The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034479	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 chromosome, complete genome	4870261	1216427	1293168	4870261	tRNA,tail,terminase,integrase,protease,transposase,head,capsid,portal,lysis,holin	Salmonella_phage(37.93%)	93	1208508:1208524	1299015:1299031
1208508:1208524	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1216427_1217465_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1217580_1218270_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1218588_1218972_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1219033_1219621_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1219723_1220623_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1220640_1221975_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1222105_1222843_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1222827_1224450_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001521719.1|1224534_1224714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014344135.1|1224713_1224878_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1224874_1225450_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1225481_1226132_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1226131_1227088_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1227084_1227564_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1228061_1229291_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1229268_1229553_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1229593_1229833_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1229875_1231033_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1230995_1233923_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1234049_1234400_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1234421_1234580_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|1235036_1235699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|1235698_1236085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|1236077_1236917_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|1236975_1237371_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|1237470_1237713_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|1237672_1238047_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|1238138_1239023_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|1239019_1239715_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|1239728_1240427_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|1240534_1241167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1241409_1241643_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1241759_1242008_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|1242042_1242645_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001241017.1|1242644_1242851_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_001096550.1|1242853_1243465_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1243461_1243602_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1243598_1244276_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_072095218.1|1244272_1244458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|1244548_1245112_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1245618_1245807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1246021_1246708_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1246983_1247313_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1247296_1247749_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1247766_1248219_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1248454_1248856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1249142_1249688_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1249659_1251591_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1251574_1251778_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1251774_1253355_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1253344_1254841_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1254853_1255201_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1255255_1256284_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_022662786.1|1256341_1256707_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1256717_1257101_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_001534814.1|1257128_1257707_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.7	1.7e-82
WP_000817263.1|1257755_1258886_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1258994_1259396_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1259403_1260150_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1260200_1260596_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1260592_1260931_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1260902_1263998_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1264000_1264330_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1264339_1265038_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1265044_1265782_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1265679_1266327_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_138930548.1|1266388_1269751_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_000178853.1|1269789_1270032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1270085_1272458_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1272454_1273279_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1273268_1273847_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1273943_1274171_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1274277_1274490_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1274552_1274618_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_015589559.1|1275197_1275362_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1276074_1276212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1276690_1278184_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1278588_1280388_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1280404_1281379_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1281652_1282333_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1282329_1283235_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1283246_1283975_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1283986_1284718_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1284717_1285098_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1285209_1285470_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1285507_1286434_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276370.1|1286549_1287746_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1287767_1288685_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1288723_1289572_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1289687_1290581_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1290591_1291953_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1291956_1292592_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1292616_1293168_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1299015:1299031	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP034479	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 chromosome, complete genome	4870261	1646606	1676199	4870261	protease,tail,holin	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1646606_1647101_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1647514_1648006_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1647995_1648259_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778094.1|1648255_1650742_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1650748_1651444_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1651430_1652300_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1652415_1652865_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1652874_1653477_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1653497_1654115_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000990028.1|1654111_1654771_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1654822_1655560_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1655556_1655769_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1655765_1656245_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1656241_1658173_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1658169_1658727_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238333.1|1658723_1659767_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1659810_1660458_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1661187_1661751_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1661942_1662146_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1662448_1663240_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1663536_1663740_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1663908_1666275_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_014344510.1|1666603_1667593_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	2.4e-190
WP_010989045.1|1667607_1667976_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1668004_1669336_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1669632_1669962_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1670554_1671796_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1671798_1672326_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1672703_1673147_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1673200_1675030_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1675377_1675668_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1675695_1676199_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 3
NZ_CP034479	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 chromosome, complete genome	4870261	1748250	1757421	4870261	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1748250_1749198_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1749181_1749913_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1749893_1750001_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1750060_1750792_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1751014_1752700_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1752696_1753416_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1753462_1753930_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1753986_1754517_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1754688_1755147_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1755387_1757421_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP034479	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 chromosome, complete genome	4870261	1825729	1836235	4870261		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1825729_1827133_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1827310_1828204_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1828580_1829666_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1829665_1830565_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1830612_1831491_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1831491_1832043_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1832048_1833041_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1833037_1833811_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1833815_1834895_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1834921_1836235_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP034479	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 chromosome, complete genome	4870261	1922229	1972979	4870261	tail,terminase,integrase,protease,head,capsid,plate,portal,lysis,holin	Salmonella_phage(89.06%)	71	1916807:1916821	1933283:1933297
1916807:1916821	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1922229_1922703_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1923350_1923641_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1924012_1924810_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1925101_1926091_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1926092_1926335_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1926359_1926929_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000208068.1|1926932_1927766_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_000065095.1|1927762_1928380_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000071070.1|1928376_1928892_-	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000764235.1|1928888_1929119_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1929189_1929729_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080415.1|1929865_1930693_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000997190.1|1930750_1931122_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001020636.1|1931936_1932632_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_071529734.1|1932605_1932791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191666.1|1932729_1932954_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1932982_1933537_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1933283:1933297	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|1933533_1934691_+	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000620702.1|1934687_1934912_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000061500.1|1934908_1935727_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|1935728_1936211_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|1936210_1937104_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001241579.1|1937100_1937490_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_001061457.1|1937506_1938367_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001202278.1|1938374_1939364_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	9.2e-190
WP_000188927.1|1939374_1939998_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001527054.1|1940130_1940388_+	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_014343859.1|1940317_1940752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001527046.1|1940913_1941258_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_001005901.1|1941260_1941875_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001050825.1|1941871_1942357_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_000877027.1|1942569_1942989_+	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001292890.1|1943208_1943511_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_001135225.1|1943571_1943922_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_000929191.1|1944047_1944542_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_000088182.1|1944538_1946272_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000605609.1|1946283_1946466_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466254.1|1946465_1947707_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_001193639.1|1947684_1948335_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257528.1|1948349_1949555_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_000601353.1|1949605_1949806_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000927378.1|1949808_1950132_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702408.1|1950128_1950533_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_001135697.1|1950504_1951017_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000779218.1|1951013_1951574_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_000497739.1|1951577_1951742_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007991.1|1951731_1953228_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000515952.1|1953227_1953584_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1953580_1953907_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785385.1|1953991_1955920_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000863818.1|1955953_1957294_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_001066636.1|1957290_1958349_+	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_001273649.1|1958348_1958882_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605050.1|1958886_1959300_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_014343856.1|1959271_1959817_+	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_014343855.1|1959851_1960373_+|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_001207832.1|1960375_1960963_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554737.1|1960949_1962512_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_000760554.1|1962511_1963081_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000492926.1|1963365_1964373_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1964585_1964807_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_099112411.1|1964920_1965136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000500831.1|1965437_1965599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1965725_1966145_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1966147_1967416_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1967870_1968083_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1968093_1968282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1968542_1969739_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1970388_1970688_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1970779_1971475_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1971548_1972979_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP034479	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 chromosome, complete genome	4870261	2077023	2083832	4870261	integrase,tail	Salmonella_phage(33.33%)	11	2079233:2079255	2088948:2088970
WP_000856224.1|2077023_2077254_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2077391_2077766_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2077766_2078642_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2078658_2079012_+	YebY family protein	NA	NA	NA	NA	NA
2079233:2079255	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2079385_2080240_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2080299_2080794_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2080983_2081214_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2081267_2081801_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2082057_2082225_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2082289_2082478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2082950_2083832_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2088948:2088970	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP034479	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 chromosome, complete genome	4870261	2690491	2778249	4870261	tRNA,tail,terminase,transposase,integrase,head,capsid,portal,lysis	Enterobacteria_phage(31.58%)	114	2760553:2760567	2774951:2774965
WP_000829539.1|2690491_2691019_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272241.1|2691015_2691123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2691328_2691775_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2691754_2692549_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2692649_2693834_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2693952_2694300_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487126.1|2694285_2694597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2694665_2694917_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2695112_2695211_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2695349_2695598_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001520194.1|2695605_2695791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762776.1|2695912_2696554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2696783_2696966_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2696968_2697331_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2697503_2698142_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|2698338_2698884_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908464.1|2698966_2699116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208089.1|2699194_2699443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2699697_2700546_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001738208.1|2700614_2701208_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175803.1|2701352_2702141_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_000234685.1|2702249_2702900_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2703093_2703420_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_000456065.1|2703613_2704747_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947460.1|2704828_2705419_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950207.1|2705412_2706210_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
WP_000966645.1|2706203_2707016_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001520270.1|2707005_2707980_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946082.1|2707979_2709614_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2710295_2710610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929982.1|2710758_2711289_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
WP_000761746.1|2711371_2712415_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001518864.1|2712753_2713224_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000480529.1|2713372_2713645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758946.1|2713844_2713970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977725.1|2714347_2714692_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2715928_2716486_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|2717297_2717561_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2717692_2717905_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2718319_2718841_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|2719031_2719271_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033407.1|2719759_2720548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000787622.1|2720869_2721073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917257.1|2721529_2722654_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000943928.1|2723101_2723266_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-20
WP_000334551.1|2723567_2724239_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.1e-80
WP_000481981.1|2724558_2726661_-	type III secretion system effector E3 ubiquitin transferase SspH1	NA	Q9MBL9	Phage_Gifsy-2	48.5	1.0e-28
WP_000457876.1|2728190_2728316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071531834.1|2728578_2728695_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_014344029.1|2728885_2729086_+	PagJ	NA	NA	NA	NA	NA
WP_000143179.1|2729183_2729768_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
WP_038407301.1|2729767_2732209_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.0	2.5e-87
WP_000178849.1|2732262_2732505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138930548.1|2732543_2735906_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_000246126.1|2735967_2736615_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2736512_2737250_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2737256_2737955_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2737964_2738294_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2738296_2741392_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2741363_2741702_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2741698_2742094_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2742144_2742891_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2742898_2743300_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2743408_2744539_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_001534814.1|2744587_2745166_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.7	1.7e-82
WP_000083294.1|2745193_2745577_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_022662786.1|2745587_2745953_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2746010_2747039_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2747093_2747441_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_138930549.1|2747453_2748950_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.4	3.7e-97
WP_000831821.1|2748939_2750520_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2750516_2750720_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2750703_2752635_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2752606_2753152_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669689.1|2753437_2753839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086015771.1|2754065_2754521_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.8	8.0e-56
WP_001208107.1|2754838_2755378_-	lysozyme	NA	S5MQK2	Escherichia_phage	74.1	5.7e-77
WP_001533331.1|2755355_2755658_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001533418.1|2755907_2756375_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_000690097.1|2756386_2756605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000658040.1|2756758_2756947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024132423.1|2757081_2757270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211401.1|2757189_2757750_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	71.1	1.1e-41
WP_014344026.1|2757831_2758020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639984.1|2758016_2758571_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	65.3	3.4e-64
WP_000926953.1|2758567_2758864_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	3.9e-35
WP_000784702.1|2758845_2759040_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	1.4e-12
WP_000929785.1|2759036_2759636_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	81.0	1.7e-93
WP_014343878.1|2759670_2759919_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2760035_2760269_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014344025.1|2760527_2760719_-	hypothetical protein	NA	G8C7S2	Escherichia_phage	68.9	1.1e-17
2760553:2760567	attL	TCAGCTTTCCATTCA	NA	NA	NA	NA
WP_000002116.1|2760830_2761112_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
WP_000208067.1|2761104_2761758_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
WP_000852188.1|2761760_2762231_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
WP_000065092.1|2762232_2762898_-	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
WP_000788827.1|2762912_2763605_-	Replication protein 14	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
WP_000024048.1|2763601_2764507_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
WP_072143007.1|2764598_2764973_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_000145711.1|2764938_2765166_-	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_000169863.1|2765179_2765647_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.9	3.2e-68
WP_000368620.1|2765798_2766884_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
WP_000373340.1|2766991_2767198_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
WP_022664343.1|2767908_2770620_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	39.6	1.2e-125
WP_001126029.1|2770612_2771443_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
WP_001033922.1|2771478_2771799_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
WP_000066251.1|2771791_2772124_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	81.8	8.8e-20
WP_000069465.1|2772120_2772672_+	hypothetical protein	NA	A0A192Y7X3	Salmonella_phage	34.5	2.8e-10
WP_000089141.1|2772721_2772958_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|2772947_2774090_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444507.1|2774202_2775453_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
2774951:2774965	attR	TCAGCTTTCCATTCA	NA	NA	NA	NA
WP_001249412.1|2775624_2776290_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|2776286_2776616_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000476067.1|2776627_2777089_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004541.1|2777142_2778249_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP034479	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 chromosome, complete genome	4870261	2924139	3008875	4870261	tRNA,tail,terminase,integrase,protease,portal,lysis,holin	Salmonella_phage(45.45%)	94	2948233:2948252	3020021:3020040
WP_000938191.1|2924139_2924820_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2925440_2926100_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2926186_2926516_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2926512_2926794_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2926842_2927622_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2927647_2928196_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2928410_2929622_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2929679_2929997_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2930041_2930458_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2930628_2931291_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2931385_2931844_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2931879_2933934_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2934057_2934504_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2934522_2936676_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2936662_2937268_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2937484_2937994_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2938350_2939403_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2939474_2939927_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156453.1|2940112_2941873_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2941941_2942460_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2942559_2942727_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2942982_2943546_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2943542_2945183_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2945187_2946441_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2946455_2948363_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2948233:2948252	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2948375_2950484_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2950582_2951692_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2951688_2952231_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2952396_2953407_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2953614_2956227_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2956653_2956845_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2957115_2957802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2957786_2958086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2958154_2958781_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001526469.1|2959428_2960397_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000143167.1|2960872_2961454_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2961453_2963892_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2963945_2964188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|2964226_2967577_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000246065.1|2967648_2968353_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2968250_2968988_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2968997_2969693_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2969782_2970316_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2970432_2970930_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2971028_2971361_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2971357_2974345_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2974424_2974754_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2974750_2975149_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2975194_2975944_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2975955_2976357_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2976353_2976920_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2976900_2977200_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2977192_2977516_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2977606_2979688_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|2979611_2981129_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|2981155_2981362_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2981358_2983497_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2983453_2983987_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2984194_2984674_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2984691_2985144_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2985127_2985457_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2985732_2986419_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2986779_2987229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2987364_2987490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2987663_2987981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2988047_2988845_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2988834_2988981_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2988977_2989589_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001241019.1|2989591_2989798_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929805.1|2989797_2990400_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2990482_2990704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2990815_2991049_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2991340_2991631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2991708_2992020_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2992016_2992364_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800013.1|2992374_2993124_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.2	1.1e-137
WP_000062941.1|2993126_2994110_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2994194_2994569_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2994534_2994774_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2994893_2995304_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|2995353_2995614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2995606_2995765_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2995786_2996086_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_020979285.1|2996212_2999098_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.6	0.0e+00
WP_001539618.1|2999060_3000218_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|3000260_3000500_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3000540_3000789_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262308.1|3000833_3002126_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.5	2.9e-252
WP_000191399.1|3002320_3003523_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|3003600_3005037_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|3005281_3006496_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000301921.1|3006582_3006816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762342.1|3006812_3007274_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3007474_3008875_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
3020021:3020040	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 9
NZ_CP034479	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 chromosome, complete genome	4870261	3073041	3081773	4870261	transposase,protease	Enterobacteria_phage(14.29%)	8	NA	NA
WP_085983316.1|3073041_3074296_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_119920232.1|3074311_3074587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|3074759_3075218_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3075409_3077686_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3077716_3078037_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3078360_3078582_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3078711_3080658_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3080654_3081773_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP034479	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 chromosome, complete genome	4870261	4450478	4497522	4870261	tRNA,tail,plate	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4450478_4451477_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4451564_4452875_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4453121_4453637_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4453735_4453945_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4453966_4454080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4454076_4455402_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4455580_4456189_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4456297_4456666_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017359.1|4456836_4459257_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4459355_4460228_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4460241_4460739_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4460919_4461837_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4462000_4463359_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4463447_4464557_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4464918_4466109_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4466240_4467785_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4467799_4468690_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4468855_4469266_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4469408_4471505_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4471504_4472242_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_014343934.1|4472238_4472907_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4472940_4473183_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4473626_4475276_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4475620_4476970_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4477102_4477450_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4478025_4478313_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270440.1|4478315_4478921_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	1.2e-59
WP_000777266.1|4478933_4479248_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4479407_4479863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4479859_4480057_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4480046_4481474_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4481473_4481998_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4482049_4482367_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4482326_4482455_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262500.1|4482551_4484906_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_000271423.1|4484905_4485859_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4485858_4486068_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4486055_4487099_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4487108_4487831_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4488158_4488521_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4488517_4489447_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4489446_4490994_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4491157_4491517_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4491507_4492623_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4492615_4493248_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4493250_4494996_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4495000_4495606_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4495602_4496058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4496306_4496597_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4496793_4497522_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP034480	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence	93832	0	12622	93832		Enterobacteria_phage(100.0%)	12	NA	NA
WP_001526823.1|2600_2801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000979451.1|2949_3252_+	transcriptional regulator PefB	NA	NA	NA	NA	NA
WP_000748205.1|3526_4045_+	major pilin PefA	NA	NA	NA	NA	NA
WP_000007893.1|4272_6681_+	outer membrane usher protein PefC	NA	NA	NA	NA	NA
WP_001038510.1|6673_7366_+	fimbrial chaperone PefD	NA	NA	NA	NA	NA
WP_010999940.1|7380_7938_+	membrane protein	NA	NA	NA	NA	NA
WP_014343944.1|8190_9066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000004313.1|9497_9710_+	transcriptional regulator PefI	NA	NA	NA	NA	NA
WP_001526811.1|9694_10045_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000178592.1|10289_10943_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010999938.1|11075_11975_+	YjiK family protein	NA	NA	NA	NA	NA
WP_000725062.1|12064_12622_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	38.5	4.5e-24
>prophage 2
NZ_CP034480	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence	93832	18251	18992	93832		Xanthomonas_phage(100.0%)	1	NA	NA
WP_000177629.1|18251_18992_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	3.9e-07
>prophage 3
NZ_CP034480	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence	93832	36844	37264	93832		Salmonella_phage(100.0%)	1	NA	NA
WP_001229397.1|36844_37264_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	88.9	2.2e-68
>prophage 4
NZ_CP034480	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence	93832	43733	43955	93832		Vibrio_virus(100.0%)	1	NA	NA
WP_001278699.1|43733_43955_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	42.3	1.0e-08
>prophage 5
NZ_CP034480	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence	93832	54188	58094	93832		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_000117513.1|54188_56186_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.0	5.5e-16
WP_000131520.1|56254_56497_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000741240.1|56551_57070_-	single-stranded DNA-binding protein SSB2	NA	A0A0A0P1Q9	Enterobacteria_phage	82.5	6.8e-51
WP_015059457.1|57100_57229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015983.1|57770_58094_-	hypothetical protein	NA	G8C7V1	Escherichia_phage	56.5	2.0e-13
>prophage 6
NZ_CP034480	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence	93832	61286	70582	93832	transposase	Escherichia_phage(28.57%)	12	NA	NA
WP_000088645.1|61286_61967_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000091632.1|62111_62300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|62348_62705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|62697_63168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|63678_64101_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|64100_65375_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_001541561.1|65456_66434_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000427676.1|66430_67636_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|68050_68992_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|69023_69590_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|69646_69982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|70165_70582_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
>prophage 7
NZ_CP034480	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence	93832	74131	74692	93832		Ralstonia_phage(100.0%)	1	NA	NA
WP_001240331.1|74131_74692_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.7	1.3e-31
>prophage 8
NZ_CP034480	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence	93832	80199	80364	93832		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|80199_80364_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 9
NZ_CP034480	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence	93832	85786	86137	93832		Escherichia_phage(100.0%)	1	NA	NA
WP_001541541.1|85786_86137_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 10
NZ_CP034480	Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence	93832	89197	89980	93832	integrase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_000082169.1|89197_89980_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
