The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040753	Sulfitobacter sp. BSw21498 chromosome, complete genome	3097372	752468	762998	3097372		Staphylococcus_phage(12.5%)	10	NA	NA
WP_138923209.1|752468_754097_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.1e-25
WP_093732351.1|754689_755151_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	52.4	5.7e-25
WP_138923210.1|755169_755880_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	38.2	8.5e-36
WP_138923211.1|755876_756230_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	35.2	2.3e-10
WP_138923212.1|756229_756931_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2P1JXV3	Rhodococcus_phage	50.9	1.8e-54
WP_138923213.1|757151_757748_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_138923214.1|757822_758497_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_138923215.1|758727_759963_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	40.5	1.2e-77
WP_093732344.1|760006_760588_+	DUF1190 domain-containing protein	NA	M1F298	Cronobacter_phage	28.3	4.7e-08
WP_138925105.1|760904_762998_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	32.0	4.7e-26
>prophage 2
NZ_CP040753	Sulfitobacter sp. BSw21498 chromosome, complete genome	3097372	1200266	1226321	3097372	tail,capsid,head,tRNA	uncultured_Mediterranean_phage(22.22%)	26	NA	NA
WP_138923561.1|1200266_1201319_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_138923562.1|1201328_1204685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923563.1|1204784_1205246_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_138923564.1|1205242_1206052_+	DUF455 family protein	NA	NA	NA	NA	NA
WP_138923565.1|1206242_1207571_+	peptidoglycan DD-metalloendopeptidase family protein	NA	V5R8R0	Arthrobacter_phage	39.5	7.9e-19
WP_138923566.1|1207560_1208061_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_138923567.1|1208201_1208756_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	41.1	2.7e-21
WP_138923568.1|1208748_1209255_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	55.6	4.8e-41
WP_138925127.1|1209386_1210580_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_093733071.1|1210758_1211058_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_093733072.1|1211236_1212247_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_138923569.1|1212250_1213648_+	pyruvate dehydrogenase complex E1 component subunit beta	NA	NA	NA	NA	NA
WP_138923570.1|1213660_1215013_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_138923571.1|1215156_1215978_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_138923572.1|1216062_1219992_-	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	38.4	1.9e-225
WP_138923573.1|1219991_1220438_-	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	49.6	9.7e-30
WP_138923574.1|1220434_1221325_-	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	37.5	5.6e-53
WP_138923575.1|1221321_1221954_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	49.5	1.0e-56
WP_138923576.1|1221966_1222626_-|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	30.0	3.3e-10
WP_138923577.1|1222625_1222814_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_138923578.1|1222854_1223169_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_138923579.1|1223172_1223613_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_138923580.1|1223647_1224058_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_138923581.1|1224054_1224393_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_138923582.1|1224389_1224986_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_138923583.1|1225145_1226321_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	37.3	8.1e-68
>prophage 3
NZ_CP040753	Sulfitobacter sp. BSw21498 chromosome, complete genome	3097372	1256427	1343761	3097372	protease,transposase,holin,integrase,tRNA	Bacillus_virus(11.11%)	77	1281943:1281961	1331244:1332497
WP_138923611.1|1256427_1257063_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_138923612.1|1257026_1257380_-	DUF2155 domain-containing protein	NA	NA	NA	NA	NA
WP_138923613.1|1257479_1257863_-	NADH:ubiquinone oxidoreductase subunit NDUFA12	NA	NA	NA	NA	NA
WP_005852785.1|1257946_1258306_-	RidA family protein	NA	NA	NA	NA	NA
WP_138923614.1|1258451_1259717_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.9	1.8e-129
WP_138923615.1|1259849_1260509_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	61.1	1.6e-60
WP_138923616.1|1260703_1261018_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_138923617.1|1261014_1262067_+	permease	NA	NA	NA	NA	NA
WP_138923618.1|1262083_1263127_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_093733929.1|1263215_1263698_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_138923619.1|1263694_1264468_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.9	7.6e-14
WP_138923620.1|1264421_1265249_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_138923621.1|1265335_1266877_-	ATPase	NA	W8CYF6	Bacillus_phage	28.0	2.0e-18
WP_138923622.1|1267107_1267413_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_138923623.1|1267535_1268447_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_138923624.1|1268443_1269253_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_138923625.1|1269249_1270044_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_138923626.1|1270040_1270826_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.2e-27
WP_138923627.1|1270880_1271858_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_138923628.1|1272012_1272801_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138923629.1|1272968_1275026_+	PAS-domain containing protein	NA	A0A2K9L0Z8	Tupanvirus	31.2	1.3e-23
WP_138923630.1|1275153_1275720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138923631.1|1276023_1276899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138923632.1|1276992_1278195_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_138923633.1|1278184_1278583_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_138923634.1|1278579_1279140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923635.1|1279457_1279952_+	DUF892 family protein	NA	NA	NA	NA	NA
WP_138925131.1|1280062_1281703_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
1281943:1281961	attL	TGGCGGAGGAGGTGTCCGC	NA	NA	NA	NA
WP_138923636.1|1283205_1283349_+|transposase	transposase	transposase	NA	NA	NA	NA
1281943:1281961	attL	TGGCGGAGGAGGTGTCCGC	NA	NA	NA	NA
WP_138923637.1|1283515_1285252_+	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.6	2.0e-09
WP_138923638.1|1285248_1286559_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_138923639.1|1288320_1291275_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_138922942.1|1291750_1292909_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.5	1.7e-46
WP_138923640.1|1293136_1294858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923641.1|1294854_1296573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923642.1|1296881_1298495_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_138923643.1|1298911_1299118_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138923644.1|1299215_1299866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923645.1|1299877_1301053_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	40.0	3.1e-75
WP_138923646.1|1301337_1302561_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	34.0	1.4e-41
1301204:1301222	attR	TGGCGGAGGAGGTGTCCGC	NA	NA	NA	NA
WP_138923647.1|1302598_1303408_+	hypothetical protein	NA	NA	NA	NA	NA
1301204:1301222	attR	TGGCGGAGGAGGTGTCCGC	NA	NA	NA	NA
WP_138923648.1|1303639_1303831_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_138923650.1|1305016_1305667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138923651.1|1305746_1308719_+	class I SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_138923652.1|1308715_1309591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138923653.1|1309592_1310048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138923654.1|1310450_1311323_+	macro domain-containing protein	NA	F8SJY4	Pseudomonas_phage	35.4	8.6e-14
WP_171048904.1|1311411_1312272_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_138923656.1|1312735_1313605_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_138923657.1|1313627_1314797_+	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	32.3	3.8e-41
WP_138923658.1|1314793_1315432_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	39.6	1.3e-32
WP_138923659.1|1315471_1316587_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	40.0	1.7e-06
WP_138923660.1|1316619_1317438_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_138923661.1|1317437_1318235_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_138923662.1|1318345_1319275_+	AEC family transporter	NA	NA	NA	NA	NA
WP_138925132.1|1319271_1319898_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_138923663.1|1320072_1321356_+	serine hydrolase	NA	NA	NA	NA	NA
WP_138925133.1|1321590_1323345_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_138923664.1|1323482_1323959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171048905.1|1324669_1324873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171048906.1|1325630_1325789_-	hypothetical protein	NA	A0A0N7BVE9	Escherichia_phage	58.8	1.1e-07
WP_138923665.1|1326417_1326594_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138923666.1|1327082_1328316_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.9	2.2e-87
WP_171048907.1|1328508_1328778_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_171048908.1|1328825_1328987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923668.1|1328995_1329247_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138923669.1|1329495_1330524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138922942.1|1331310_1332469_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.5	1.7e-46
WP_138925135.1|1332984_1333878_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_138923670.1|1334980_1335559_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_138923671.1|1335651_1336617_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_138925136.1|1336754_1337105_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_138923672.1|1337244_1337526_-	zf-TFIIB domain-containing protein	NA	NA	NA	NA	NA
WP_138923673.1|1338279_1339695_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_171048973.1|1339844_1340318_-	aspartyl-trna synthetase	NA	NA	NA	NA	NA
WP_171048909.1|1340684_1341869_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_138923675.1|1343479_1343761_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	42.0	9.1e-10
>prophage 4
NZ_CP040753	Sulfitobacter sp. BSw21498 chromosome, complete genome	3097372	1362560	1419983	3097372	tRNA,transposase,integrase	uncultured_Mediterranean_phage(36.36%)	53	1368194:1368208	1401489:1401503
WP_138923690.1|1362560_1362722_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138923691.1|1362740_1363870_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_165481303.1|1363937_1364099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138923692.1|1364095_1364950_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_138923693.1|1365147_1365747_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_138923694.1|1365899_1368500_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
1368194:1368208	attL	TTTCACCGATCTGAT	NA	NA	NA	NA
WP_138925143.1|1368651_1368849_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138923695.1|1369888_1371481_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_138923696.1|1371701_1371944_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_138923697.1|1371994_1372654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923698.1|1372646_1374722_-	AAA family ATPase	NA	A0A0H3UZA5	Geobacillus_virus	26.8	8.2e-39
WP_138923699.1|1374718_1375165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923700.1|1375154_1376492_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_138922942.1|1376488_1377648_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.5	1.7e-46
WP_171048914.1|1377758_1378550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923702.1|1378536_1380012_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_093733747.1|1381597_1381936_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_138923703.1|1381972_1383379_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_138923704.1|1383528_1384332_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_138923705.1|1384505_1385228_-	DUF3445 domain-containing protein	NA	NA	NA	NA	NA
WP_138923706.1|1385369_1385909_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_171048915.1|1385901_1386054_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_138923708.1|1386050_1386785_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_138923709.1|1386837_1387494_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_138923710.1|1387490_1388108_-	heme ABC exporter ATP-binding protein CcmA	NA	M1ID50	Paramecium_bursaria_Chlorella_virus	30.8	2.2e-08
WP_138923711.1|1388109_1388463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923712.1|1388631_1389600_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	45.7	2.4e-57
WP_138923713.1|1389612_1391262_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	29.1	8.3e-10
WP_093733735.1|1391298_1391577_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	56.3	5.6e-20
WP_138923714.1|1391843_1393136_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	41.7	6.2e-85
WP_138923715.1|1393195_1393903_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_138923716.1|1393975_1395451_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_138925144.1|1395501_1396818_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_138923717.1|1396932_1397646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923718.1|1397875_1399120_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_138923719.1|1399116_1402938_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
1401489:1401503	attR	TTTCACCGATCTGAT	NA	NA	NA	NA
WP_138923720.1|1402941_1404168_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.1	1.7e-20
WP_138923721.1|1404388_1404847_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_138925145.1|1404878_1406678_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.0	3.4e-41
WP_171048916.1|1406822_1408112_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	40.4	4.8e-05
WP_171048917.1|1408223_1408778_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.8	3.5e-13
WP_138923724.1|1409038_1409494_-	host attachment protein	NA	NA	NA	NA	NA
WP_138923725.1|1409733_1410333_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_138923726.1|1410528_1411110_-	sarcosine oxidase subunit gamma	NA	NA	NA	NA	NA
WP_138923727.1|1411102_1414120_-	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_138923728.1|1414199_1414529_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_138923729.1|1414622_1414877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923730.1|1414974_1416219_-	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_138923731.1|1416454_1417681_+	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_138923732.1|1417677_1418163_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_138923733.1|1418203_1418446_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_138923734.1|1418463_1418682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923735.1|1418969_1419983_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP040753	Sulfitobacter sp. BSw21498 chromosome, complete genome	3097372	1440952	1490729	3097372	protease,holin,transposase,integrase	Bacillus_phage(18.18%)	47	1453346:1453365	1462069:1462088
WP_138923754.1|1440952_1441921_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_138923755.1|1441920_1443153_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_138923756.1|1443247_1444714_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.1	2.4e-32
WP_138923757.1|1444735_1445524_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_138923758.1|1445776_1447150_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_138923759.1|1447244_1447925_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_093733690.1|1448066_1448978_+	pirin family protein	NA	NA	NA	NA	NA
WP_138923760.1|1449012_1449600_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138923761.1|1449679_1449976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138923762.1|1450082_1451369_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_138923763.1|1451470_1453210_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	1.3e-45
1453346:1453365	attL	CCCTACGGGCTGCCACTTGT	NA	NA	NA	NA
WP_138923764.1|1454699_1455134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923765.1|1455136_1455871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923766.1|1455867_1456239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923767.1|1456833_1457376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923768.1|1457480_1457804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923769.1|1457975_1459823_-	AAA family ATPase	NA	A0A060RJ50	Pseudomonas_phage	36.4	5.2e-37
WP_138923770.1|1459928_1460237_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_138923771.1|1460359_1460596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138923772.1|1460595_1461921_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	32.8	4.3e-49
WP_138923773.1|1462584_1463616_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1462069:1462088	attR	CCCTACGGGCTGCCACTTGT	NA	NA	NA	NA
WP_138923774.1|1463612_1464665_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	21.1	7.2e-07
WP_138923775.1|1464661_1465429_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.0	7.5e-14
WP_138923776.1|1465534_1467052_+	catalase	NA	A0A2K9L572	Tupanvirus	38.2	7.5e-82
WP_138923777.1|1467125_1467971_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_138923778.1|1467967_1468795_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_138923779.1|1468950_1469895_-	EamA family transporter	NA	NA	NA	NA	NA
WP_138923780.1|1469960_1471001_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	32.2	1.9e-23
WP_138923781.1|1470997_1471831_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_138923782.1|1471917_1472841_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_138923783.1|1473013_1473901_+	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_138923784.1|1473953_1474925_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	1.9e-17
WP_138923785.1|1474921_1475899_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.6	2.4e-17
WP_138923786.1|1475902_1476808_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_138923787.1|1476809_1477817_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_138923788.1|1477810_1478920_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_138923789.1|1479012_1480602_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_138923790.1|1480672_1481263_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_138923791.1|1481627_1482419_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_138923792.1|1482426_1483647_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_138923793.1|1483670_1485419_-	alpha-amylase	NA	NA	NA	NA	NA
WP_138925148.1|1486026_1486980_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.1	1.3e-10
WP_138923794.1|1487024_1487621_-	heme NO-binding domain-containing protein	NA	NA	NA	NA	NA
WP_138923795.1|1487754_1488462_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_171048974.1|1488452_1488731_-	DUF3572 domain-containing protein	NA	NA	NA	NA	NA
WP_138923796.1|1488835_1489765_+	response regulator	NA	NA	NA	NA	NA
WP_138923797.1|1489736_1490729_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
