATCC 25416 chromosome 2, complete sequence	3396958	2087962	2094763	3396958		Burkholderia_phage(50.0%)	12	NA	NA
WP_027791737.1|2087962_2088634_-	SOS response-associated peptidase family protein	NA	Q8W6R8	Burkholderia_virus	76.1	2.7e-100
WP_027791738.1|2088688_2089180_+	hypothetical protein	NA	C7BGE3	Burkholderia_phage	90.8	1.8e-85
WP_034196056.1|2089223_2089703_-	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	55.5	2.8e-35
WP_027791740.1|2089699_2090248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051363314.1|2090313_2091150_-	phage antirepressor KilAC domain-containing protein	NA	A0A1W6JP13	Morganella_phage	36.2	1.7e-27
WP_138143377.1|2091149_2091416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080982032.1|2091498_2091657_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_034196057.1|2091768_2092302_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_027791742.1|2092314_2092812_-	lysozyme	NA	Q3HQU9	Burkholderia_phage	92.1	8.4e-83
WP_027791743.1|2092804_2092987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158605826.1|2093087_2093891_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_034196161.1|2094064_2094763_-	hypothetical protein	NA	A9YX14	Burkholderia_phage	54.9	1.5e-56
