The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	0	2770	4910422		Escherichia_phage(100.0%)	1	NA	NA
WP_000213098.1|2152_2770_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 2
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	5855	9070	4910422		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|5855_6596_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|6787_9070_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 3
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	13168	52667	4910422	transposase,head,tail,integrase,plate	Burkholderia_virus(44.74%)	56	38265:38280	57586:57601
WP_000057158.1|13168_14257_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|14327_15611_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|15866_16439_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_023142129.1|16947_17409_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_000072165.1|17415_18030_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_000527461.1|18029_19361_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.8e-40
WP_000138756.1|19363_19942_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|19934_21038_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|21028_21376_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|21430_22027_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|22023_23178_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_012602373.1|23165_23381_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|23377_24262_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|24261_27213_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|27288_27447_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|27370_27706_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|27803_28085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|28087_28609_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|28608_30036_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|30025_30280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|30276_30741_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|30740_31187_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|31188_31527_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|31536_32490_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|32504_33620_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|33834_34293_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|34295_35117_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|35097_36594_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000124060.1|38184_38730_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
38265:38280	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|38729_39041_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|39040_39367_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|39363_40014_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|39997_40738_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|40740_41091_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|41221_41950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|41925_42330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|42328_42544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|42734_43499_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|43615_43972_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|44065_44254_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|44306_44615_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|44625_45546_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|45545_45863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|45878_47648_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|47658_48825_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|48827_49097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|49124_49655_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000878812.1|49665_49887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|49943_50216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|50225_50522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|50536_50752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|50748_51432_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|51428_51659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|51648_51855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|51856_52306_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|52277_52667_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
57586:57601	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 4
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	56392	60932	4910422		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|56392_56677_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705731.1|56882_59147_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|59183_60932_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
>prophage 5
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	75637	87223	4910422	tRNA	Bacillus_virus(33.33%)	9	NA	NA
WP_001295932.1|75637_76186_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109456.1|76212_76860_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|76909_78100_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977908.1|78284_79373_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	2.8e-99
WP_000117888.1|79975_81376_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
WP_001295933.1|81544_82747_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193867.1|83012_85625_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_001090493.1|85667_86435_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
WP_023363144.1|86431_87223_-	aliphatic sulfonate ABC transporter permease SsuC	NA	G3M9Y4	Bacillus_virus	24.5	1.4e-15
>prophage 6
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	95190	97098	4910422		Tupanvirus(100.0%)	1	NA	NA
WP_000053085.1|95190_97098_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 7
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	109708	111763	4910422		Bacillus_phage(100.0%)	1	NA	NA
WP_001295938.1|109708_111763_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 8
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	115997	116657	4910422	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|115997_116657_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 9
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	127654	140071	4910422		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|127654_127867_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|127877_128066_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|128040_128271_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|128260_128434_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818460.1|128482_129556_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054734.1|129638_132371_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	1.8e-38
WP_001264949.1|132453_133482_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|133454_134147_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230247.1|134276_135449_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063148.1|135448_137995_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.8	1.5e-71
WP_000209903.1|137991_138591_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024569.1|138845_139151_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420625.1|139150_140071_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 10
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	143101	145201	4910422		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|143101_143275_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001295943.1|143357_144686_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	5.3e-233
WP_001028098.1|144706_145201_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 11
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	159522	160587	4910422		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258777.1|159522_160587_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.6e-91
>prophage 12
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	167405	168773	4910422		Bacillus_phage(100.0%)	1	NA	NA
WP_000409838.1|167405_168773_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	2.5e-20
>prophage 13
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	172164	172998	4910422		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189322.1|172164_172998_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 14
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	177135	177669	4910422		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|177135_177669_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 15
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	186976	187897	4910422		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|186976_187897_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 16
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	192558	192804	4910422		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|192558_192804_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 17
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	208684	209626	4910422		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295961.1|208684_209626_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 18
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	221982	223164	4910422		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|221982_222717_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|222927_223164_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 19
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	226436	228079	4910422		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257002.1|226436_227078_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267919.1|227074_228079_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 20
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	240401	240659	4910422		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|240401_240659_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 21
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	247945	251668	4910422		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|247945_248647_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251354.1|248646_249891_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291272.1|249919_250831_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952746.1|250846_251668_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 22
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	254943	256921	4910422		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799382.1|254943_255801_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	26.2	4.3e-10
WP_000531594.1|255784_256921_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 23
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	261942	302498	4910422	head,holin,lysis,tail,integrase,terminase,tRNA	Enterobacteria_phage(51.35%)	45	262311:262325	290904:290918
WP_000423736.1|261942_263313_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.9e-107
262311:262325	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295971.1|263316_263958_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001295972.1|263993_265100_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|265153_265615_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|265624_266278_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|266449_267700_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|267813_268956_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|268945_269182_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|269321_269561_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|269544_269871_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|269870_270092_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|270190_270472_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|270482_270674_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|270646_270829_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|270825_271506_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|271502_272288_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|272293_272590_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|272665_272872_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|273467_274157_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|274261_274492_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|274561_275101_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001435464.1|275187_276117_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_000788794.1|276113_276815_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|277064_281330_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|281366_282410_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|282759_282861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|282857_283313_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|283312_283483_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|283475_283766_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|283762_284125_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|284121_284262_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|284258_284948_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|285269_285575_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|285561_286038_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|286254_286437_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|286527_286821_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|287301_287628_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000453620.1|288579_289125_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|289099_291025_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
290904:290918	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|291021_291228_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295978.1|294133_294466_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_138976263.1|295999_296338_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.1	3.6e-53
WP_000459457.1|298486_298921_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_138976264.1|298913_301475_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.3	0.0e+00
WP_001499538.1|301799_302498_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	3.3e-133
>prophage 24
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	307397	317240	4910422		Enterobacteria_phage(60.0%)	13	NA	NA
WP_000290538.1|307397_309419_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|309415_309694_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000355360.1|309706_310000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968127.1|310091_310949_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101732.1|310945_311803_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983716.1|311799_312627_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	29.0	1.9e-07
WP_000555630.1|312626_313541_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001337534.1|313819_314104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304451.1|314239_314998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|315469_315622_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_023146274.1|315705_315831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373104.1|315883_316288_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332288.1|316508_317240_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	2.1e-53
>prophage 25
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	331436	333124	4910422		Morganella_phage(50.0%)	2	NA	NA
WP_000897376.1|331436_331856_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	6.9e-38
WP_000457596.1|331855_333124_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.5	9.6e-208
>prophage 26
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	340960	343377	4910422	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_000422741.1|340960_341386_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|341382_341733_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|341763_343377_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 27
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	351581	352340	4910422		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173310.1|351581_352340_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 28
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	370956	375615	4910422	integrase	Shigella_phage(33.33%)	8	370917:370930	377660:377673
370917:370930	attL	TCCGTTATTTCAGT	NA	NA	NA	NA
WP_001531625.1|370956_371226_-	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	58.7	3.4e-14
WP_006324788.1|371479_371836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063270541.1|372190_372583_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_000954131.1|372702_373164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000177770.1|373165_373618_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_023141324.1|373664_374594_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	28.5	4.4e-08
WP_000580009.1|374580_375195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095671.1|375417_375615_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	43.9	7.3e-06
377660:377673	attR	ACTGAAATAACGGA	NA	NA	NA	NA
>prophage 29
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	385801	393592	4910422	integrase,transposase,tRNA	Shigella_phage(25.0%)	8	379110:379124	398403:398417
379110:379124	attL	ATGTCCGCTTTGAGC	NA	NA	NA	NA
WP_077249438.1|385801_386656_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	1.6e-81
WP_000537155.1|386652_386937_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000954595.1|387047_388223_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	39.4	1.7e-73
WP_000505872.1|388437_389529_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000152940.1|389645_390230_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000823885.1|390507_390786_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_001033350.1|390840_392520_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
WP_001298109.1|392644_393592_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
398403:398417	attR	ATGTCCGCTTTGAGC	NA	NA	NA	NA
>prophage 30
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	396728	403006	4910422		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000804726.1|396728_397811_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456450.1|397810_398644_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200375.1|398640_399033_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|399036_399846_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|399881_400736_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001531632.1|400884_400992_-	small toxic polypeptide ldrA/ldrC	NA	NA	NA	NA	NA
WP_000063608.1|401396_402497_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000120702.1|402766_403006_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	39.0	2.6e-05
>prophage 31
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	414128	415667	4910422		Escherichia_phage(100.0%)	1	NA	NA
WP_000702647.1|414128_415667_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
>prophage 32
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	424320	430683	4910422		Synechococcus_phage(33.33%)	7	NA	NA
WP_000555842.1|424320_425163_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001311640.1|425212_425671_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|425783_426689_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193451.1|426780_427794_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|427995_428904_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|429048_429462_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068069.1|430065_430683_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.1	1.7e-53
>prophage 33
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	440249	442264	4910422		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110940.1|440249_441263_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|441259_442264_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 34
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	452226	455184	4910422		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001195273.1|452226_453585_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|453588_455184_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 35
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	464459	469751	4910422	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559273.1|464459_465218_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|465437_466487_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|466522_466774_-	YciN family protein	NA	NA	NA	NA	NA
WP_001304419.1|467153_469751_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 36
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	474661	475252	4910422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|474661_475252_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 37
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	483064	484999	4910422		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485012.1|483064_484999_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	2.8e-33
>prophage 38
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	493933	495951	4910422		Salmonella_phage(50.0%)	2	NA	NA
WP_000135013.1|493933_495097_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.2	5.6e-29
WP_000573407.1|495144_495951_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 39
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	515292	516375	4910422		Planktothrix_phage(100.0%)	1	NA	NA
WP_000068009.1|515292_516375_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.6e-22
>prophage 40
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	533599	534115	4910422		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|533599_534115_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 41
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	538887	548306	4910422	tRNA	Bacillus_phage(20.0%)	8	NA	NA
WP_001296045.1|538887_540120_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|540374_541358_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_123891623.1|541646_541877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000123789.1|541835_543209_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.5e-52
WP_001157412.1|543336_544272_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_071525889.1|545340_545520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295593.1|546597_547032_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837933.1|547172_548306_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
>prophage 42
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	553265	554255	4910422		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|553265_554255_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 43
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	569142	573045	4910422		Klosneuvirus(100.0%)	1	NA	NA
WP_000139528.1|569142_573045_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	1.7e-53
>prophage 44
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	576998	577947	4910422		Escherichia_phage(50.0%)	2	NA	NA
WP_001531678.1|576998_577529_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731859.1|577773_577947_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 45
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	589797	591759	4910422		Phage_TP(100.0%)	1	NA	NA
WP_012896797.1|589797_591759_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.6	3.5e-23
>prophage 46
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	595389	596403	4910422		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000220422.1|595389_596403_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	4.6e-27
>prophage 47
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	601900	604003	4910422		Salmonella_phage(100.0%)	1	NA	NA
WP_000689332.1|601900_604003_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.8	1.9e-136
>prophage 48
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	612966	614511	4910422		Escherichia_phage(100.0%)	1	NA	NA
WP_000702528.1|612966_614511_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 49
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	625756	627514	4910422		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|625756_626041_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642417.1|626503_627514_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	3.3e-25
>prophage 50
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	630918	633318	4910422		Klosneuvirus(100.0%)	1	NA	NA
WP_001296069.1|630918_633318_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	3.5e-09
>prophage 51
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	659621	661040	4910422		Bacillus_phage(100.0%)	1	NA	NA
WP_000558459.1|659621_661040_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 52
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	667783	668167	4910422		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091198.1|667783_668167_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 53
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	671169	672060	4910422		Bacillus_phage(100.0%)	1	NA	NA
WP_000592832.1|671169_672060_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-20
>prophage 54
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	676446	691030	4910422		Escherichia_phage(37.5%)	14	NA	NA
WP_000214712.1|676446_676650_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000526709.1|676685_678146_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.3e-43
WP_000151247.1|678234_679602_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000836081.1|679659_680679_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.3	3.7e-16
WP_001296083.1|680690_681905_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	8.2e-47
WP_000598292.1|682110_682437_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705204.1|682571_682913_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|682947_683508_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001296084.1|683510_684221_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001296085.1|684328_684634_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041660.1|684832_687259_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_000213028.1|688899_689517_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526467.1|689518_690373_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148693.1|690415_691030_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 55
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	708792	710094	4910422		Bacillus_phage(100.0%)	1	NA	NA
WP_000732519.1|708792_710094_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	2.5e-17
>prophage 56
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	719989	721801	4910422		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945867.1|719989_721801_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 57
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	741883	743158	4910422	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|741883_743158_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 58
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	750069	751568	4910422		Salmonella_phage(50.0%)	2	NA	NA
WP_001296099.1|750069_750591_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	1.7e-46
WP_000250634.1|750671_751568_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	2.1e-07
>prophage 59
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	755983	764787	4910422		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101207.1|755983_756811_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007273.1|756938_757520_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	44.8	3.1e-44
WP_000701057.1|757665_758835_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|759000_759090_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190985.1|759388_760414_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
WP_000269498.1|760410_761343_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182336.1|761455_762667_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|762957_764106_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|764145_764787_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 60
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	770292	772559	4910422		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587585.1|770292_771105_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001070015.1|771108_771894_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001296101.1|771890_772559_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.7e-22
>prophage 61
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	780847	785931	4910422		environmental_halophage(33.33%)	5	NA	NA
WP_000144583.1|780847_782068_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.7	4.4e-93
WP_000907957.1|782064_783336_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948882.1|783310_784057_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_001296103.1|784066_785554_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367158.1|785562_785931_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
>prophage 62
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	804350	823945	4910422	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553669.1|804350_806051_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.8e-31
WP_000069403.1|806107_808486_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
WP_000368046.1|808818_809652_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|809808_810855_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270810.1|810986_811178_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175632.1|811181_812618_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001296111.1|812680_813394_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209785.1|813641_814106_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029460.1|814183_814933_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|814932_815484_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956533.1|815546_816527_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|816627_816927_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672320.1|816931_819319_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|819333_820317_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|820600_820645_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|820767_821124_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|821176_821374_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|821470_822013_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144199.1|822016_823945_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.6e-129
>prophage 63
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	833316	835578	4910422		Tupanvirus(100.0%)	1	NA	NA
WP_000077883.1|833316_835578_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	5.1e-143
>prophage 64
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	841703	842531	4910422		Bacillus_virus(100.0%)	1	NA	NA
WP_000175016.1|841703_842531_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	3.5e-73
>prophage 65
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	850007	851228	4910422		Klosneuvirus(100.0%)	1	NA	NA
WP_000082031.1|850007_851228_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	3.2e-27
>prophage 66
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	857991	858645	4910422		Bacillus_phage(100.0%)	1	NA	NA
WP_001296116.1|857991_858645_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 67
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	863035	864991	4910422		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235830.1|863035_864991_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 68
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	870708	874794	4910422		Tupanvirus(50.0%)	4	NA	NA
WP_001135068.1|870708_871350_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
WP_001524794.1|871442_872801_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719098.1|872918_873677_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723696.1|873813_874794_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	3.0e-07
>prophage 69
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	883607	884462	4910422		Indivirus(100.0%)	1	NA	NA
WP_001296125.1|883607_884462_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 70
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	887780	892357	4910422		Bacillus_phage(100.0%)	3	NA	NA
WP_000219684.1|887780_889064_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621382.1|889210_890686_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001296127.1|890866_892357_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 71
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	901324	909430	4910422	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|901324_903010_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290577.1|903214_903796_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220974.1|903835_904531_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128874.1|904588_906499_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.2	1.7e-91
WP_001295493.1|906630_906975_+	RidA family protein	NA	NA	NA	NA	NA
WP_071525875.1|907336_907696_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|907815_907995_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854961.1|908068_909430_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	1.7e-40
>prophage 72
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	913292	914849	4910422		Moraxella_phage(100.0%)	1	NA	NA
WP_138976269.1|913292_914849_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	2.3e-41
>prophage 73
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	920490	920700	4910422		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|920490_920700_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 74
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	926032	928081	4910422		Moraxella_phage(100.0%)	1	NA	NA
WP_001055794.1|926032_928081_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 75
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	935576	940045	4910422		Escherichia_phage(33.33%)	7	NA	NA
WP_000812745.1|935576_936233_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	2.3e-56
WP_000976472.1|936627_936969_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879317.1|936981_937854_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|937857_938232_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|938370_938601_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_138976270.1|938702_939359_+	C-N hydrolase family protein YobB	NA	NA	NA	NA	NA
WP_000944256.1|939382_940045_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 76
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	948101	949577	4910422		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|948101_949577_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 77
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	953575	1045902	4910422	transposase,holin,portal,tail,integrase,plate,terminase,tRNA,capsid	Escherichia_phage(21.28%)	109	1003352:1003411	1045964:1046088
WP_001184045.1|953575_954898_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001347089.1|954913_955846_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|955924_956680_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571478.1|956676_957462_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_099156422.1|957655_959004_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
WP_000568520.1|959113_960124_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|960132_960744_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|960882_960948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024911.1|961018_961621_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|961622_962144_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|962178_962919_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|962947_963400_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|963392_965165_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|965474_966041_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|966037_966856_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|966908_967304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|967344_968088_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|968084_969056_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|969091_971521_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|971545_972646_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|973033_973780_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|973793_974360_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|974575_976309_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|976361_976754_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|976753_978832_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|978824_979973_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|980161_980806_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|980816_981206_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|981220_982270_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|982272_983133_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|983423_985085_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|985229_985733_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|985753_987718_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|987722_988649_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|988645_989533_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|989659_990238_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|990240_990591_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|991370_991799_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|991805_993230_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|993204_994005_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|994171_995158_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|995172_996687_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|996756_997746_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|998540_999044_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|999121_999373_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|999487_999574_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|999837_1000161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|1000332_1000830_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1000867_1001107_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|1001297_1002509_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|1002559_1003225_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1003352:1003411	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|1003696_1004116_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|1005330_1005555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531768.1|1005716_1006106_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|1006141_1007782_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|1007890_1008172_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|1008184_1008697_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000117510.1|1008714_1010217_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|1010213_1010603_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|1010602_1011787_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|1011779_1012406_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|1012408_1013329_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|1013325_1013667_-|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|1013669_1014572_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|1014552_1015089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|1015085_1015766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|1015797_1016178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|1016174_1016594_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|1016628_1017663_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|1017721_1018051_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|1018050_1019358_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|1019357_1020932_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|1020928_1021162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|1021161_1023024_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|1023010_1023577_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|1023945_1024191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|1024250_1024445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|1024452_1024932_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|1024931_1025204_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|1025203_1025587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|1025699_1026371_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|1026370_1026664_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|1026660_1027257_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|1027334_1027514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|1027665_1028307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|1028550_1028784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|1029182_1029671_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|1029680_1030286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|1030748_1031447_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|1032635_1033559_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|1033733_1034522_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000466605.1|1034794_1035016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661082.1|1035203_1035428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|1035424_1035736_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|1035732_1035969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|1035970_1036381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|1036419_1037835_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|1037824_1038580_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|1038576_1038801_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|1038840_1039317_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|1039375_1039606_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|1039704_1040118_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|1041128_1041449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|1041479_1043696_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|1043692_1044262_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|1044261_1044444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023142603.1|1044493_1044718_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	56.3	7.3e-10
WP_000833838.1|1044653_1044917_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|1044885_1045902_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
1045964:1046088	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 78
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1051278	1052031	4910422		Bacillus_virus(100.0%)	1	NA	NA
WP_001273000.1|1051278_1052031_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 79
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1063415	1164388	4910422	transposase,head,holin,protease,portal,tail,integrase,terminase,capsid	Escherichia_phage(30.36%)	108	1126738:1126753	1166669:1166684
WP_000334561.1|1063415_1063913_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.2	7.7e-52
WP_023142167.1|1063794_1064124_-	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	85.6	4.0e-41
WP_001347174.1|1064146_1064671_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_000879824.1|1064827_1065625_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|1065634_1066186_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|1066354_1066687_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_023142598.1|1066786_1066999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001274299.1|1067030_1067345_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994425.1|1067559_1069218_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|1069210_1070206_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282677.1|1070198_1070885_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213308.1|1070884_1072258_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|1072276_1072720_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620069.1|1072716_1073844_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|1073948_1074413_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|1074417_1075422_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282103.1|1075418_1075832_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001313947.1|1075834_1076200_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253318.1|1076199_1076937_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|1076946_1077216_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983988.1|1077224_1078010_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103992.1|1078299_1078923_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|1078966_1079209_-	protein DsrB	NA	NA	NA	NA	NA
WP_001347685.1|1079141_1079330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000844800.1|1079317_1079545_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491527.1|1079840_1080656_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001531784.1|1080652_1082347_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|1082517_1082700_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|1082778_1083696_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|1083868_1084789_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|1084777_1085248_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157265.1|1085228_1086647_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001296176.1|1086713_1087409_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001330593.1|1087448_1087814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000897312.1|1087906_1088110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000824383.1|1088379_1089495_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_000218217.1|1090087_1090939_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826711.1|1091046_1092405_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|1092404_1093076_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|1093208_1093622_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740067.1|1093730_1094735_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240063.1|1094735_1095371_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_099156434.1|1095454_1096803_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001007778.1|1097063_1097714_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_016245365.1|1098794_1099082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204583.1|1099091_1099370_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	46.2	3.0e-21
WP_016245366.1|1099366_1101430_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	1.1e-147
WP_016245367.1|1101581_1102181_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	5.7e-102
WP_061091866.1|1102248_1105947_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	74.6	0.0e+00
WP_000090944.1|1106007_1106616_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.6	7.6e-102
WP_106108511.1|1106552_1107296_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	1.8e-145
WP_001152453.1|1107300_1107999_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	8.1e-132
WP_001115181.1|1107998_1108340_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	7.1e-41
WP_138976272.1|1108332_1111572_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	97.6	0.0e+00
WP_071590020.1|1111618_1111879_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_001312914.1|1111920_1112307_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_001441850.1|1112306_1113011_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	94.4	1.8e-115
WP_047627858.1|1113070_1113415_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	99.1	1.6e-56
WP_014639219.1|1113411_1113861_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
WP_021573342.1|1113857_1114196_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	89.3	2.2e-50
WP_000719066.1|1114204_1114522_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766109.1|1114598_1115816_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|1115830_1116430_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923132.1|1116422_1117649_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	1.5e-202
WP_138976273.1|1117796_1119554_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.1	0.0e+00
WP_097365726.1|1119553_1120036_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	9.6e-84
WP_001139555.1|1120183_1120534_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	99.1	1.5e-65
WP_077487348.1|1120638_1120821_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	73.8	4.2e-16
WP_000992099.1|1121037_1121571_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.8e-99
WP_000193274.1|1121634_1121985_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000839572.1|1121989_1122205_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_021526742.1|1123102_1123984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021526743.1|1123999_1124263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024190350.1|1124252_1124651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138976320.1|1124686_1125052_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	88.3	7.1e-55
WP_138976274.1|1125044_1125416_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.7e-35
WP_042052797.1|1125428_1126475_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	2.2e-109
WP_023141427.1|1126476_1126749_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_138976275.1|1126695_1126935_+	hypothetical protein	NA	NA	NA	NA	NA
1126738:1126753	attL	TTTGTGCGCCATCTGT	NA	NA	NA	NA
WP_000813254.1|1126916_1127072_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000786207.1|1127330_1127510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289994.1|1127630_1128146_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
WP_029701087.1|1128311_1128494_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	3.1e-27
WP_000403785.1|1128587_1128944_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001209475.1|1128921_1129383_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_001266134.1|1129379_1129676_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_048958880.1|1129672_1130095_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.5e-64
WP_042198652.1|1130135_1131206_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	5.0e-64
WP_000693850.1|1131277_1131703_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261754.1|1131699_1131927_-	cell division control protein	NA	NA	NA	NA	NA
WP_000444613.1|1132026_1132671_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	8.8e-08
WP_042198646.1|1133009_1133309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|1133380_1133599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573395.1|1133602_1133767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854564.1|1134166_1134355_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070253.1|1134351_1134540_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_138976276.1|1134633_1137075_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.1	8.6e-112
WP_000096344.1|1137133_1137337_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001335889.1|1137336_1138362_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	1.2e-102
WP_001311896.1|1138597_1139395_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060157.1|1139732_1140995_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
WP_000703040.1|1141188_1142493_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286284.1|1142520_1143801_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000654452.1|1143793_1145596_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_000098394.1|1145582_1147385_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	6.5e-32
WP_000140402.1|1147551_1148511_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623045.1|1148701_1154809_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000369500.1|1154896_1164388_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
1166669:1166684	attR	ACAGATGGCGCACAAA	NA	NA	NA	NA
>prophage 80
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1191314	1193167	4910422		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502870.1|1191314_1191959_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_001542270.1|1191943_1193167_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	2.0e-61
>prophage 81
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1207884	1244182	4910422	transposase	Stx2-converting_phage(21.43%)	43	NA	NA
WP_001296203.1|1207884_1209081_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001304240.1|1209204_1209483_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000813432.1|1209576_1210179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001327829.1|1210652_1210868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093906.1|1211204_1211900_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	2.3e-118
WP_000255956.1|1211896_1212919_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_089438313.1|1213064_1213244_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001304235.1|1213469_1213847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001331901.1|1213773_1214034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296206.1|1214443_1215589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163787.1|1216119_1216377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000016207.1|1216430_1217198_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_000217077.1|1217194_1218253_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000778018.1|1218271_1219261_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000856948.1|1219271_1221437_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001069649.1|1221865_1222300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531797.1|1222517_1224902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203551.1|1224898_1225804_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102633.1|1225800_1226871_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_001542273.1|1227006_1227420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298859.1|1227534_1229076_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1229090_1229837_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000422741.1|1230391_1230817_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1230813_1231164_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|1231194_1232808_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_138976321.1|1232864_1233236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|1233456_1234275_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|1234274_1234520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|1234613_1235087_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|1235102_1235579_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|1235641_1235863_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|1235881_1236526_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_001280918.1|1236541_1236910_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854815.1|1236998_1237373_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|1237369_1237564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|1237576_1237690_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001296208.1|1238178_1238361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|1238461_1238791_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001200889.1|1238962_1240021_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105368.1|1240218_1240692_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001296209.1|1240810_1241977_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_000980556.1|1242185_1243613_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001531805.1|1243723_1244182_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
>prophage 82
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1248886	1249786	4910422		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1248886_1249786_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 83
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1257228	1260048	4910422		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704867.1|1257228_1258395_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	2.2e-110
WP_000043486.1|1258641_1260048_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	2.3e-37
>prophage 84
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1267328	1272062	4910422		Enterobacteria_phage(80.0%)	5	NA	NA
WP_001100793.1|1267328_1267871_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|1267875_1268754_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|1268811_1269711_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|1269710_1270796_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|1271168_1272062_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
>prophage 85
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1279536	1286242	4910422		Bacillus_phage(25.0%)	6	NA	NA
WP_001296216.1|1279536_1280907_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
WP_000079263.1|1281011_1282448_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699670.1|1282450_1283674_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479831.1|1283670_1284150_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043618.1|1284152_1285118_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.4	2.9e-87
WP_000048190.1|1285120_1286242_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 86
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1290559	1301165	4910422		Catovirus(40.0%)	8	NA	NA
WP_000654487.1|1290559_1291399_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
WP_000137092.1|1291527_1293690_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
WP_000482899.1|1293692_1294136_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978080.1|1294141_1295281_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001296218.1|1295940_1297524_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252365.1|1297975_1299829_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|1299850_1300432_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|1300523_1301165_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 87
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1305888	1307241	4910422		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469704.1|1305888_1307241_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 88
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1320348	1326622	4910422	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675176.1|1320348_1321752_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|1321748_1322471_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|1322650_1322983_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|1323129_1324491_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001531820.1|1324990_1325308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138976279.1|1325722_1326622_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	1.7e-12
>prophage 89
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1335760	1339317	4910422		Serratia_phage(50.0%)	4	NA	NA
WP_000846228.1|1335760_1336765_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011972.1|1336761_1337727_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434047.1|1337700_1338447_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296225.1|1338498_1339317_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
>prophage 90
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1349966	1352000	4910422	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001296226.1|1349966_1352000_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
>prophage 91
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1367806	1377251	4910422		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|1367806_1368943_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|1368939_1370943_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|1371067_1371529_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|1371569_1372040_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1372086_1372806_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1372802_1374488_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|1374709_1375441_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|1375500_1375608_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|1375588_1376320_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|1376324_1377251_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 92
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1397605	1399126	4910422		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|1397605_1399126_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 93
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1402820	1406606	4910422		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1402820_1403489_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425450.1|1403746_1404583_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489277.1|1404614_1406606_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
>prophage 94
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1410674	1411532	4910422		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|1410674_1411532_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 95
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1425697	1429998	4910422		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001296238.1|1425697_1427164_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.3e-43
WP_000198798.1|1427281_1428268_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001296239.1|1428306_1429020_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1429431_1429998_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 96
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1435752	1443402	4910422		Vibrio_phage(50.0%)	7	NA	NA
WP_000194884.1|1435752_1437342_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	2.5e-19
WP_000202798.1|1437345_1437690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213379.1|1438023_1439214_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_001234850.1|1439241_1439937_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578064.1|1440086_1441847_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	4.9e-101
WP_000494186.1|1441971_1442256_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1442394_1443402_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 97
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1453460	1454078	4910422		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|1453460_1454078_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 98
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1462846	1468642	4910422		Bacillus_phage(25.0%)	5	NA	NA
WP_000422200.1|1462846_1464490_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.6e-13
WP_000884927.1|1464565_1465216_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
WP_000872491.1|1465215_1466280_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000406076.1|1466353_1467409_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865587.1|1467520_1468642_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	2.0e-116
>prophage 99
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1472919	1477762	4910422		Hokovirus(50.0%)	2	NA	NA
WP_000876055.1|1472919_1475769_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.1e-41
WP_001296244.1|1475935_1477762_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
>prophage 100
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1492685	1506503	4910422		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281226.1|1492685_1495313_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990769.1|1495459_1496182_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_012896818.1|1496321_1500080_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.6	1.3e-21
WP_001075170.1|1500761_1503047_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|1503135_1504266_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|1504265_1504520_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301031.1|1504573_1505224_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779086.1|1505426_1506503_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 101
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1512395	1517038	4910422	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140602.1|1512395_1513391_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	56.1	1.8e-68
WP_000150331.1|1513403_1513625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032152265.1|1513665_1514469_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001296249.1|1514486_1515776_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296250.1|1515832_1517038_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
>prophage 102
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1520641	1525645	4910422		Tupanvirus(50.0%)	4	NA	NA
WP_000879110.1|1520641_1521244_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
WP_000012638.1|1521551_1522691_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.8	4.2e-29
WP_000461638.1|1522694_1523663_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.5e-35
WP_000860311.1|1523662_1525645_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
>prophage 103
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1560606	1563834	4910422		Salmonella_phage(50.0%)	3	NA	NA
WP_000813854.1|1560606_1561206_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012895.1|1561264_1563097_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203415.1|1563183_1563834_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
>prophage 104
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1574504	1575278	4910422		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_001293592.1|1574504_1575278_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 105
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1579489	1581007	4910422		Mollivirus(100.0%)	1	NA	NA
WP_000334229.1|1579489_1581007_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.2	1.6e-87
>prophage 106
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1587665	1588802	4910422		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699128.1|1587665_1588802_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	8.5e-22
>prophage 107
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1597338	1598424	4910422		Pandoravirus(100.0%)	1	NA	NA
WP_001296258.1|1597338_1598424_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 108
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1614557	1623954	4910422	integrase	Enterobacteria_phage(60.0%)	9	1614322:1614337	1632012:1632027
1614322:1614337	attL	CCGTATCCGCCTGTTT	NA	NA	NA	NA
WP_000368123.1|1614557_1615490_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
WP_000926944.1|1615800_1616976_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	63.0	2.8e-145
WP_000287253.1|1616955_1617906_-	sce7725 family protein	NA	NA	NA	NA	NA
WP_000019149.1|1617927_1618809_-	sce7726 family protein	NA	NA	NA	NA	NA
WP_000783295.1|1619488_1619761_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	50.0	3.2e-20
WP_000856856.1|1620043_1622731_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	35.0	4.2e-112
WP_001063904.1|1622727_1623138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839713.1|1623130_1623367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111085.1|1623363_1623954_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	49.2	4.4e-22
1632012:1632027	attR	CCGTATCCGCCTGTTT	NA	NA	NA	NA
>prophage 109
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1628906	1629827	4910422		Morganella_phage(100.0%)	1	NA	NA
WP_000484018.1|1628906_1629827_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 110
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1633646	1634381	4910422		Clostridioides_phage(100.0%)	1	NA	NA
WP_001296275.1|1633646_1634381_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	2.7e-13
>prophage 111
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1659919	1681647	4910422		Streptococcus_phage(25.0%)	23	NA	NA
WP_000443709.1|1659919_1661935_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	5.0e-150
WP_001296279.1|1662005_1663004_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1663233_1663995_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1664179_1665151_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1665534_1665792_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623108.1|1665836_1667564_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1667604_1668114_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096640.1|1668156_1669008_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719965.1|1669112_1669481_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000105467.1|1669483_1670395_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
WP_000021034.1|1670529_1671627_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	2.8e-30
WP_000852686.1|1671616_1672492_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458408.1|1672491_1673325_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290263.1|1673324_1674341_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517443.1|1674498_1675290_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_077779535.1|1675430_1675661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001175628.1|1675569_1676466_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_001040496.1|1676469_1677894_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000084590.1|1678071_1678971_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838953.1|1679066_1679642_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001296281.1|1679702_1680152_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406012.1|1680138_1680564_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102910.1|1680777_1681647_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 112
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1700301	1701252	4910422		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1700301_1701252_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 113
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1718493	1719207	4910422		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1718493_1719207_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 114
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1726685	1730687	4910422		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198327.1|1726685_1727975_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_001295473.1|1728060_1728687_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001296287.1|1729011_1730049_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
WP_001028626.1|1730048_1730687_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 115
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1737122	1743405	4910422		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|1737122_1737296_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669398.1|1737600_1738116_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|1738131_1738671_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000138282.1|1738763_1740341_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|1740409_1741876_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000937876.1|1742037_1743405_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	41.2	2.3e-45
>prophage 116
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1763898	1764330	4910422		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|1763898_1764330_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 117
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1774215	1780553	4910422		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133610.1|1774215_1775499_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
WP_000523612.1|1775557_1775758_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|1775769_1776105_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|1776106_1777957_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|1777973_1778489_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1778584_1778908_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1778924_1779311_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1779338_1780553_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 118
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1790538	1792068	4910422		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000493440.1|1790538_1792068_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.4	6.5e-09
>prophage 119
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1797826	1809135	4910422		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1797826_1799080_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883165.1|1799408_1800599_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1800643_1800982_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001296298.1|1801042_1802377_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215903.1|1802366_1803080_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001296299.1|1803244_1804672_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.9e-16
WP_001531893.1|1805247_1809135_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.1e-129
>prophage 120
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1813254	1813515	4910422		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196297.1|1813254_1813515_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 121
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1816974	1820716	4910422		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1816974_1817655_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1817926_1818901_-	signal peptidase I	NA	NA	NA	NA	NA
WP_001531895.1|1818916_1820716_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 122
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1826487	1832570	4910422	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|1826487_1827822_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001296304.1|1827854_1828736_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|1828838_1829426_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1829481_1829865_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|1830169_1830859_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997384.1|1830906_1831944_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1832150_1832570_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 123
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1837863	1839162	4910422		Burkholderia_virus(100.0%)	1	NA	NA
WP_000852119.1|1837863_1839162_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
>prophage 124
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1844948	1847522	4910422		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1844948_1847522_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 125
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1853427	1854498	4910422		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|1853427_1854498_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 126
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1868905	1869388	4910422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|1868905_1869388_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 127
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1874398	1878449	4910422		Klosneuvirus(50.0%)	4	NA	NA
WP_000625041.1|1874398_1875679_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	3.8e-34
WP_001296312.1|1875915_1877316_+	GABA permease	NA	NA	NA	NA	NA
WP_000156817.1|1877336_1877999_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|1877999_1878449_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 128
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1882383	1887680	4910422		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1882383_1882629_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|1882625_1883036_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246582.1|1883008_1885153_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.9e-196
WP_000777934.1|1885162_1886122_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	1.4e-134
WP_000985509.1|1886477_1887680_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 129
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1902421	1907808	4910422	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1902421_1902607_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047157.1|1902841_1905472_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	9.3e-80
WP_000140501.1|1905600_1906101_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1906169_1907231_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140273.1|1907310_1907808_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	9.8e-31
>prophage 130
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1913591	1914557	4910422		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287403.1|1913591_1914557_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.6	2.7e-37
>prophage 131
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1938571	1945711	4910422		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|1938571_1941133_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|1941238_1941895_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001296319.1|1941945_1942713_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|1942908_1943817_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|1943813_1945076_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|1945072_1945711_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 132
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1950077	1953793	4910422		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|1950077_1951070_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272593.1|1951132_1952272_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1952411_1953038_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1953031_1953793_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 133
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1956903	1958936	4910422		Tupanvirus(50.0%)	2	NA	NA
WP_001173651.1|1956903_1957509_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	1.9e-28
WP_001090370.1|1957508_1958936_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 134
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1973587	1974373	4910422		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021342.1|1973587_1974373_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 135
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1981674	1989899	4910422		Bacillus_phage(25.0%)	5	NA	NA
WP_012896831.1|1981674_1983084_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	22.9	1.9e-15
WP_001199974.1|1984978_1985650_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
WP_001268442.1|1985943_1986816_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|1986875_1988174_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1988261_1989899_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 136
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	1993295	1997410	4910422		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046817.1|1993295_1994597_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.0e-38
WP_000186432.1|1994653_1997410_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.4e-54
>prophage 137
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2004942	2005791	4910422		Vibrio_phage(100.0%)	1	NA	NA
WP_000100405.1|2004942_2005791_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	6.1e-41
>prophage 138
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2010649	2011405	4910422		Bacillus_phage(100.0%)	1	NA	NA
WP_001296330.1|2010649_2011405_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 139
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2022981	2025487	4910422	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_001296332.1|2022981_2024187_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	4.6e-74
WP_000184272.1|2024186_2024630_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117716.1|2024680_2025487_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
>prophage 140
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2034320	2045364	4910422		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000147344.1|2034320_2036957_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	3.2e-96
WP_001576295.1|2036968_2039293_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.0	1.9e-15
WP_138976284.1|2039304_2041668_+	M23 family peptidase	NA	A7IYC3	Corynebacterium_phage	27.3	8.8e-05
WP_001531916.1|2041664_2042522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543768.1|2042985_2045364_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.0	1.9e-15
>prophage 141
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2048729	2051243	4910422		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000354273.1|2048729_2051243_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	45.3	4.1e-08
>prophage 142
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2055530	2057833	4910422	transposase	Acidithiobacillus_phage(50.0%)	2	NA	NA
WP_001298859.1|2055530_2057072_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2057086_2057833_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
>prophage 143
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2069115	2070731	4910422		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_001296341.1|2069115_2070063_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.2	5.8e-16
WP_001066226.1|2070134_2070731_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
>prophage 144
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2074602	2085750	4910422		Bacillus_phage(25.0%)	5	NA	NA
WP_000016907.1|2074602_2075856_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237953.1|2076087_2077419_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775933.1|2077500_2079327_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	3.0e-24
WP_001296343.1|2079326_2082869_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	5.2e-09
WP_001138102.1|2082861_2085750_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.5	1.2e-67
>prophage 145
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2091227	2092022	4910422		Geobacillus_virus(100.0%)	1	NA	NA
WP_000816232.1|2091227_2092022_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 146
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2097286	2098000	4910422		Moraxella_phage(100.0%)	1	NA	NA
WP_000895624.1|2097286_2098000_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 147
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2107631	2110126	4910422		Aichi_virus(50.0%)	2	NA	NA
WP_000256426.1|2107631_2109050_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|2109364_2110126_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 148
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2114412	2115168	4910422		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|2114412_2115168_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 149
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2139446	2154838	4910422	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280189.1|2139446_2140847_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001296347.1|2140864_2142181_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012167.1|2142216_2143584_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_000838415.1|2143619_2144108_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_138976286.1|2144107_2146027_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001296348.1|2146462_2147911_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	2.1e-25
WP_001050745.1|2147912_2148038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2148034_2148106_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192798.1|2148160_2148709_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|2148751_2150269_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|2150278_2151377_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813195.1|2151467_2153201_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	4.1e-60
WP_000715230.1|2153206_2153917_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|2153941_2154838_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 150
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2158643	2163116	4910422		Pandoravirus(50.0%)	2	NA	NA
WP_001296350.1|2158643_2160077_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	1.1e-31
WP_000195012.1|2160242_2163116_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
>prophage 151
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2171252	2172485	4910422		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2171252_2172485_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 152
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2185992	2186670	4910422		Bacillus_virus(100.0%)	1	NA	NA
WP_000956881.1|2185992_2186670_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	4.9e-09
>prophage 153
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2192373	2193282	4910422		Yersinia_phage(100.0%)	1	NA	NA
WP_000646924.1|2192373_2193282_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
>prophage 154
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2201649	2202804	4910422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2201649_2202804_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 155
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2228570	2229836	4910422	integrase	Enterobacteria_phage(100.0%)	1	2221979:2221993	2230571:2230585
2221979:2221993	attL	GTTACGCACTGGCGC	NA	NA	NA	NA
WP_001218869.1|2228570_2229836_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001218869.1|2228570_2229836_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
2230571:2230585	attR	GTTACGCACTGGCGC	NA	NA	NA	NA
>prophage 156
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2267188	2268361	4910422		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524942.1|2267188_2268361_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 157
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2290536	2291421	4910422		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|2290536_2291421_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 158
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2297264	2304583	4910422		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000013152.1|2297264_2298092_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
WP_000691604.1|2298291_2299218_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|2299268_2299526_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095204.1|2299567_2301787_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000438655.1|2302038_2302788_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296416.1|2303110_2304583_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.7	4.5e-47
>prophage 159
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2312041	2317081	4910422		Bacillus_virus(50.0%)	4	NA	NA
WP_001281848.1|2312041_2314300_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	3.1e-84
WP_001296417.1|2314437_2316045_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183485.1|2316153_2316636_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|2316688_2317081_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 160
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2324924	2337370	4910422		uncultured_Caudovirales_phage(16.67%)	11	NA	NA
WP_000986428.1|2324924_2325908_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
WP_000940874.1|2325904_2326714_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
WP_001240664.1|2327087_2329229_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000195275.1|2329292_2331185_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	4.5e-92
WP_000105733.1|2331213_2331795_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444744.1|2331794_2332622_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2332646_2333069_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|2333069_2333699_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735289.1|2333903_2335385_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2335532_2336204_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442882.1|2336209_2337370_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	7.7e-87
>prophage 161
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2348609	2349263	4910422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|2348609_2349263_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 162
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2353176	2354610	4910422		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|2353176_2354610_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 163
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2359747	2360986	4910422	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708473.1|2359747_2360986_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.0	3.8e-92
>prophage 164
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2367286	2383434	4910422	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264377.1|2367286_2368300_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
WP_001144069.1|2368537_2368753_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918810.1|2368863_2370609_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.9e-76
WP_000437380.1|2370803_2372645_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2372722_2373229_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001066500.1|2373482_2374247_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000017999.1|2374534_2375158_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094714.1|2375264_2376785_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	4.0e-35
WP_000633381.1|2377091_2378582_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450588.1|2378623_2378956_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212450.1|2379174_2380158_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082927.1|2380341_2383434_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.4	2.6e-158
>prophage 165
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2396866	2397832	4910422		Escherichia_phage(100.0%)	1	NA	NA
WP_001098827.1|2396866_2397832_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 166
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2415145	2421190	4910422	transposase	Shigella_phage(50.0%)	4	NA	NA
WP_085949154.1|2415145_2416292_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000622122.1|2417056_2418421_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000719990.1|2418492_2418882_-	enamine/imine deaminase	NA	NA	NA	NA	NA
WP_000861714.1|2418895_2421190_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.1	2.0e-158
>prophage 167
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2427344	2428490	4910422		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296434.1|2427344_2428490_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.7e-50
>prophage 168
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2446110	2453906	4910422		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809258.1|2446110_2446974_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_000249175.1|2447038_2449075_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246833.1|2449032_2449428_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|2449447_2450038_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|2450047_2450623_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147602.1|2450735_2451776_-	permease	NA	NA	NA	NA	NA
WP_001296438.1|2451848_2452484_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001296439.1|2452611_2453130_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.6	4.4e-10
WP_000449450.1|2453109_2453553_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189328.1|2453603_2453906_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 169
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2459608	2461498	4910422		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2459608_2461498_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 170
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2466979	2473618	4910422		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133040.1|2466979_2469652_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
WP_001031057.1|2469676_2471164_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2471191_2471644_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|2472274_2473618_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 171
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2477698	2480571	4910422	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764749.1|2477698_2478547_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.6	7.5e-23
WP_001107467.1|2478636_2480571_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 172
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2487200	2488683	4910422		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2487200_2488172_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|2488404_2488683_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 173
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2492751	2507545	4910422		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2492751_2493561_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922880.1|2493770_2494748_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2494761_2495748_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|2495768_2496335_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2496331_2496907_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2496875_2497433_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2497439_2498165_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|2498212_2499646_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2499668_2499956_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183674.1|2500073_2500565_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2500610_2501465_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2501461_2501734_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|2501946_2502579_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047069.1|2502575_2503304_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719791.1|2503300_2503954_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809780.1|2504183_2506520_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001296449.1|2506615_2507545_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 174
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2516248	2520259	4910422	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_000108477.1|2516248_2517739_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
WP_000224714.1|2517847_2518741_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000074796.1|2518862_2519654_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366127.1|2519761_2520259_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 175
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2524226	2525594	4910422	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001296452.1|2524226_2525594_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
>prophage 176
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2543239	2544283	4910422		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2543239_2544283_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 177
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2553569	2558081	4910422		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000132912.1|2553569_2555069_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.8	1.4e-11
WP_001296455.1|2555129_2556020_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275542.1|2556055_2556910_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843962.1|2557250_2558081_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 178
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2563417	2564302	4910422		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258951.1|2563417_2564302_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 179
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2570806	2574960	4910422		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738587.1|2570806_2571832_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_001120549.1|2571899_2573081_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001296459.1|2573090_2574194_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078344.1|2574201_2574960_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 180
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2585300	2586772	4910422	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2585300_2585810_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004421.1|2585824_2586772_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 181
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2607996	2609949	4910422		Vibrio_phage(100.0%)	1	NA	NA
WP_001525807.1|2607996_2609949_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 182
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2618774	2627341	4910422		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773180.1|2618774_2621477_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	2.0e-40
WP_000031783.1|2621768_2622953_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2623023_2625138_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2625234_2625705_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2625801_2626176_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903381.1|2626301_2626589_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820731.1|2626595_2626955_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209693.1|2626954_2627341_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
>prophage 183
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2632911	2642452	4910422		Tupanvirus(25.0%)	9	NA	NA
WP_000634830.1|2632911_2634825_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057364.1|2634824_2635847_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2635840_2636059_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_138976292.1|2636112_2636982_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2637036_2637441_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2637742_2638375_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001296470.1|2638425_2640516_+	membrane protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000963794.1|2640582_2641803_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601853.1|2641888_2642452_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
>prophage 184
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2661366	2662203	4910422		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2661366_2662203_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 185
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2677064	2684445	4910422	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_000826444.1|2677064_2678273_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	4.9e-209
WP_000370859.1|2678575_2680300_-	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_001265681.1|2680677_2682300_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253709.1|2682376_2683729_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2683725_2684445_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 186
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2691035	2691446	4910422	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_023908544.1|2691035_2691446_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	42.5	9.3e-11
>prophage 187
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2697483	2699877	4910422		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081885.1|2697483_2699877_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	7.3e-15
>prophage 188
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2710851	2713299	4910422		Dickeya_phage(100.0%)	1	NA	NA
WP_000993445.1|2710851_2713299_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 189
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2723628	2725725	4910422		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_001296481.1|2723628_2725725_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	34.7	6.1e-42
>prophage 190
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2733981	2735792	4910422		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073605.1|2733981_2734725_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.8	1.1e-09
WP_000907823.1|2734721_2735792_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 191
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2739333	2740816	4910422		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|2739333_2740047_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082099.1|2740048_2740816_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 192
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2747295	2750114	4910422		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|2747295_2748150_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042013.1|2748394_2749453_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2749445_2750114_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 193
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2753120	2757241	4910422		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|2753120_2753747_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106599.1|2753820_2756019_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	1.9e-118
WP_000130621.1|2756120_2756366_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100463.1|2756575_2757241_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
>prophage 194
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2765134	2765941	4910422		Bacillus_virus(100.0%)	1	NA	NA
WP_000173684.1|2765134_2765941_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.7	7.6e-17
>prophage 195
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2773379	2776115	4910422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000972087.1|2773379_2776115_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 196
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2785802	2791211	4910422		Indivirus(50.0%)	5	NA	NA
WP_001296496.1|2785802_2787845_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	4.0e-46
WP_001296497.1|2788047_2788890_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_000160794.1|2788961_2790314_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_023363328.1|2790367_2790451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065754.1|2790785_2791211_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	1.4e-49
>prophage 197
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2801884	2803354	4910422		Pithovirus(50.0%)	2	NA	NA
WP_000622316.1|2801884_2802655_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
WP_000123131.1|2802706_2803354_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
>prophage 198
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2850257	2852242	4910422		Bacillus_virus(50.0%)	2	NA	NA
WP_000103571.1|2850257_2851262_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196477.1|2851258_2852242_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 199
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2862286	2864620	4910422		Escherichia_phage(100.0%)	1	NA	NA
WP_138976294.1|2862286_2864620_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	1.4e-71
>prophage 200
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2868274	2868487	4910422		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|2868274_2868487_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 201
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2872707	2873703	4910422		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182627.1|2872707_2873703_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.4	5.4e-12
>prophage 202
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2879020	2880562	4910422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146503.1|2879020_2880562_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 203
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2904610	2909222	4910422		Clostridioides_phage(50.0%)	3	NA	NA
WP_000985737.1|2904610_2905906_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
WP_000741500.1|2906035_2907187_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000587626.1|2907377_2909222_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	4.3e-15
>prophage 204
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2930930	2940435	4910422		Lake_Baikal_phage(16.67%)	9	NA	NA
WP_138976295.1|2930930_2931182_-	glutaredoxin 3	NA	A0A2H4N7T8	Lake_Baikal_phage	53.1	1.3e-10
WP_001156181.1|2931322_2931754_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001296527.1|2931997_2933542_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214150.1|2933551_2934835_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483825.1|2934838_2935798_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982097.1|2935784_2936819_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|2937057_2938083_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213854.1|2938092_2939289_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	1.4e-35
WP_000587750.1|2939502_2940435_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 205
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2955335	2959898	4910422		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171854.1|2955335_2955815_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114533.1|2955853_2956663_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2956760_2956928_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2956948_2957185_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001296533.1|2957401_2958070_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050112.1|2958241_2959462_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	3.2e-43
WP_001298007.1|2959442_2959898_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 206
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2963916	2968937	4910422		Vibrio_phage(33.33%)	4	NA	NA
WP_001296534.1|2963916_2965599_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.0	5.7e-22
WP_001295237.1|2965856_2966480_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2966534_2966810_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280473.1|2966828_2968937_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 207
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2973238	2974630	4910422		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2973238_2974630_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 208
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2987891	2988929	4910422		Wolbachia_phage(100.0%)	1	NA	NA
WP_001280586.1|2987891_2988929_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
>prophage 209
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	2995179	2996514	4910422		Moraxella_phage(100.0%)	1	NA	NA
WP_001527950.1|2995179_2996514_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.9	1.1e-65
>prophage 210
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3005155	3017035	4910422		Micromonas_sp._RCC1109_virus(20.0%)	11	NA	NA
WP_000168502.1|3005155_3006844_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	1.6e-56
WP_001312198.1|3006949_3007048_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001296567.1|3007448_3008633_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
WP_000148034.1|3008640_3009138_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|3009134_3009497_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_001296568.1|3009486_3009834_-	YidH family protein	NA	NA	NA	NA	NA
WP_001087174.1|3011384_3013100_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.2	1.2e-40
WP_001296571.1|3013266_3014133_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001279774.1|3014222_3015884_-	putative transporter	NA	NA	NA	NA	NA
WP_001243431.1|3016081_3016510_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|3016621_3017035_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 211
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3021464	3022613	4910422		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|3021464_3022613_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 212
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3027221	3034590	4910422		Bacillus_virus(33.33%)	8	NA	NA
WP_138976297.1|3027221_3029636_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.4	2.4e-114
WP_000060112.1|3029664_3030738_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3030737_3031838_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|3031842_3033246_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122984430.1|3033542_3033623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|3033852_3033993_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3034009_3034369_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3034332_3034590_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 213
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3044787	3046125	4910422		Moraxella_phage(100.0%)	1	NA	NA
WP_001296582.1|3044787_3046125_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.9	1.2e-62
>prophage 214
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3057881	3065396	4910422		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|3057881_3058655_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251986.1|3058745_3059636_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3059635_3060595_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3060680_3061721_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334086.1|3062034_3063864_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933735.1|3064025_3065396_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 215
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3077351	3078344	4910422		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845115.1|3077351_3078344_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 216
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3081512	3087365	4910422		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|3081512_3083381_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001296586.1|3083547_3083967_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387762.1|3083974_3085480_+	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.2	8.7e-14
WP_000211858.1|3085484_3086450_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3086474_3087365_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 217
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3100764	3102411	4910422		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012588.1|3100764_3102411_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	5.7e-67
>prophage 218
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3110007	3115421	4910422		Bacillus_phage(33.33%)	4	NA	NA
WP_001238869.1|3110007_3112029_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001296590.1|3112075_3113560_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3113695_3114961_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3115091_3115421_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 219
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3119463	3125607	4910422		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|3119463_3120594_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006608.1|3120590_3121853_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	5.9e-24
WP_001226629.1|3121852_3122920_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.3e-101
WP_000676056.1|3122938_3123820_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145166.1|3123797_3124472_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612067.1|3124476_3125607_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	7.4e-18
>prophage 220
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3133614	3135270	4910422		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395838.1|3133614_3135270_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 221
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3146165	3150024	4910422		Bacillus_phage(100.0%)	3	NA	NA
WP_000130676.1|3146165_3147062_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|3147061_3147778_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|3147861_3150024_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 222
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3156628	3160041	4910422	transposase	Catovirus(50.0%)	3	NA	NA
WP_001442069.1|3156628_3158458_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	1.3e-83
WP_000928838.1|3158522_3159143_+	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_000133649.1|3159180_3160041_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.2e-65
>prophage 223
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3167893	3169402	4910422		Vibrio_phage(100.0%)	1	NA	NA
WP_000037971.1|3167893_3169402_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 224
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3191396	3194683	4910422		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187545.1|3191396_3193037_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|3193115_3193385_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459601.1|3193388_3193904_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109949.1|3193906_3194683_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 225
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3203462	3204077	4910422		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|3203462_3204077_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 226
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3217674	3220461	4910422		uncultured_virus(100.0%)	1	NA	NA
WP_000249989.1|3217674_3220461_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 227
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3224582	3227053	4910422		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001315107.1|3224582_3225992_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190574.1|3226003_3227053_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
>prophage 228
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3230939	3235670	4910422		Escherichia_phage(33.33%)	5	NA	NA
WP_000022287.1|3230939_3231728_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	1.3e-21
WP_000196715.1|3231767_3232664_-	sugar kinase	NA	NA	NA	NA	NA
WP_000190782.1|3232836_3233715_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.0e-47
WP_000094544.1|3233739_3234627_+	aldolase	NA	NA	NA	NA	NA
WP_000357981.1|3234659_3235670_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 229
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3250563	3253614	4910422		Escherichia_phage(100.0%)	1	NA	NA
WP_138976300.1|3250563_3253614_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 230
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3264573	3269499	4910422		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001296619.1|3264573_3265194_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
WP_001166063.1|3265453_3266437_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270242.1|3266585_3267260_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3267430_3268804_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|3268800_3269499_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 231
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3281109	3285612	4910422		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3281109_3281955_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3282379_3282625_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3282709_3283195_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|3283287_3284214_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|3284280_3285612_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 232
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3297234	3298788	4910422		Pandoravirus(100.0%)	1	NA	NA
WP_000694068.1|3297234_3298788_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.5	3.5e-10
>prophage 233
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3305601	3312848	4910422		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424857.1|3305601_3306264_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
WP_001185130.1|3306275_3308777_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004469.1|3309085_3310165_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3310179_3310500_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184861.1|3310550_3312848_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 234
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3328600	3334383	4910422	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_000125467.1|3328600_3329917_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.2	2.0e-59
WP_001309117.1|3330020_3330671_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000806409.1|3330670_3331030_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000186998.1|3331069_3332170_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_001296629.1|3332538_3334383_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	9.3e-10
>prophage 235
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3342817	3345870	4910422		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3342817_3343768_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3344685_3345870_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 236
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3349865	3358194	4910422		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3349865_3353894_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653952.1|3353970_3358194_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
>prophage 237
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3366490	3368254	4910422		Klosneuvirus(50.0%)	3	NA	NA
WP_000362389.1|3366490_3367162_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	3.6e-20
WP_000940085.1|3367204_3367795_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3367981_3368254_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 238
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3373616	3375206	4910422		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187526.1|3373616_3375206_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.0e-68
>prophage 239
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3388987	3392671	4910422		Dickeya_phage(100.0%)	1	NA	NA
WP_000095941.1|3388987_3392671_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 240
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3417010	3418126	4910422		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3417010_3418126_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 241
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3425478	3426087	4910422		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3425478_3426087_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 242
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3438207	3442336	4910422		Escherichia_phage(25.0%)	4	NA	NA
WP_001296639.1|3438207_3439623_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
WP_001147314.1|3439675_3440755_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.6	3.4e-28
WP_000122237.1|3440777_3441335_+	nicotinamide mononucleotide transporter	NA	I6W764	Vibriophage	28.8	2.2e-15
WP_001523669.1|3441331_3442336_+	AAA family ATPase	NA	K4F711	Cronobacter_phage	30.2	1.3e-26
>prophage 243
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3447794	3449153	4910422		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_074170155.1|3447794_3449153_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	8.6e-37
>prophage 244
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3459096	3462710	4910422		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357755.1|3459096_3461919_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
WP_000168305.1|3462173_3462710_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 245
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3466527	3467877	4910422		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|3466527_3467877_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 246
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3474001	3475960	4910422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078193.1|3474001_3475960_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 247
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3485671	3487199	4910422		Bacillus_virus(50.0%)	2	NA	NA
WP_000156927.1|3485671_3486376_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	7.1e-19
WP_000132446.1|3486362_3487199_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
>prophage 248
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3491116	3493264	4910422		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|3491116_3493264_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 249
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3498509	3504878	4910422		Tetraselmis_virus(50.0%)	5	NA	NA
WP_001296653.1|3498509_3500495_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	1.9e-149
WP_001171678.1|3500767_3501697_-	allose kinase	NA	NA	NA	NA	NA
WP_001296654.1|3501680_3502376_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507111.1|3502386_3503367_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235245.1|3503345_3504878_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	7.5e-13
>prophage 250
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3511021	3512571	4910422		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611411.1|3511021_3511702_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	1.1e-05
WP_001075531.1|3511812_3512571_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
>prophage 251
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3518174	3518963	4910422		Pithovirus(100.0%)	1	NA	NA
WP_001193415.1|3518174_3518963_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	2.5e-12
>prophage 252
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3523803	3525306	4910422		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|3523803_3525306_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 253
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3548359	3563553	4910422	tRNA	Enterobacteria_phage(50.0%)	9	NA	NA
WP_001528154.1|3548359_3552199_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	45.2	0.0e+00
WP_001088099.1|3553096_3553927_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001531193.1|3554047_3554227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080129.1|3555082_3559012_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	37.3	4.9e-218
WP_000405647.1|3559225_3559498_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001312331.1|3559725_3560022_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_001173343.1|3560049_3560223_+	type V toxin-antitoxin system toxin GhoT	NA	NA	NA	NA	NA
WP_000003806.1|3560341_3561859_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856826.1|3562095_3563553_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
>prophage 254
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3577830	3579814	4910422		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3577830_3578124_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3578167_3579814_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 255
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3584018	3584552	4910422		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|3584018_3584552_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 256
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3589472	3590450	4910422		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3589472_3590450_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 257
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3598170	3598716	4910422		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3598170_3598716_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 258
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3602630	3615655	4910422	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990282.1|3602630_3603962_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	7.4e-17
WP_001296676.1|3603971_3605819_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	7.5e-60
WP_001280359.1|3605811_3606762_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3606847_3607156_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460357.1|3607231_3608512_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312479.1|3608597_3609857_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3609859_3610864_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3610945_3611143_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527954.1|3611246_3612545_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	1.7e-66
WP_001177639.1|3612749_3613175_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076322.1|3613213_3615655_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
>prophage 259
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3619497	3620661	4910422		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944012.1|3619497_3620661_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.8e-80
>prophage 260
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3663402	3669890	4910422		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055075.1|3663402_3663933_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|3664242_3665199_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205813.1|3665338_3666841_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|3666854_3667877_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|3667863_3668859_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3668891_3669890_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 261
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3674200	3676962	4910422		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106238.1|3674200_3674665_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187791.1|3674823_3676962_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
>prophage 262
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3680600	3686697	4910422		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|3680600_3681548_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3681732_3681786_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|3681926_3684623_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|3684828_3685215_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3685287_3685749_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3685761_3686697_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 263
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3694965	3705392	4910422	tRNA	Klosneuvirus(25.0%)	7	NA	NA
WP_000416407.1|3694965_3697821_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|3697820_3698264_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3698619_3700131_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3700397_3701498_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001296697.1|3701497_3702580_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001296698.1|3702740_3704243_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	4.6e-84
WP_001296699.1|3704372_3705392_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
>prophage 264
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3716410	3719401	4910422	transposase	Enterobacteria_phage(50.0%)	4	NA	NA
WP_000239754.1|3716410_3716647_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.7	9.0e-19
WP_000422741.1|3716984_3717410_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3717406_3717757_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|3717787_3719401_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 265
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3725129	3737133	4910422	transposase	Stx2-converting_phage(28.57%)	13	NA	NA
WP_000080195.1|3725129_3726743_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|3726773_3727124_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3727120_3727546_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000527665.1|3727820_3727928_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001390362.1|3727946_3728051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145475.1|3728108_3728765_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296707.1|3729012_3730290_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001309168.1|3730249_3730408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001545177.1|3730352_3732350_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
WP_085947616.1|3732504_3733661_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000177057.1|3734594_3734852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|3735408_3736176_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|3736176_3737133_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 266
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3746112	3748272	4910422	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000998019.1|3746112_3747498_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|3747547_3747895_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|3747891_3748272_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 267
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3759506	3761916	4910422		Yersinia_phage(33.33%)	4	NA	NA
WP_001234738.1|3759506_3760325_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_001350782.1|3760666_3761140_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001186775.1|3761155_3761632_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|3761694_3761916_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 268
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3766795	3767986	4910422		Bacillus_phage(100.0%)	1	NA	NA
WP_001295727.1|3766795_3767986_+	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
>prophage 269
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3771126	3775869	4910422	transposase	Acidithiobacillus_phage(50.0%)	4	NA	NA
WP_000366620.1|3771126_3773202_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	7.7e-37
WP_001332038.1|3773622_3773805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000788354.1|3774305_3774560_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_085949154.1|3774722_3775869_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
>prophage 270
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3796109	3799989	4910422	transposase	Shigella_phage(50.0%)	3	NA	NA
WP_085949154.1|3796109_3797257_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_001363826.1|3797382_3798426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991462.1|3799008_3799989_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	57.2	4.7e-101
>prophage 271
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3806318	3806915	4910422		Escherichia_phage(100.0%)	1	NA	NA
WP_000044711.1|3806318_3806915_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 272
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3817110	3818571	4910422		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|3817110_3818571_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 273
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3825094	3825649	4910422		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151866.1|3825094_3825649_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 274
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3833150	3842970	4910422	transposase	Sodalis_phage(25.0%)	7	NA	NA
WP_000181180.1|3833150_3834107_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.0e-60
WP_000199304.1|3834349_3835762_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000397910.1|3835938_3836103_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_000132599.1|3836145_3836484_-	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_000058884.1|3836698_3839962_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.4	2.8e-49
WP_000535012.1|3840056_3841361_-	restriction endonuclease subunit S	NA	B3GAM1	uncultured_virus	24.7	8.3e-05
WP_001029745.1|3841350_3842970_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	21.8	1.1e-06
>prophage 275
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3848753	3854120	4910422		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919544.1|3848753_3850418_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410144.1|3850466_3851828_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091573.1|3852044_3852959_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106049.1|3853097_3854120_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	27.1	2.1e-11
>prophage 276
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3857347	3858627	4910422		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3857347_3858085_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|3858087_3858627_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 277
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3866456	3869332	4910422		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|3866456_3868046_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3868438_3869044_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3869170_3869332_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 278
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3875321	3876644	4910422		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477800.1|3875321_3876644_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	1.5e-78
>prophage 279
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3884407	3889572	4910422		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093834.1|3884407_3885640_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000046754.1|3885760_3887428_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000409419.1|3887634_3889572_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 280
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3892855	3894969	4910422		Bacillus_phage(50.0%)	2	NA	NA
WP_001188689.1|3892855_3893545_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219582.1|3893544_3894969_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
>prophage 281
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3906625	3919614	4910422		Cyanophage(16.67%)	12	NA	NA
WP_000130187.1|3906625_3907579_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094685.1|3907693_3908281_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528533.1|3908315_3908882_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102393.1|3909030_3909744_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843689.1|3909769_3910174_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3910544_3912461_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|3912549_3913680_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001181672.1|3913783_3913993_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001274833.1|3914549_3915311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173016.1|3915331_3916825_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	27.8	8.0e-28
WP_000494928.1|3916953_3918213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681384.1|3918447_3919614_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	9.8e-90
>prophage 282
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3926041	3928858	4910422	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286823.1|3926041_3928858_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	2.1e-77
>prophage 283
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3933666	3934815	4910422		Halovirus(100.0%)	1	NA	NA
WP_001295757.1|3933666_3934815_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	9.8e-50
>prophage 284
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3940318	3945978	4910422		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001295759.1|3940318_3941872_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.0	2.0e-34
WP_000349970.1|3941944_3943162_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3943290_3944433_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787105.1|3944463_3945978_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 285
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3953872	3955833	4910422		Bacillus_phage(50.0%)	4	NA	NA
WP_000624375.1|3953872_3954352_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125566.1|3954437_3954671_+	antitoxin	NA	NA	NA	NA	NA
WP_001160964.1|3954673_3954958_+	CcdB family protein	NA	NA	NA	NA	NA
WP_000257181.1|3954984_3955833_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 286
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3963610	3969033	4910422		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117001.1|3963610_3966517_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035602.1|3966681_3969033_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	2.3e-37
>prophage 287
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3980772	3981471	4910422		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916271.1|3980772_3981471_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.2	5.2e-22
>prophage 288
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	3992948	3994673	4910422		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425639.1|3992948_3994673_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 289
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4020642	4021686	4910422		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217320.1|4020642_4021686_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 290
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4025932	4026484	4910422		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923703.1|4025932_4026484_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 291
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4039597	4041022	4910422		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|4039597_4041022_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 292
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4048677	4055145	4910422		Mamastrovirus(33.33%)	5	NA	NA
WP_001189632.1|4048677_4050228_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
WP_001295777.1|4050274_4052665_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|4052870_4053407_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|4053447_4054110_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150638.1|4054218_4055145_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 293
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4058407	4059328	4910422	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339933.1|4058407_4059328_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
>prophage 294
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4069459	4076265	4910422	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174644.1|4069459_4070878_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937399.1|4070916_4071843_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|4071879_4072335_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_138976307.1|4072512_4073217_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294702.1|4073231_4073762_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001295782.1|4073835_4076265_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	6.0e-41
>prophage 295
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4086649	4087447	4910422		Planktothrix_phage(100.0%)	1	NA	NA
WP_001295786.1|4086649_4087447_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	4.6e-14
>prophage 296
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4093358	4093703	4910422		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4093358_4093703_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 297
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4097632	4099057	4910422	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753937.1|4097632_4099057_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 298
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4110636	4111395	4910422		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|4110636_4111395_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 299
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4120223	4124339	4910422		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569423.1|4120223_4120820_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294788.1|4120856_4124339_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	2.8e-209
>prophage 300
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4137297	4138329	4910422		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|4137297_4138329_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 301
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4148508	4152710	4910422		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_000644685.1|4148508_4149867_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052747.1|4149938_4150694_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|4150727_4151450_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917890.1|4151446_4151914_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001385210.1|4151978_4152710_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
>prophage 302
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4157141	4160464	4910422		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|4157141_4157720_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|4157924_4158692_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4158662_4159403_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093933.1|4159714_4160464_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 303
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4174440	4180185	4910422		Hokovirus(50.0%)	5	NA	NA
WP_000859530.1|4174440_4174836_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.0	1.0e-30
WP_000758621.1|4174855_4175203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531417.1|4175290_4175839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531418.1|4176863_4177265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194008.1|4177746_4180185_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	43.4	2.7e-33
>prophage 304
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4203716	4204868	4910422		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001311432.1|4203716_4204868_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.1	6.6e-30
>prophage 305
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4209544	4217498	4910422		Streptococcus_phage(50.0%)	7	NA	NA
WP_000749899.1|4209544_4210600_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
WP_001285288.1|4210888_4211992_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893315.1|4212003_4213257_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.0e-96
WP_000201175.1|4213810_4214281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101918754.1|4214258_4214444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000671528.1|4214623_4215871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000229741.1|4215860_4217498_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	28.7	1.0e-23
>prophage 306
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4241055	4241907	4910422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|4241055_4241907_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 307
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4247949	4251254	4910422		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001295799.1|4247949_4248819_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_001295800.1|4248978_4249572_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474088.1|4249583_4249820_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046304.1|4249928_4251254_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
>prophage 308
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4261172	4268740	4910422	integrase,holin	Escherichia_phage(33.33%)	5	4260133:4260146	4275216:4275229
4260133:4260146	attL	TTCACCAACGGCAA	NA	NA	NA	NA
WP_001295805.1|4261172_4261736_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001159129.1|4262820_4264491_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	8.9e-60
WP_001295806.1|4264504_4265977_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001295807.1|4265990_4266578_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131040.1|4266706_4268740_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
4275216:4275229	attR	TTCACCAACGGCAA	NA	NA	NA	NA
>prophage 309
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4279861	4280911	4910422		Tupanvirus(100.0%)	1	NA	NA
WP_000692730.1|4279861_4280911_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
>prophage 310
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4288557	4290444	4910422		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010274.1|4288557_4290444_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 311
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4298605	4299688	4910422		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000805862.1|4298605_4299688_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.9	7.0e-191
>prophage 312
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4305098	4307059	4910422		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044319.1|4305098_4306049_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	4.3e-35
WP_001013504.1|4306045_4307059_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.4	1.4e-44
>prophage 313
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4310137	4313605	4910422		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_000842109.1|4310137_4311247_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
WP_001141271.1|4311281_4311557_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_001018403.1|4311862_4312825_+	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000939359.1|4312837_4313605_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
>prophage 314
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4320513	4321671	4910422		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830769.1|4320513_4321671_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 315
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4329086	4330202	4910422		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|4329086_4330202_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 316
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4334491	4344589	4910422		Bacillus_phage(60.0%)	7	NA	NA
WP_012896740.1|4334491_4335403_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	6.0e-103
WP_001219313.1|4335527_4336436_+	fructokinase	NA	NA	NA	NA	NA
WP_012896741.1|4336704_4337889_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698843.1|4338014_4341158_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	7.6e-12
WP_001221274.1|4341154_4342357_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|4342546_4343236_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893576.1|4343293_4344589_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 317
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4351541	4360384	4910422	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4351541_4352669_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4352691_4353024_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934823.1|4353051_4354899_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4354909_4355881_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|4356010_4356358_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295827.1|4356395_4357280_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295828.1|4357578_4358118_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4358268_4358718_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150440.1|4358721_4359825_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
WP_001021161.1|4359913_4360384_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 318
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4381818	4386865	4910422	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4381818_4382442_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130299.1|4382567_4383842_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
WP_001295325.1|4384029_4386384_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4386592_4386865_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 319
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4390017	4390713	4910422		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|4390017_4390713_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 320
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4394036	4397583	4910422		Bacillus_phage(100.0%)	2	NA	NA
WP_001235630.1|4394036_4395809_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.3e-50
WP_001256214.1|4395801_4397583_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	3.4e-41
>prophage 321
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4406421	4409571	4910422		Leptospira_phage(100.0%)	1	NA	NA
WP_001132478.1|4406421_4409571_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 322
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4416409	4424867	4910422		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4416409_4416961_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122044.1|4417089_4419021_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	3.9e-43
WP_000467098.1|4419073_4419403_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4419402_4420008_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678189.1|4420117_4421992_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	1.0e-117
WP_001220233.1|4422172_4422817_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250114.1|4422948_4423911_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801794.1|4423907_4424867_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.0	2.9e-15
>prophage 323
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4434429	4437671	4910422		Escherichia_phage(66.67%)	3	NA	NA
WP_000057523.1|4434429_4434732_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
WP_000806442.1|4434767_4435109_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083947.1|4435166_4437671_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.0e-115
>prophage 324
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4443039	4443717	4910422		Bacillus_virus(100.0%)	1	NA	NA
WP_001157551.1|4443039_4443717_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 325
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4446973	4447660	4910422		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|4446973_4447660_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 326
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4458865	4460647	4910422		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001295838.1|4458865_4460647_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	7.8e-38
>prophage 327
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4466837	4467983	4910422		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295840.1|4466837_4467983_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	9.7e-50
>prophage 328
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4480218	4484694	4910422	integrase,tRNA,tail	Moumouvirus(20.0%)	7	4474161:4474174	4487735:4487748
4474161:4474174	attL	GCCTGGCGTAACGC	NA	NA	NA	NA
WP_000912352.1|4480218_4481604_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143517.1|4481639_4482161_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190282.1|4482268_4482481_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4482482_4483349_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001331488.1|4483703_4484012_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	81.8	7.4e-37
WP_001295845.1|4484031_4484331_-|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	81.2	5.0e-30
WP_023363122.1|4484388_4484694_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	4.0e-43
4487735:4487748	attR	GCGTTACGCCAGGC	NA	NA	NA	NA
>prophage 329
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4493486	4495602	4910422		Hokovirus(50.0%)	2	NA	NA
WP_000253846.1|4493486_4494929_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	2.3e-11
WP_000770953.1|4494918_4495602_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 330
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4498747	4501891	4910422		Leptospira_phage(100.0%)	1	NA	NA
WP_000574008.1|4498747_4501891_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
>prophage 331
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4511460	4513005	4910422		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000937457.1|4511460_4513005_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	1.8e-14
>prophage 332
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4524393	4530467	4910422		Tupanvirus(50.0%)	4	NA	NA
WP_000077758.1|4524393_4528275_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	1.7e-61
WP_001332746.1|4528330_4528534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000096765.1|4528521_4529655_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140634.1|4529651_4530467_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
>prophage 333
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4544758	4546581	4910422		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502950.1|4544758_4545388_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
WP_000029772.1|4545360_4546581_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	6.1e-58
>prophage 334
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4549686	4551801	4910422		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4549686_4551252_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_001295855.1|4551372_4551801_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	4.3e-19
>prophage 335
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4565854	4566501	4910422		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4565854_4566064_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4566117_4566501_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 336
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4570918	4573358	4910422		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4570918_4572130_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231421.1|4572269_4573358_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 337
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4580368	4582951	4910422	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157896.1|4580368_4582951_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
>prophage 338
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4587083	4590616	4910422		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367903.1|4587083_4588754_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.9	7.2e-78
WP_001207535.1|4588837_4589773_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631387.1|4589890_4590616_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	9.9e-32
>prophage 339
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4598560	4599640	4910422		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4598560_4599640_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 340
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4604171	4605836	4910422		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|4604171_4605836_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 341
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4610461	4612408	4910422		Vibrio_phage(100.0%)	1	NA	NA
WP_001023114.1|4610461_4612408_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 342
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4615462	4616221	4910422		Moraxella_phage(100.0%)	1	NA	NA
WP_000480543.1|4615462_4616221_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	48.2	4.8e-45
>prophage 343
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4620714	4623360	4910422	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_000679501.1|4620714_4621476_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
WP_001287134.1|4621695_4623360_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 344
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4627505	4628270	4910422		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773282.1|4627505_4628270_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 345
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4634925	4646758	4910422		Hokovirus(40.0%)	10	NA	NA
WP_000186068.1|4634925_4635603_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.6e-26
WP_001295875.1|4635599_4638284_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	6.5e-12
WP_001295876.1|4638276_4638849_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000088001.1|4638857_4640906_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_000741157.1|4640928_4642602_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4642601_4642691_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424788.1|4643003_4643210_+	YbfA family protein	NA	NA	NA	NA	NA
WP_001075784.1|4643310_4643820_+	YbgA family protein	NA	NA	NA	NA	NA
WP_000207133.1|4643816_4645235_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	2.8e-62
WP_001032722.1|4645276_4646758_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
>prophage 346
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4650136	4650928	4910422		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114009.1|4650136_4650928_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.8	5.8e-09
>prophage 347
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4654851	4655607	4910422		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000991076.1|4654851_4655607_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.9	2.9e-10
>prophage 348
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4691445	4694965	4910422		Vibrio_phage(33.33%)	4	NA	NA
WP_000345405.1|4691445_4692165_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.9	2.4e-22
WP_000951272.1|4692161_4693103_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.3e-23
WP_000784348.1|4693216_4693597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109194.1|4693912_4694965_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
>prophage 349
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4699328	4705904	4910422		Tupanvirus(33.33%)	7	NA	NA
WP_001265440.1|4699328_4700345_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_000096849.1|4700607_4702080_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.8	1.9e-13
WP_001147439.1|4702147_4702936_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4703064_4703214_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113014.1|4703380_4704154_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604037.1|4704153_4704843_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891663.1|4704845_4705904_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	7.4e-20
>prophage 350
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4716166	4717456	4910422		Klosneuvirus(100.0%)	1	NA	NA
WP_001295886.1|4716166_4717456_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.3e-18
>prophage 351
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4723783	4724692	4910422		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295887.1|4723783_4724692_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	4.9e-28
>prophage 352
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4735290	4746861	4910422		Anomala_cuprea_entomopoxvirus(20.0%)	10	NA	NA
WP_000996111.1|4735290_4737027_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|4737019_4738015_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001295890.1|4738017_4738689_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007091.1|4738917_4740279_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	32.6	1.5e-52
WP_001218657.1|4740815_4742966_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	1.8e-41
WP_000386550.1|4742993_4743956_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443542.1|4744095_4745181_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|4745318_4745579_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|4745843_4746110_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990158.1|4746183_4746861_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	5.2e-19
>prophage 353
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4753250	4758476	4910422		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|4753250_4753973_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|4753969_4754629_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4754767_4755514_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4755917_4756421_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|4756720_4757608_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4757842_4757908_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4757960_4758476_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 354
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4763472	4770356	4910422		Tupanvirus(33.33%)	5	NA	NA
WP_000961458.1|4763472_4765065_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000114256.1|4765264_4766080_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209354.1|4766225_4768658_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295894.1|4768663_4769563_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001295895.1|4769693_4770356_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	9.7e-26
>prophage 355
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4773571	4775443	4910422		Planktothrix_phage(100.0%)	1	NA	NA
WP_001295896.1|4773571_4775443_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 356
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4786777	4787980	4910422		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|4786777_4787980_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 357
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4796546	4805686	4910422		Vibrio_phage(25.0%)	11	NA	NA
WP_001195231.1|4796546_4796804_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201575.1|4796963_4797251_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|4797234_4797957_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4798017_4798920_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4799007_4799484_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_001295904.1|4799833_4800946_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|4801040_4802174_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105413.1|4802183_4803128_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061639.1|4803124_4803970_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4804029_4804518_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149713.1|4804558_4805686_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 358
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4808811	4811549	4910422		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|4808811_4809540_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001295906.1|4809757_4810273_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4810398_4810722_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_138976317.1|4810718_4811549_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 359
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4815136	4816855	4910422		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815373.1|4815136_4816855_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
>prophage 360
NZ_CP029420	Escherichia coli strain 3385 chromosome, complete genome	4910422	4826071	4909820	4910422	head,transposase,holin,protease,portal,tail,integrase,plate,terminase,tRNA,capsid	Enterobacteria_phage(59.38%)	92	4846584:4846603	4909904:4909923
WP_000188152.1|4826071_4828018_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.4	8.5e-38
WP_000410785.1|4828090_4828315_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4828637_4828958_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4828988_4831265_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|4831949_4832168_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_138976318.1|4832452_4833157_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|4833198_4834920_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|4834920_4836687_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|4836809_4837775_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|4838318_4838813_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|4838947_4843054_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4843212_4843824_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|4843834_4845178_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4845268_4846561_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
4846584:4846603	attL	AAAGCGCCTGCGGGCGCTTT	NA	NA	NA	NA
WP_000078916.1|4846866_4847007_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|4847198_4847459_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|4847499_4848609_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|4848766_4849951_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|4849950_4850463_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|4850518_4850893_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|4850901_4851057_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|4851043_4853851_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000979945.1|4853863_4854352_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|4854380_4854980_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_023363133.1|4855207_4855993_+	hypothetical protein	NA	Q858V4	Yersinia_virus	76.6	1.1e-108
WP_001554335.1|4855994_4856522_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_000972134.1|4856550_4857084_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_021538277.1|4857086_4859072_-|tail	phage tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
WP_000071703.1|4859074_4859605_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|4859597_4860494_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213444.1|4860497_4860848_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001271941.1|4860844_4861426_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000356366.1|4861422_4862058_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|4862050_4862518_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|4862541_4864419_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|4864557_4864953_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|4864949_4865342_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|4865338_4865662_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|4865664_4865865_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|4865864_4866359_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|4866460_4867261_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|4867306_4868359_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|4868382_4869219_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|4869373_4871125_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|4871124_4872171_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|4872185_4872710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|4873433_4873931_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|4873970_4874813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|4874896_4875211_-	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|4875215_4876175_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_001067855.1|4877489_4878194_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013213985.1|4878761_4879742_+|transposase	IS481-like element ISKpn27 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	29.6	6.3e-05
WP_004199234.1|4880017_4880899_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213987.1|4882133_4882430_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_013213989.1|4882758_4883184_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_138976319.1|4883164_4883563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161490.1|4884726_4885287_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|4885290_4888257_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_020319858.1|4889330_4889468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749973.1|4889476_4890193_+	StdB	NA	NA	NA	NA	NA
WP_000414913.1|4890194_4890563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048968061.1|4890855_4891089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749971.1|4891199_4891520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214483.1|4891574_4891754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129958.1|4892480_4892990_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_000932975.1|4893876_4894116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881513.1|4894125_4894530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000447669.1|4894587_4895013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861760.1|4895427_4895868_+	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_001749980.1|4895855_4897121_+	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
WP_001452808.1|4897271_4898063_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_000057569.1|4898077_4898419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749982.1|4898978_4899698_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	28.3	2.0e-16
WP_072223234.1|4899822_4900272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749988.1|4900427_4900997_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_094833327.1|4901136_4901349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4901325_4902030_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000599382.1|4903744_4904110_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000013455.1|4904182_4904413_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
WP_071532336.1|4904469_4904685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000104290.1|4904735_4905035_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|4905031_4905298_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|4905294_4905498_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|4905521_4905932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|4906025_4906139_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|4906135_4906378_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|4906389_4906668_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|4906678_4907029_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|4907166_4907358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|4907790_4908312_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|4908416_4908758_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|4908827_4909820_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
4909904:4909923	attR	AAAGCGCCTGCGGGCGCTTT	NA	NA	NA	NA
>prophage 1
NZ_CP029421	Escherichia coli strain 3385 plasmid unnamed1, complete sequence	101340	0	101025	101340	tRNA,terminase,integrase,transposase,portal,tail	Salmonella_phage(81.91%)	106	26145:26204	50880:52129
WP_024170896.1|1311_2010_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	87.1	5.1e-110
WP_000161986.1|2009_2678_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_000049676.1|2674_3340_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000129633.1|3336_4227_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_000176292.1|4236_4503_+	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000215413.1|4698_5331_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_001007299.1|5330_6587_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_001717193.1|6613_8188_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	93.1	2.2e-286
WP_001055285.1|8209_9097_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	89.3	7.1e-133
WP_001130339.1|9122_9998_+	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	4.2e-154
WP_001755483.1|10071_10992_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	80.2	2.4e-123
WP_000801187.1|11036_11471_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	82.6	1.1e-59
WP_000057118.1|11470_12304_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
WP_001027663.1|12383_12728_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000523628.1|12718_13192_+	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001755481.1|13193_13577_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	81.9	4.7e-57
WP_000072377.1|13651_14398_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	93.5	2.8e-122
WP_000163861.1|14453_14771_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_001351971.1|14851_15121_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.8	1.7e-34
WP_001755480.1|15128_19700_+	tape measure protein	NA	J9Q712	Salmonella_phage	85.3	0.0e+00
WP_000442112.1|19742_20078_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	87.3	8.0e-53
WP_001348638.1|20127_20859_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	97.0	5.3e-134
WP_001405045.1|20851_21649_+	hypothetical protein	NA	J9Q7R4	Salmonella_phage	94.0	1.3e-154
WP_001293195.1|21636_22230_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	2.0e-99
WP_138976322.1|22247_26147_+	host specificity protein J	NA	J9Q713	Salmonella_phage	79.9	0.0e+00
26145:26204	attL	TGAAGTGGTCAACAAAAACTGGCCACCGAGTTAGAGTTTTTTCCAGTATCGATTTTCCGA	NA	NA	NA	NA
WP_085949154.1|26174_27322_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_120791101.1|28715_28979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001755539.1|29683_32350_+|tail	phage tail fiber repeat family protein	tail	J9Q6E3	Salmonella_phage	39.2	7.5e-69
WP_000064175.1|32552_32876_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
WP_000856758.1|32889_33582_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
WP_001717322.1|33583_33835_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.9e-27
WP_000931257.1|34207_34591_+	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	43.3	1.3e-11
WP_001755538.1|34575_35328_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.1	7.9e-16
WP_001755537.1|35504_36173_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	3.7e-110
WP_000062085.1|36172_36532_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_000443723.1|36583_38278_+	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.9	4.1e-12
WP_001755535.1|38456_39197_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.2	3.7e-127
WP_001755533.1|39240_40581_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.3	5.7e-235
WP_085949154.1|40718_41865_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_138976323.1|41896_43171_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	92.0	1.2e-234
WP_000636535.1|43167_43383_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.5	3.3e-20
WP_138976324.1|43528_43819_+	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	79.2	4.1e-37
WP_025670480.1|45472_45823_+	hypothetical protein	NA	Q716B1	Shigella_phage	51.7	4.6e-27
WP_000156433.1|45819_46065_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
WP_000797845.1|46275_47379_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_001282577.1|47373_47760_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_024269779.1|48011_48224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949154.1|49761_50908_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_138976325.1|50955_51078_+	hypothetical protein	NA	J9Q7G6	Salmonella_phage	76.9	4.8e-08
WP_001755521.1|51173_52409_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.0	3.3e-197
50880:52129	attR	TCGGAAAATCGATACTGGAAAAAACTCTAACTCGGTGGCCAGTTTTTGTTGACCACTTCAGACTGACATTGATTTGATGGCAATTGGCATCATGACTGACGCACCGGAGAGATTTTACGCAAACCATGCCCTGGTAACGAGCGTTGATAGTCTTGGTTCATCTGTAGTTACTGAACTATCTCGTATCATTTTGAAGTGATTAGAATAGCCTTAATGATAAGTAATCACTTACGATATTTGATGGTATATTTATATAAGAAGTTGAAAGCTCATTAGAAAACAAAGGAAAAACGCATGACTACTACTGCACTGCAAAATGAAAAAAATCCTTCTGATTACCTTGTTTGCAAGTGGTGCGGAAAATCATTTCACTATTTTAAGTCCCATGTAGCCAATGGTAATTGCGAGGGCATTCCTGAGTCAGTAAAAGATGCCGATCCTGACACCGTACTGAAAATGTACACAACGCAGTTTCCAGATGAGCCAACGCTATCGAAAAAGGCACTTGATGCAATTCAAGCTAAACGTGCCGAGCAAATAAGCGAAATGGCCAAATCATCTGGCGTGACCAATAGCCCAGGCTATACAGGCACAGTTGAGTACAAGACAGATCTGGTCGCAGCTCACGAACTGCTAAATGTAACGGTGAAAGAACTCGGAACAAAACGTGGGACGCCGCTCATGGTTAGCGTCAACGTCAATACGCCGTTTCCAGAGTTCGTTCCAGAAGTGAAGAAGGGATACGTATATGGCGACTTCGAACTGATCAAAGACATTTTCATGATGCTTGAACTTGGCATACCAGGCTATTTGTGGGGTCATGCAGGAACAGGCAAATCTTCATTGCCTACACAACTATGTGCTTTGCTCAATCGTCCGTTAATCCGTGCCCAACATACAGCATCAATGGAAGAGGCTCATGTTACGGGACAAATTCTGGCGCGTGATGGCTCTACGTATTTCGAGCCTGGCTTGCTTGCGCTCGCAATGAAGCATGGCTGGGTTTACCTCGCGGATGAATACGACTTTGCGTTTCCACAGATTCTTGGCGTGTATCAGCCAGTGCTGGAAGGTGAAGCGTTGGTCATCAAAGAGGCGACTCAAGAATGGCGTCGCATTACTCCGCATGAACGGTTTGCTTTCATTGGCACTGGCAACACGAACGGATCTGGTGATGAAACCGGCTTGTACCAGGGTACAAACATCCAGAACGCCGCTAACTTTTCGCGTTTTGGCATCGTTTCGAATGT	NA	NA	NA	NA
WP_001308882.1|52411_52615_+	hypothetical protein	NA	J9Q6I7	Salmonella_phage	92.5	5.2e-31
WP_000645856.1|52589_56108_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.4	0.0e+00
WP_000459728.1|56326_56917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106169.1|57161_57593_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.7	9.0e-65
WP_001755519.1|57710_58739_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	87.3	9.4e-145
WP_001755518.1|58799_59744_+	5'-3' exonuclease SAM fold family protein	NA	J9Q7S6	Salmonella_phage	88.9	1.0e-161
WP_000920224.1|59743_60010_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_072770580.1|60012_62352_+	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
WP_000591156.1|62444_62645_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	60.6	3.2e-09
WP_000715581.1|62648_63479_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_024170891.1|63579_63996_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	76.1	1.3e-60
WP_001755515.1|64051_64327_+	hypothetical protein	NA	J9Q738	Salmonella_phage	74.7	2.0e-33
WP_000688529.1|64366_64546_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	67.8	4.0e-11
WP_000644408.1|64542_64878_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_001229345.1|64877_65090_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_001293471.1|65579_66635_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	91.0	5.4e-172
WP_000364573.1|67377_68022_+	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
WP_000174803.1|68276_69362_+	exonuclease	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
WP_089455004.1|69403_69595_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	76.2	3.7e-23
WP_085949154.1|70135_71283_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_014962280.1|71502_71922_+	hypothetical protein	NA	J9Q743	Salmonella_phage	71.2	9.3e-51
WP_021520508.1|71931_72489_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.6	3.3e-88
WP_021520509.1|72649_73459_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.6	8.9e-66
WP_021520510.1|73642_74236_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.8	1.7e-98
WP_000121544.1|74422_74653_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
WP_052988677.1|75237_75831_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	81.7	4.5e-91
WP_000427218.1|76232_76484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001103988.1|76480_76669_+	hypothetical protein	NA	J9Q800	Salmonella_phage	53.2	7.2e-11
WP_000901061.1|76762_77188_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	4.4e-56
WP_000893469.1|77187_77346_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000335122.1|77485_78055_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
WP_021520149.1|78109_78391_+	hypothetical protein	NA	A0A0E3JPT1	Enterobacteria_phage	76.3	3.2e-39
WP_000467663.1|78393_79008_+	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.4	2.7e-99
WP_001090450.1|79111_79588_+	hypothetical protein	NA	J9Q747	Salmonella_phage	89.2	6.0e-78
WP_000149672.1|79646_82763_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.2	2.2e-27
WP_001755496.1|84917_86474_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.9e-104
WP_001755493.1|86832_87084_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	88.0	6.2e-34
WP_000506720.1|87182_87572_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
WP_000004356.1|87608_88709_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001755492.1|88866_90900_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_001717178.1|91139_91361_+	hypothetical protein	NA	J9Q750	Salmonella_phage	58.2	1.9e-18
WP_000910476.1|91397_91583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014962255.1|93890_94109_+	hypothetical protein	NA	J9Q804	Salmonella_phage	91.7	2.3e-32
WP_049076861.1|94247_94577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755488.1|94730_95042_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	1.3e-28
WP_000216800.1|95168_95564_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	3.1e-32
WP_023908299.1|95645_96056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023145151.1|96385_96673_+	hypothetical protein	NA	J9Q753	Salmonella_phage	79.6	2.1e-38
WP_001009193.1|96877_97360_+	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_001755486.1|97977_98208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255469.1|98228_98432_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
WP_001273881.1|98480_99131_-	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	6.4e-99
WP_001717186.1|99414_99594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208379.1|99726_100251_-	hypothetical protein	NA	J9Q6L0	Salmonella_phage	82.4	2.8e-68
WP_024170895.1|100255_100678_-	hypothetical protein	NA	J9Q806	Salmonella_phage	75.7	7.0e-54
WP_001291060.1|100746_101025_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	62.6	2.2e-24
>prophage 1
NZ_CP029422	Escherichia coli strain 3385 plasmid unnamed2, complete sequence	89323	1508	57505	89323	integrase,transposase	Escherichia_phage(32.0%)	55	33888:33904	50415:50431
WP_000027057.1|1508_2369_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|2554_3259_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_138976326.1|3306_3531_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_000839179.1|4032_4437_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4433_4781_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001310017.1|5860_6883_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_001300609.1|6879_7662_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000977394.1|8400_9192_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001298664.1|9198_11169_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_001322642.1|12411_12684_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001072358.1|13530_14700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309252.1|15066_15255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066941.1|15375_16116_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000361610.1|16400_17378_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_023142190.1|17690_17924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000081352.1|20720_21653_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001373486.1|21639_23043_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_012372828.1|23250_24267_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001513659.1|24494_24812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513660.1|25098_25458_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|25485_25665_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|25669_26050_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|26049_26271_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001617892.1|26453_28010_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_023142242.1|28006_29278_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	28.0	1.5e-11
WP_001553854.1|29399_32516_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_000991832.1|33563_34496_-	hypothetical protein	NA	NA	NA	NA	NA
33888:33904	attL	ATTCAGCCCGGATTTCA	NA	NA	NA	NA
WP_000246636.1|34499_35495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813634.1|36202_36421_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|36422_36728_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016982.1|36728_37535_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|38308_39064_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|39651_40818_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817036.1|40817_41789_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_001349526.1|42345_42618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001348615.1|42655_43558_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086185.1|43942_44626_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001104873.1|44626_44848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274437.1|44861_45296_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001671341.1|46662_46965_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271753.1|47011_47434_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027516.1|47430_47622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001348620.1|47973_48396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|48656_48887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170714.1|48938_50300_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001348621.1|50346_50910_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
50415:50431	attR	TGAAATCCGGGCTGAAT	NA	NA	NA	NA
WP_001553845.1|50935_51184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032143370.1|51404_51593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000547975.1|51594_51801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290841.1|51826_52366_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_000005990.1|52428_52662_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117179.1|52727_54686_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
WP_000845940.1|54740_55175_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276232.1|55171_55891_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_085947770.1|56136_57505_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
