The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	45923	55788	2558218	transposase	Enterococcus_phage(42.86%)	11	NA	NA
WP_149029771.1|45923_46955_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_057811956.1|47297_48251_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	46.0	4.4e-64
WP_057811955.1|48424_48868_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057811954.1|49137_50163_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	65.8	8.0e-120
WP_057811958.1|50176_52348_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	59.9	6.0e-250
WP_149029772.1|52334_52715_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	33.6	5.0e-11
WP_057811953.1|52707_52938_-	glutaredoxin-like protein NrdH	NA	A0A249XUR7	Enterococcus_phage	48.6	4.0e-11
WP_057811952.1|53203_53830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029773.1|53961_54888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057811950.1|54930_55140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057811949.1|55224_55788_+	AAA family ATPase	NA	A0A212Q4J6	Cowpox_virus	33.1	3.7e-10
>prophage 2
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	343513	391499	2558218	transposase	Staphylococcus_prophage(16.67%)	47	NA	NA
WP_149029770.1|343513_344434_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.0	4.3e-48
WP_057813460.1|344705_346163_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.2	6.6e-43
WP_149029786.1|346261_346642_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_057813462.1|346638_347160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813464.1|347355_349080_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_057813466.1|349107_349296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813512.1|349458_350769_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_057813468.1|350737_350965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029787.1|351014_351197_-	antitoxin	NA	NA	NA	NA	NA
WP_057813471.1|351256_351703_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.7	1.4e-31
WP_057813473.1|351792_353127_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	39.5	5.1e-66
WP_057813475.1|353626_354865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813477.1|354888_355968_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_057813479.1|355933_356272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813481.1|356338_357448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813483.1|357697_359062_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.7	3.2e-23
WP_057813485.1|359082_360534_+	amino acid permease	NA	NA	NA	NA	NA
WP_119318724.1|360945_361194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813487.1|361488_361860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813489.1|362112_362922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813491.1|363034_363343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813493.1|363628_364516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813494.1|364975_366430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083484563.1|366525_367551_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_083484564.1|367664_369017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813501.1|369033_370752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813502.1|370868_371888_+	acyltransferase	NA	NA	NA	NA	NA
WP_149029788.1|371956_373384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029789.1|373550_375029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010020969.1|375188_375428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813508.1|375555_377280_+	glycoside hydrolase family 73 protein	NA	Q9ZXE4	Bacillus_phage	44.7	1.7e-18
WP_057813510.1|377465_378224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029770.1|378308_379229_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.0	4.3e-48
WP_057813861.1|379449_379944_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_057813859.1|380048_381008_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A288WFW6	Bacillus_phage	44.8	3.4e-24
WP_149029790.1|381099_382551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813855.1|382565_383369_+	YdcF family protein	NA	NA	NA	NA	NA
WP_057813853.1|383379_384429_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_057813851.1|384502_385951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813849.1|386312_387002_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_057813847.1|387173_387362_+	type II toxin-antitoxin system HicA family toxin	NA	D6PSW1	Lactobacillus_phage	56.5	1.3e-12
WP_057813845.1|387385_387778_+	HicB family protein	NA	A0A090DBV2	Clostridium_phage	37.9	7.7e-15
WP_083484577.1|387925_388282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813841.1|388294_389155_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_149029771.1|389184_390216_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_149029791.1|390360_390504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029792.1|390581_391499_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	25.5	3.7e-07
>prophage 3
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	396440	455839	2558218	protease,transposase	Streptococcus_phage(30.77%)	54	NA	NA
WP_149029770.1|396440_397361_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.0	4.3e-48
WP_083484617.1|397511_399029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010020946.1|399152_399356_+	type II toxin-antitoxin system HicA family toxin	NA	D6PSW1	Lactobacillus_phage	56.2	1.9e-12
WP_057814753.1|399456_399636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057814751.1|399877_400345_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_057814749.1|400533_401400_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_057814747.1|401386_403648_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_057814745.1|403787_404732_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083484616.1|404745_405228_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_057814741.1|405309_407751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149029793.1|408004_408157_+	hypothetical protein	NA	A0A1X9I6V6	Streptococcus_phage	43.8	4.3e-06
WP_149029794.1|408262_409294_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	3.6e-43
WP_057815206.1|410043_411474_+	MFS transporter	NA	NA	NA	NA	NA
WP_149029771.1|411531_412563_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_057814301.1|412936_414682_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_149029795.1|414819_415512_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_057814302.1|415583_416912_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_057814303.1|416921_417419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057814304.1|417405_418233_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_057814305.1|418483_420448_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_057814306.1|420466_421291_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_057814307.1|421466_422867_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_057814308.1|422947_423904_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_057814310.1|424151_425072_+	DMT family transporter	NA	NA	NA	NA	NA
WP_057814311.1|425163_425937_+	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_057814312.1|426093_426966_+	DMT family transporter	NA	NA	NA	NA	NA
WP_057814313.1|427331_428039_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_057814314.1|428056_429736_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_057814315.1|429840_430266_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057814316.1|430320_430992_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_149029796.1|431622_432063_+	universal stress protein	NA	NA	NA	NA	NA
WP_057814319.1|432101_433757_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_057814320.1|433802_434213_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	41.9	3.2e-11
WP_057814321.1|435611_436421_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_010020902.1|436492_436825_+	HicB domain-containing protein	NA	NA	NA	NA	NA
WP_057814322.1|436835_437657_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_149029797.1|437765_437984_+	antitoxin of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_149029770.1|437951_438872_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.0	4.3e-48
WP_057813765.1|438997_439267_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_057813763.1|439375_440674_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	38.9	5.1e-79
WP_057813761.1|440666_440987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813759.1|440979_441357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813757.1|441357_442191_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057813755.1|442465_444169_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_149029771.1|444684_445716_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_149029798.1|445640_447176_+	ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	37.0	4.3e-77
WP_057814167.1|447222_447582_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057814176.1|447704_449624_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.0	3.6e-105
WP_057814180.1|450587_451925_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.6	1.2e-46
WP_057814182.1|452106_452748_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_057814184.1|452860_453622_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_057814185.1|453668_454166_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_057814186.1|454259_454772_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_149029770.1|454918_455839_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.0	4.3e-48
>prophage 4
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	464315	501127	2558218	integrase,plate,terminase,tRNA,tail,capsid,transposase,portal,head,protease	Lactobacillus_phage(57.14%)	54	458421:458435	482703:482717
458421:458435	attL	CAAAGGGTAACGCTA	NA	NA	NA	NA
WP_057814939.1|464315_465605_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.8	1.6e-96
WP_149029799.1|466062_466899_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	31.8	8.7e-40
WP_149029771.1|466952_467984_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_057816076.1|468089_468425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057816077.1|468537_468981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057816079.1|469405_469627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057816081.1|469644_469863_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	51.6	2.1e-09
WP_057816082.1|469940_470609_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	36.5	7.7e-23
WP_057816084.1|470610_470979_-	hypothetical protein	NA	A0A0P0I7G8	Lactobacillus_phage	60.0	1.0e-29
WP_057816086.1|471035_471458_-	ImmA/IrrE family metallo-endopeptidase	NA	O03904	Lactobacillus_phage	29.0	1.9e-11
WP_057816088.1|471441_471864_-	helix-turn-helix transcriptional regulator	NA	A0A0S2SXM8	Bacillus_phage	36.4	7.5e-08
WP_057816090.1|472018_472249_+	helix-turn-helix transcriptional regulator	NA	A8YQK9	Lactobacillus_phage	41.0	2.0e-07
WP_057816092.1|472325_472829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057816094.1|472815_473148_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_057816096.1|473150_473384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057816098.1|473396_473648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029800.1|473828_474719_+	recombinase RecT	NA	A0A1B0YA63	Lactobacillus_phage	58.2	2.9e-78
WP_149029801.1|474693_475503_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.0	9.2e-71
WP_057813742.1|475519_475966_+	HNH endonuclease	NA	A0A125RNK0	Pseudomonas_phage	42.2	8.0e-08
WP_057813746.1|476840_477602_+	ATP-binding protein	NA	D2KRE5	Lactobacillus_phage	32.2	1.2e-19
WP_057813747.1|477613_477940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083484575.1|477902_478364_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	39.4	1.8e-15
WP_083484576.1|478360_479113_+	hypothetical protein	NA	E9LUT0	Lactobacillus_phage	49.6	1.1e-54
WP_057813751.1|479109_479322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813753.1|479318_479819_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	53.0	1.2e-41
WP_010019123.1|480028_480238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029802.1|480275_480500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813876.1|480654_480876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029803.1|480954_481152_+	hypothetical protein	NA	A0A2K9VC77	Lactobacillus_phage	52.9	4.3e-06
WP_057813878.1|481148_481379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813880.1|481378_481648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083484579.1|481893_482364_+	hypothetical protein	NA	O03925	Lactobacillus_phage	35.8	7.9e-14
WP_010019138.1|482812_483031_+	DUF2829 domain-containing protein	NA	A0A2H4J7N7	uncultured_Caudovirales_phage	82.6	1.5e-28
482703:482717	attR	CAAAGGGTAACGCTA	NA	NA	NA	NA
WP_057813885.1|483020_483362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813886.1|483339_483597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813888.1|483593_483830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813890.1|483783_484161_+	HNH endonuclease	NA	A0A0K2CYS9	Paenibacillus_phage	53.7	1.2e-17
WP_057813891.1|484327_484789_+|terminase	phage terminase small subunit P27 family	terminase	F8J1A9	Lactobacillus_phage	41.5	4.2e-20
WP_149029890.1|484772_486542_+|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	64.3	1.5e-227
WP_057813893.1|486557_487823_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	50.9	9.6e-107
WP_057813925.1|487803_488508_+|protease	Clp protease ClpP	protease	F8J1B3	Lactobacillus_phage	58.0	6.6e-65
WP_057813895.1|488507_489656_+|capsid	phage major capsid protein	capsid	A0A2I7SCR0	Paenibacillus_phage	47.0	3.2e-85
WP_057813897.1|489848_490169_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_057813899.1|490155_490518_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_057813901.1|490514_490937_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_057813904.1|490933_491320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083484580.1|491320_491989_+|tail	phage tail protein	tail	W5RV35	Staphylococcus_phage	29.4	2.6e-18
WP_057813906.1|491988_492381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029891.1|492879_496881_+|tail	phage tail tape measure protein	tail	B4XYQ3	Lactobacillus_phage	56.6	2.7e-123
WP_083484581.1|496865_497744_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_083484582.1|497740_499426_+	hypothetical protein	NA	A8ASK8	Listeria_phage	30.0	1.1e-17
WP_057813913.1|499425_499761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813915.1|499765_500332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813917.1|500347_501127_+|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
>prophage 5
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	631514	693895	2558218	protease,transposase	Streptococcus_phage(13.33%)	57	NA	NA
WP_149029811.1|631514_632393_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	45.9	9.1e-72
WP_057813735.1|632382_632820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057811959.1|632995_633565_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	44.6	4.0e-36
WP_057811960.1|633567_634155_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	46.5	7.0e-36
WP_057811961.1|634205_634961_-	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.0	7.9e-16
WP_057811962.1|634960_635656_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_057811963.1|635684_636467_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_057811964.1|636549_637473_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	65.8	1.2e-111
WP_057811965.1|637486_638281_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_057811966.1|638533_638995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057811967.1|639124_640480_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_057811968.1|640554_642132_+	peptide chain release factor 3	NA	A0A2K5B2A5	Erysipelothrix_phage	24.9	1.9e-32
WP_057811969.1|642540_643545_+	glycoside hydrolase family 73 protein	NA	A0A249Y0X5	Enterococcus_phage	39.4	7.5e-14
WP_057811970.1|643728_646242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057811971.1|646343_647678_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_149029812.1|648090_648831_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_083484526.1|648842_649322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057811972.1|649314_650262_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_057811973.1|650369_651236_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057811974.1|651564_652299_+	RibD family protein	NA	NA	NA	NA	NA
WP_057811975.1|652421_653768_+	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	44.3	3.0e-18
WP_057811976.1|653821_654133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057811977.1|654249_654684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813083.1|654913_655444_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149029804.1|655440_656292_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	47.0	2.4e-45
WP_057816105.1|656355_658848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057816103.1|659174_659765_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057816101.1|659852_661133_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_149029771.1|661331_662363_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_057812487.1|662522_663449_+	AEC family transporter	NA	NA	NA	NA	NA
WP_057812485.1|663450_663783_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057812483.1|663814_664378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057812482.1|664496_665327_+	histidinol-phosphatase HisJ	NA	NA	NA	NA	NA
WP_057812480.1|665697_666864_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_149029813.1|666832_667480_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_057812476.1|667588_668875_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_057812474.1|668889_669474_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_057812472.1|669473_670091_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_057812470.1|670071_670791_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	A0A1V0SIZ6	Klosneuvirus	26.8	1.3e-12
WP_057812468.1|670784_671537_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_057812492.1|671536_671848_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_010020628.1|671850_672183_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_057812466.1|672195_673272_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.5	4.9e-19
WP_149029814.1|673333_674371_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_057812464.1|674383_675013_+	DUF47 family protein	NA	NA	NA	NA	NA
WP_057812462.1|675226_678736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057812460.1|679063_680089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057812458.1|680378_682349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057812456.1|682447_683002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057812455.1|683060_685259_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.3	3.8e-127
WP_057812453.1|685585_685852_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_057812451.1|685851_687576_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_057812449.1|687619_688192_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149029892.1|688683_691635_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_057813083.1|691737_692268_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149029815.1|692264_692897_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.9	1.2e-25
WP_149029810.1|692974_693895_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.4	1.1e-48
>prophage 6
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	843015	904406	2558218	integrase,holin,terminase,tRNA,tail,capsid,portal,head,protease	Lactobacillus_phage(67.65%)	63	864951:864969	904582:904600
WP_057815687.1|843015_845430_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	70.6	0.0e+00
WP_057815735.1|845815_847450_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_057815682.1|847534_848377_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_057815680.1|848580_849954_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_057815678.1|850063_850450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057815672.1|850607_850994_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_057815670.1|851030_851474_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_057815669.1|851562_854493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057815667.1|854661_855978_-	HAMP domain-containing histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	28.5	1.6e-19
WP_057815665.1|855961_856654_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.4	9.1e-35
WP_057815732.1|856875_859227_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_057815663.1|859247_860216_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.2	4.4e-51
WP_149029821.1|861699_863028_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_057815661.1|863250_863532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057815659.1|864352_864910_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
864951:864969	attL	TATAAGCGAACTACGAGAA	NA	NA	NA	NA
WP_057815657.1|865060_866236_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	37.3	3.8e-57
WP_057815655.1|866313_866622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057815653.1|866693_867482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057815651.1|867526_868177_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	49.8	2.8e-46
WP_083484643.1|868316_868562_+	helix-turn-helix transcriptional regulator	NA	A0A0S2SXX9	Bacillus_phage	50.0	1.3e-12
WP_057815729.1|868565_869315_+	antirepressor	NA	A0A2D1GPQ2	Lactobacillus_phage	50.8	5.7e-59
WP_057815647.1|869314_869503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057815646.1|869495_869732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057815644.1|870143_870464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057815642.1|870634_871375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057815640.1|871387_871630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057815638.1|871619_871877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010019246.1|871891_872080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057815636.1|872115_872595_+	siphovirus Gp157 family protein	NA	D6PSU0	Lactobacillus_phage	44.7	3.7e-27
WP_057815634.1|872595_873288_+	AAA family ATPase	NA	Q6J1V8	Lactobacillus_phage	55.5	2.4e-67
WP_057815633.1|873284_874640_+	DEAD/DEAH box helicase	NA	Q9T1H9	Lactobacillus_phage	56.6	5.4e-148
WP_057815631.1|874660_875203_+	DUF669 domain-containing protein	NA	Q9T0Y2	Lactobacillus_phage	57.3	2.4e-54
WP_057815630.1|875224_877546_+	DNA primase	NA	Q9T0Y1	Lactobacillus_phage	58.2	4.0e-268
WP_057815628.1|877866_878169_+	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	63.6	1.1e-29
WP_083484642.1|878140_878566_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057815624.1|878602_879109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057815619.1|879320_879506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057815617.1|879519_879945_+	DUF1642 domain-containing protein	NA	NA	NA	NA	NA
WP_057815614.1|880009_880219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057815612.1|880438_880801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029893.1|880806_881232_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	44.3	1.7e-28
WP_057815606.1|882323_883166_+	HNH endonuclease	NA	U5U440	Lactobacillus_phage	52.0	1.3e-75
WP_057815604.1|883469_883925_+|terminase	phage terminase small subunit P27 family	terminase	E9LUH9	Lactobacillus_phage	48.7	7.6e-30
WP_057815602.1|883936_885634_+|terminase	terminase large subunit	terminase	D2KRA5	Lactobacillus_phage	61.1	4.6e-205
WP_057815600.1|885826_887083_+|portal	phage portal protein	portal	B4XYP4	Lactobacillus_phage	56.2	1.3e-111
WP_057815598.1|887048_887672_+|head,protease	HK97 family phage prohead protease	head,protease	U5U3W0	Lactobacillus_phage	50.7	3.3e-44
WP_057815597.1|887727_888870_+|capsid	phage major capsid protein	capsid	E9LUI4	Lactobacillus_phage	60.3	8.1e-113
WP_057815594.1|889018_889357_+	DNA-packaging protein	NA	B4XYP7	Lactobacillus_phage	53.3	1.9e-22
WP_083484641.1|889295_889673_+|head	phage head closure protein	head	P94213	Lactobacillus_phage	47.5	6.7e-24
WP_057815591.1|889669_890047_+	hypothetical protein	NA	D2KRB2	Lactobacillus_phage	54.4	2.4e-29
WP_057815589.1|890048_890462_+	hypothetical protein	NA	D2KRB3	Lactobacillus_phage	40.2	2.1e-23
WP_057815587.1|890500_891094_+|tail	phage tail protein	tail	U5U3Z7	Lactobacillus_phage	58.0	1.0e-55
WP_057815586.1|891162_891504_+	hypothetical protein	NA	U5U4K9	Lactobacillus_phage	45.0	1.7e-13
WP_057815584.1|891711_892845_+|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	57.4	6.2e-73
WP_057815582.1|893124_896910_+|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	33.3	7.9e-72
WP_149029822.1|897010_897646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057815578.1|897642_899322_+	hypothetical protein	NA	A0A0A8WIC9	Clostridium_phage	24.9	1.1e-14
WP_057815577.1|899463_899739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057815575.1|899739_901578_+	hypothetical protein	NA	F8HGN7	Streptococcus_phage	40.5	9.6e-23
WP_149029823.1|901617_901983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057815571.1|902059_902485_+|holin	phage holin family protein	holin	A0A097BY69	Enterococcus_phage	29.1	3.6e-10
WP_083484640.1|902484_903435_+	hypothetical protein	NA	A0A1S5SF42	Streptococcus_phage	62.8	7.8e-61
WP_057815568.1|903833_904406_+	hypothetical protein	NA	A8ASL6	Listeria_phage	34.0	1.9e-17
904582:904600	attR	TATAAGCGAACTACGAGAA	NA	NA	NA	NA
>prophage 7
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	1031494	1041496	2558218		Synechococcus_phage(33.33%)	10	NA	NA
WP_057815057.1|1031494_1031977_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.4	3.4e-20
WP_057815055.1|1031969_1033100_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_057815053.1|1033102_1033810_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_057815051.1|1033820_1034069_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_057815049.1|1034069_1034744_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_057815047.1|1034743_1036954_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	7.7e-144
WP_057815045.1|1036938_1038345_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.5	2.4e-50
WP_057815043.1|1038357_1039377_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	43.8	4.4e-70
WP_057815041.1|1039373_1039955_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.6	6.3e-29
WP_057815039.1|1039951_1041496_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.8	6.1e-71
>prophage 8
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	1049412	1108379	2558218	integrase,terminase,tRNA,tail,capsid,portal,protease	Lactobacillus_phage(61.29%)	60	1078927:1078947	1116679:1116699
WP_057815018.1|1049412_1050681_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_057815015.1|1050695_1052405_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_057815012.1|1052755_1057054_+	PolC-type DNA polymerase III	NA	M1IQE0	Bacillus_phage	20.9	5.5e-21
WP_149029826.1|1057178_1057646_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_057815010.1|1057656_1058868_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_149029827.1|1058878_1059193_+	YlxR family protein	NA	NA	NA	NA	NA
WP_057815008.1|1059192_1059489_+	50S ribosomal protein L7	NA	NA	NA	NA	NA
WP_057815005.1|1059502_1062346_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.4	1.2e-19
WP_010019505.1|1062487_1062847_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_057815004.1|1062957_1063872_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_057815002.1|1063884_1064811_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_057815000.1|1064988_1066035_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_057814998.1|1066051_1066612_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_057814995.1|1066647_1068513_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	49.4	1.0e-136
WP_010019515.1|1068636_1069776_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	28.3	8.3e-25
WP_057814994.1|1069973_1070669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057814992.1|1070831_1072679_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.6	2.6e-20
WP_057814990.1|1072742_1074047_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_057814987.1|1074092_1075082_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.8	1.3e-50
WP_083484628.1|1075229_1075889_+	class A sortase	NA	NA	NA	NA	NA
WP_057814983.1|1075980_1078290_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.3	3.4e-78
WP_010019526.1|1078312_1078831_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.4	3.4e-26
1078927:1078947	attL	TTCAAATCCTGTACTCACCTT	NA	NA	NA	NA
WP_057814980.1|1079150_1080299_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	34.9	1.4e-59
WP_057814978.1|1080447_1080846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057814976.1|1080820_1081216_-	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	44.1	1.7e-17
WP_057814974.1|1081360_1081579_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057814972.1|1081687_1082170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057814970.1|1082175_1082505_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_057814968.1|1082505_1082760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029828.1|1082937_1083831_+	recombinase RecT	NA	A0A1B0YA63	Lactobacillus_phage	54.9	3.9e-78
WP_149029829.1|1083805_1084615_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	49.6	6.0e-70
WP_083484612.1|1084626_1085496_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_083484613.1|1085708_1085972_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057814669.1|1086068_1086500_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	39.4	5.0e-15
WP_057814671.1|1086496_1087234_+	hypothetical protein	NA	E9LUT0	Lactobacillus_phage	52.7	3.3e-59
WP_057814674.1|1087233_1087734_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	54.8	1.3e-43
WP_010019123.1|1087943_1088153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010019127.1|1088383_1088569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029830.1|1088578_1088797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057815926.1|1089109_1089331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029831.1|1089374_1089620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029832.1|1089754_1090225_+	hypothetical protein	NA	O03925	Lactobacillus_phage	35.8	1.0e-13
WP_057815931.1|1090546_1090810_+	hypothetical protein	NA	C1KFI4	Lactobacillus_virus	67.1	1.1e-25
WP_057815933.1|1091631_1092123_+	hypothetical protein	NA	A9D9R6	Lactobacillus_prophage	57.1	1.6e-33
WP_057815935.1|1092070_1093420_+|terminase	PBSX family phage terminase large subunit	terminase	O03927	Lactobacillus_phage	62.0	2.0e-166
WP_057815937.1|1093441_1094974_+|portal	phage portal protein	portal	O03928	Lactobacillus_phage	55.7	4.8e-153
WP_083484648.1|1094970_1096467_+	hypothetical protein	NA	O03929	Lactobacillus_phage	50.3	1.1e-82
WP_057815939.1|1096468_1096669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057815941.1|1096770_1097343_+	hypothetical protein	NA	O03931	Lactobacillus_phage	52.8	6.2e-13
WP_057815943.1|1097365_1098253_+	hypothetical protein	NA	U3PDP8	Lactobacillus_phage	68.6	1.8e-107
WP_057815946.1|1098281_1098701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057816052.1|1098723_1099047_+|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	54.1	1.0e-25
WP_057816054.1|1099071_1099410_+	hypothetical protein	NA	O03933	Lactobacillus_phage	50.0	6.0e-16
WP_057815948.1|1099393_1099789_+	hypothetical protein	NA	O03934	Lactobacillus_phage	51.9	9.2e-32
WP_057815950.1|1099801_1100362_+	hypothetical protein	NA	O03972	Lactobacillus_phage	49.1	7.9e-37
WP_057815952.1|1100445_1100841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083484649.1|1100848_1101484_+	hypothetical protein	NA	O03936	Lactobacillus_phage	35.4	5.8e-28
WP_057815955.1|1101516_1106358_+	tape measure protein	NA	A0A220GC82	Streptococcus_phage	38.3	1.5e-75
WP_057815957.1|1106357_1107185_+|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	43.0	1.2e-54
WP_057815959.1|1107197_1108379_+	hypothetical protein	NA	O03938	Lactobacillus_phage	41.1	1.3e-78
1116679:1116699	attR	TTCAAATCCTGTACTCACCTT	NA	NA	NA	NA
>prophage 9
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	1159575	1238643	2558218	tRNA,transposase	unidentified_phage(19.23%)	76	NA	NA
WP_149029771.1|1159575_1160607_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_057814374.1|1160701_1162081_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_057814372.1|1162211_1162910_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_057814370.1|1162937_1163669_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_057814368.1|1163743_1165366_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.8	1.9e-46
WP_057814366.1|1165453_1165759_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_057814364.1|1165814_1166792_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_149029833.1|1166918_1167260_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149029810.1|1167344_1168265_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.4	1.1e-48
WP_149029834.1|1168364_1169000_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	41.9	5.4e-34
WP_057816058.1|1169131_1170571_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_057816060.1|1170587_1172444_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_057816063.1|1172579_1173578_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_057816066.1|1173884_1174397_+	VanZ family protein	NA	NA	NA	NA	NA
WP_057816069.1|1174435_1175320_+	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	35.4	1.9e-13
WP_057816071.1|1175400_1176204_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.0	2.6e-57
WP_149029835.1|1176286_1176817_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149029836.1|1176813_1177665_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	47.0	2.4e-45
WP_057813728.1|1177719_1178526_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_149029810.1|1178647_1179568_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.4	1.1e-48
WP_057812790.1|1179701_1180136_-	universal stress protein	NA	NA	NA	NA	NA
WP_083484544.1|1180241_1181087_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_057812794.1|1181213_1182035_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_057812796.1|1182065_1182647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057812798.1|1182835_1183483_+	helix-turn-helix transcriptional regulator	NA	B5LPU3	Bacillus_virus	38.1	3.2e-05
WP_057812800.1|1183727_1184087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149029777.1|1184447_1185479_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.8	1.0e-42
WP_149029837.1|1186183_1187488_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	44.9	1.3e-103
WP_057813079.1|1187718_1188135_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_057813077.1|1188179_1188731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083484553.1|1188919_1191115_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_057813075.1|1191600_1192194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029777.1|1192223_1193255_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.8	1.0e-42
WP_149029771.1|1194634_1195666_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_149029770.1|1196033_1196954_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.0	4.3e-48
WP_083484578.1|1196977_1197586_+	hypothetical protein	NA	V9QKZ6	Oenococcus_phage	48.6	1.2e-22
WP_057813865.1|1197650_1198592_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_057813867.1|1198774_1199740_+	hydroxyacid dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	35.9	4.4e-35
WP_057813869.1|1199753_1200059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813872.1|1200405_1201845_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.3	5.2e-101
WP_149029836.1|1201895_1202747_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	47.0	2.4e-45
WP_057813083.1|1202743_1203274_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_057816117.1|1203493_1204345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057816119.1|1205088_1205670_+	Sir2 silent information regulator family NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_057816115.1|1205942_1207226_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.2	5.9e-104
WP_057816112.1|1207609_1207975_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_149029838.1|1209592_1209832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057816111.1|1210015_1211236_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_057816109.1|1211540_1211720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057816107.1|1212047_1212554_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_057814503.1|1212694_1213588_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	29.0	1.0e-17
WP_057814501.1|1213584_1214253_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.3	5.9e-31
WP_057811863.1|1215047_1215449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057811862.1|1215513_1216431_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_057811861.1|1216411_1217161_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_057811860.1|1217171_1217510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057811859.1|1217598_1219830_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.8	1.1e-09
WP_057811858.1|1219833_1220271_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_057811857.1|1220273_1220897_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_057811856.1|1220941_1221340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057811855.1|1221432_1222848_+	MFS transporter	NA	NA	NA	NA	NA
WP_083484521.1|1222871_1224182_-	SH3 domain-containing protein	NA	D6QWP2	uncultured_phage	27.6	7.3e-09
WP_057811854.1|1224506_1225778_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_057811853.1|1225780_1227550_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SFI4	Hokovirus	35.2	3.2e-07
WP_057811852.1|1228021_1228465_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_057811851.1|1228464_1228983_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_057811850.1|1229060_1229939_+	YitT family protein	NA	NA	NA	NA	NA
WP_057811849.1|1230008_1230905_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.4	9.1e-27
WP_057811848.1|1230951_1231773_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_010019742.1|1231895_1232078_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_057811847.1|1232184_1233162_+	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	49.8	1.9e-49
WP_010019746.1|1233180_1233651_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_057811846.1|1233790_1234702_+	GTPase Era	NA	NA	NA	NA	NA
WP_057811845.1|1234701_1235460_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_057811844.1|1235681_1236590_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_057811843.1|1236582_1238643_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	1291663	1340348	2558218	protease,integrase,transposase	Bacillus_phage(26.67%)	46	1291584:1291643	1299997:1301228
1291584:1291643	attL	CGCAAATTGCAAGAACAAGTTAGCCACTTTGGAAAAATAAAGAAAAGTTAAGATTTATCA	NA	NA	NA	NA
WP_149029771.1|1291663_1292695_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_057816121.1|1292870_1293389_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_010019812.1|1293425_1294013_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	35.5	3.3e-25
WP_057816122.1|1294697_1297088_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	30.7	1.1e-119
WP_149029841.1|1297137_1298400_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	38.7	1.6e-66
WP_149029842.1|1298509_1298803_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_149029771.1|1298944_1299976_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_083484618.1|1300049_1300313_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_057814809.1|1300728_1300935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083484619.1|1301029_1301296_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
1299997:1301228	attR	TGATAAATCTTAACTTTTCTTTATTTTTCCAAAGTGGCTAACTTGTTCTTGCAATTTGCGATTCAATAAAATTTAAAAATTCTTCTAAAAATGATTTAAAAAAGATAAAGAATAGTCCATTTTGTAAGAAATTTGACGAAATAATTAAAAAGTTGTCAGTAAATCCATATGATCCATCAGATAACTTTGAAAAATTGTTTCCACCAGAAGATAAACTTTATTCTAGAAGATTGAATATTCAACATCGTATTGTATATTCAATTGATGAAGAGAAACAAATAGTACATATTTATTCAGCGTGGAATCATTACGCGTAAAAAACTACAAAAAGACGTCGAAAAAGTCCTCAAAAATCTTGGTATGACGACAACAGACGCGATAACTCTTTTATGCTAAGACTAATTCTTATCCAGTAGATTTGACATTAACTCAAAAGGAAATTGCCGGTATAGTAGAGGAAAGTAACAAAAAATAGAATATGCATATGAGGGACTGATACAAATTTCAAAAGAAGATAGAAAAATATTAAAATCTGACAGAGAACAAGTACGTCCGGAAATACTTGAAATAGCCAGAAAATTATATGACAAACATTCTAACTTAATGGAACGATTAAAAGATTTATGACAAAATAAAAGGACTTTTCTAATGTTGAGAAGGCTTTTTTGTACTTCTTGATTAAAAGTATTCATATCATTTCGTCCAGTAGTTTCTATTGTTCAAATCGCCTATATGACTAACGATAGAGAAATTGATTATAAATTAACCAAAAAAGGCGAAACATTTAAGGGAACAATGATCTCTCGAAGTAGCATTGTTGATTTTGTAATTAAAATAATTAATAATCCTGAAAAGTATATGTCAGAAAGTTACGGTATCAGTAAACCTGGTACTGACAATATGCTGAAACAAATACGAGAAATGGATCATGATATTTAAATGTACTTTAATCTGTATTTTTTCTTAAAATCACATTGTGTAGTATACTTAATCTAAAGCATAAAGTACTTTAGATTTTAAGGAGGCCTACGAAATGCAAGAAAAAGAAGAACTAAGTAAATTGTCAAAGCAAGGCCAATTAGTTATTCCTTCCGCTATCAGAAAGCAATTGCATCTTGAAGGTGGAGATATATTTACTTGGACGATAAATGATAAATCTGAGATGGTTTTAAAGAAAAAAGAGCTGGATTGGAGTCAAATATTAAAGCGTACTCCAGAAGAGGAAATTACTT	NA	NA	NA	NA
WP_083484620.1|1301306_1301651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057814812.1|1302696_1302960_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_057814815.1|1302949_1303231_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_057814817.1|1303656_1303899_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_083484623.1|1303784_1304126_+	hypothetical protein	NA	O03929	Lactobacillus_phage	49.3	4.1e-12
WP_057814819.1|1304635_1304836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083484621.1|1306238_1306832_+	acetyltransferase	NA	NA	NA	NA	NA
WP_057814821.1|1306828_1307182_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_083484622.1|1307202_1307379_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_057814823.1|1307672_1307906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029777.1|1308013_1309045_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.8	1.0e-42
WP_057815393.1|1310148_1311006_-	metallophosphatase family protein	NA	NA	NA	NA	NA
WP_057815395.1|1311422_1313231_-	DNA helicase RecQ	NA	A0A1V0SGM9	Hokovirus	35.9	4.6e-78
WP_057815396.1|1313289_1313931_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057815399.1|1313935_1315006_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_057815401.1|1314983_1315721_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.8	1.1e-27
WP_057815403.1|1315807_1316299_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	45.2	1.9e-18
WP_057815405.1|1316473_1317511_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_057815408.1|1317515_1318412_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_057815410.1|1318415_1319888_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_057815412.1|1319892_1320747_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057815414.1|1320749_1321229_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_057815417.1|1321312_1322140_+	recombinase XerD	NA	NA	NA	NA	NA
WP_057815419.1|1322153_1322723_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_149029810.1|1322881_1323802_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.4	1.1e-48
WP_057814888.1|1324027_1324912_-	ribose uptake protein RbsU	NA	NA	NA	NA	NA
WP_057814886.1|1325690_1326623_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_057814884.1|1326652_1327612_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083484624.1|1327704_1330146_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	31.2	1.0e-96
WP_057814882.1|1330156_1332157_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.2	4.2e-117
WP_057814880.1|1332364_1332988_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_057814878.1|1334820_1336539_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	2.1e-32
WP_057814876.1|1336828_1337518_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_057814874.1|1337571_1337850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057814872.1|1338023_1338902_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_057814870.1|1338911_1340348_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IBU3	Erwinia_phage	24.5	2.8e-30
>prophage 11
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	1438075	1444144	2558218		Staphylococcus_phage(50.0%)	7	NA	NA
WP_149029848.1|1438075_1438921_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.2	4.0e-08
WP_057814204.1|1438977_1439736_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_057814206.1|1439825_1440287_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.6	1.1e-28
WP_057814211.1|1440288_1441491_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.2	1.2e-95
WP_057814216.1|1441480_1442080_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.5	1.1e-33
WP_057814217.1|1442079_1443111_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.2	1.5e-41
WP_057814220.1|1443430_1444144_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A2P9FI75	Pseudomonas_phage	28.9	2.0e-05
>prophage 12
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	1580873	1619570	2558218	protease,integrase,transposase,head,tail	Staphylococcus_phage(25.0%)	39	1583339:1583354	1610632:1610647
WP_057812118.1|1580873_1581572_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_057812120.1|1581568_1581799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083484530.1|1582625_1582769_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
1583339:1583354	attL	TTGAATTGTTTCATAA	NA	NA	NA	NA
WP_057812124.1|1583963_1584224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057812128.1|1585140_1585506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057812130.1|1585636_1585867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057812132.1|1585907_1586456_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_083484531.1|1586587_1586737_+	Arm DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_057812134.1|1587344_1587686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057812136.1|1587728_1588313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057812140.1|1589057_1590461_-	hypothetical protein	NA	A0A2I6PDP5	Staphylococcus_phage	34.9	4.7e-70
WP_149029849.1|1590460_1591291_-	DNA replication protein	NA	NA	NA	NA	NA
WP_057812144.1|1591706_1591928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057812145.1|1591930_1592125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057812147.1|1592179_1592458_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_057812149.1|1592600_1593398_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_057812151.1|1593448_1594627_+|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	38.6	8.8e-54
WP_057812154.1|1594928_1595309_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	39.6	2.0e-15
WP_057812156.1|1595362_1596100_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_057812158.1|1596250_1597072_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057812160.1|1597133_1597760_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_057812163.1|1597802_1600067_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.8	1.3e-127
WP_057812165.1|1600200_1601025_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.2	2.1e-46
WP_149029771.1|1601777_1602809_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_057813609.1|1603713_1604262_+	LemA family protein	NA	NA	NA	NA	NA
WP_057813607.1|1604274_1605183_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_057813604.1|1605337_1606138_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_057813602.1|1606148_1607387_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.6	5.9e-101
WP_057813600.1|1607489_1607798_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057813597.1|1607859_1609074_+	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_057813595.1|1609077_1609764_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_057813593.1|1609885_1613467_+	hypothetical protein	NA	NA	NA	NA	NA
1610632:1610647	attR	TTATGAAACAATTCAA	NA	NA	NA	NA
WP_057813591.1|1613719_1615246_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_057813590.1|1615284_1616715_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_057813588.1|1616724_1617051_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_057813586.1|1617247_1617427_-	CsbD family protein	NA	NA	NA	NA	NA
WP_057813584.1|1617495_1617732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813582.1|1617949_1618576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029810.1|1618649_1619570_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.4	1.1e-48
>prophage 13
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	1683767	1744031	2558218	protease,tRNA,transposase	Staphylococcus_prophage(18.75%)	50	NA	NA
WP_057813151.1|1683767_1684475_+|tRNA	tRNA ligase	tRNA	NA	NA	NA	NA
WP_057813153.1|1684878_1685058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813155.1|1685060_1685753_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_057813158.1|1685891_1686326_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_057813160.1|1686585_1687440_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_149029896.1|1687490_1688912_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_149029770.1|1689090_1690011_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.0	4.3e-48
WP_057816073.1|1690092_1690761_-	LysM peptidoglycan-binding domain-containing protein	NA	C1KFL4	Lactobacillus_virus	64.8	1.8e-24
WP_149029770.1|1690972_1691893_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.0	4.3e-48
WP_057814437.1|1692149_1693685_-	gluconokinase	NA	NA	NA	NA	NA
WP_057814435.1|1693806_1695774_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_057814433.1|1695984_1698684_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_057814431.1|1698742_1700077_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_057814429.1|1700252_1701605_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_057814428.1|1701790_1702834_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_083484606.1|1702943_1703942_+	ROK family protein	NA	NA	NA	NA	NA
WP_057814424.1|1704007_1704814_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_057814422.1|1704887_1705682_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_057814420.1|1705709_1706318_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_057814418.1|1706326_1706896_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_057814416.1|1707050_1707770_+	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	33.9	4.1e-30
WP_083484605.1|1707817_1708489_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_057814414.1|1708469_1710065_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.9	8.9e-17
WP_149029852.1|1709998_1710946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149029810.1|1711039_1711960_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.4	1.1e-48
WP_057813730.1|1712099_1712480_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_149029853.1|1712528_1714178_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_149029777.1|1714271_1715303_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.8	1.0e-42
WP_057813558.1|1715567_1715936_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_057813556.1|1715938_1716526_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_057813554.1|1716539_1717532_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_057813562.1|1718148_1719474_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.3	1.2e-48
WP_057813549.1|1719772_1721869_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.5	2.1e-122
WP_057813547.1|1721881_1722103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813545.1|1722243_1723962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813543.1|1724386_1725784_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_057813541.1|1725752_1726289_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_057813539.1|1726320_1727661_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_083484565.1|1727720_1728350_-	VanZ family protein	NA	NA	NA	NA	NA
WP_083484566.1|1728975_1730604_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	50.2	9.7e-144
WP_057813534.1|1730684_1732823_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	47.4	1.2e-162
WP_057813531.1|1732883_1734380_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.1	1.3e-22
WP_057813529.1|1734379_1735129_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.5	3.4e-35
WP_057813528.1|1735226_1736003_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_057813526.1|1736053_1737049_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_057813524.1|1737153_1737819_-	hypothetical protein	NA	C1KFL4	Lactobacillus_virus	55.1	5.2e-19
WP_057813522.1|1738134_1738683_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_057813520.1|1738735_1741363_-	glycoside hydrolase family 3	NA	NA	NA	NA	NA
WP_057813516.1|1741893_1743084_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	5.6e-40
WP_149029804.1|1743179_1744031_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	47.0	2.4e-45
>prophage 14
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	1765711	1818880	2558218	tRNA,transposase	unidentified_phage(27.27%)	49	NA	NA
WP_149029771.1|1765711_1766743_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_149029856.1|1766988_1768158_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	64.1	3.2e-133
WP_057814804.1|1768596_1769433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057814802.1|1769646_1770402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057814800.1|1770550_1772980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010020398.1|1773117_1773756_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_057814798.1|1774019_1775201_+	MFS transporter	NA	NA	NA	NA	NA
WP_057814795.1|1775297_1776644_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_057814794.1|1776738_1777158_-	GNAT family N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	41.3	7.5e-24
WP_057814792.1|1777305_1777626_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_057814790.1|1777715_1777967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057814788.1|1778048_1778903_+	hydrolase	NA	NA	NA	NA	NA
WP_149029857.1|1778923_1779511_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149029804.1|1779507_1780359_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	47.0	2.4e-45
WP_149029897.1|1780414_1781656_-	MFS transporter	NA	NA	NA	NA	NA
WP_057813721.1|1781958_1784577_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_057813719.1|1785071_1786748_-	oleate hydratase	NA	NA	NA	NA	NA
WP_057813717.1|1786916_1788113_-	acetate kinase	NA	NA	NA	NA	NA
WP_057813715.1|1788123_1789137_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_057813714.1|1789188_1789413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083484574.1|1789402_1789852_-	ComGF family competence protein	NA	NA	NA	NA	NA
WP_057813710.1|1789823_1790111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149029858.1|1790094_1790490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813725.1|1790518_1790839_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_057813706.1|1790838_1791852_-	competence protein ComG	NA	NA	NA	NA	NA
WP_057813704.1|1791817_1792786_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_057813702.1|1792866_1793601_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_083484573.1|1793714_1797239_-	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_149029771.1|1797515_1798547_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_057811867.1|1798604_1799141_-	VanZ family protein	NA	NA	NA	NA	NA
WP_057811868.1|1799140_1800736_-	APC family permease	NA	NA	NA	NA	NA
WP_057811869.1|1800818_1802630_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	38.5	2.0e-102
WP_057811870.1|1802957_1804310_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_057811871.1|1804331_1805405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057811872.1|1805388_1806246_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_057811874.1|1808467_1809367_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_057811875.1|1809479_1810241_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	47.5	2.3e-55
WP_057811876.1|1810244_1810778_+	3'-5' exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	45.2	1.1e-24
WP_057811877.1|1810770_1811238_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_057811878.1|1811234_1811693_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_057811879.1|1811708_1812677_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_057811880.1|1812676_1813375_-	uracil-DNA glycosylase	NA	Q80BN1	Saimiriine_herpesvirus	45.5	2.3e-38
WP_057811881.1|1813458_1814334_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_057811882.1|1814336_1814876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057813083.1|1814950_1815481_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149029804.1|1815477_1816329_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	47.0	2.4e-45
WP_057814967.1|1816380_1816947_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_057814965.1|1817170_1817671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149029771.1|1817848_1818880_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
>prophage 15
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	1856010	1866016	2558218	tRNA,transposase	Bacillus_phage(33.33%)	9	NA	NA
WP_057812440.1|1856010_1857450_-	glucose-6-phosphate dehydrogenase	NA	A0A1D8KHJ5	Synechococcus_phage	32.5	2.5e-55
WP_057813091.1|1857707_1858601_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	1.4e-16
WP_149029769.1|1858597_1859302_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	33.9	2.5e-24
WP_057814297.1|1859635_1860121_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_057814275.1|1860217_1861360_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.2	5.5e-85
WP_057814276.1|1861369_1862404_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_029606454.1|1862469_1863489_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	32.6	8.8e-10
WP_057814277.1|1863502_1864090_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_057814278.1|1864093_1866016_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.9	1.4e-64
>prophage 16
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	1912453	1920718	2558218	transposase	Streptococcus_phage(50.0%)	11	NA	NA
WP_057812370.1|1912453_1913323_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	56.6	4.6e-84
WP_057812372.1|1913337_1913697_-	DUF972 family protein	NA	NA	NA	NA	NA
WP_057812374.1|1913708_1914662_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	26.7	1.6e-18
WP_057812376.1|1914664_1914991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057812378.1|1914994_1915645_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	53.6	5.7e-55
WP_057814501.1|1916122_1916791_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.3	5.9e-31
WP_057814503.1|1916787_1917681_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	29.0	1.0e-17
WP_057812638.1|1917782_1918070_-	YaaL family protein	NA	NA	NA	NA	NA
WP_057812640.1|1918071_1918671_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_010018682.1|1918670_1919000_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_057812642.1|1919011_1920718_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.0	3.7e-53
>prophage 17
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	2026104	2083482	2558218	tRNA,transposase,protease	Streptococcus_phage(11.11%)	44	NA	NA
WP_057814540.1|2026104_2027310_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_057814538.1|2027386_2029483_-	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	26.1	4.8e-63
WP_010018510.1|2029529_2029997_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_010018509.1|2030043_2030457_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_083484610.1|2030666_2031353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057814536.1|2031338_2032157_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_057814534.1|2032293_2035962_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	23.9	1.1e-65
WP_057814532.1|2035986_2039595_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.6	7.6e-48
WP_057814530.1|2039840_2042342_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.3	2.6e-124
WP_057814661.1|2043150_2044641_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	37.7	4.3e-90
WP_057814528.1|2044719_2045721_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_057814525.1|2045791_2046673_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_057814523.1|2046729_2048910_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A9YVR1	Ostreococcus_tauri_virus	47.6	4.2e-110
WP_057814521.1|2048992_2049538_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.1	1.6e-13
WP_057814519.1|2049534_2050860_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	29.0	4.9e-21
WP_057814517.1|2050919_2051333_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_057814515.1|2051356_2051746_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_057814514.1|2051844_2052084_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_057814512.1|2052086_2053646_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_057814510.1|2053647_2057172_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_057814509.1|2057195_2057753_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010018488.1|2057899_2058883_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_057814507.1|2059003_2059666_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_057814505.1|2059857_2060973_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_057814501.1|2061501_2062170_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.3	5.9e-31
WP_057814503.1|2062166_2063060_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	29.0	1.0e-17
WP_057814402.1|2063169_2064282_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.0	7.3e-34
WP_057814400.1|2064281_2064644_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_057814397.1|2064885_2066409_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.6	2.1e-63
WP_057814395.1|2066492_2067854_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_083484603.1|2067943_2069182_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_010018477.1|2069207_2069456_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_057814392.1|2069556_2071053_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.4	6.1e-28
WP_057814390.1|2071280_2072561_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_057814388.1|2072598_2074212_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.2	2.3e-137
WP_057814386.1|2074389_2075025_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_057814384.1|2075071_2075512_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_057814382.1|2075567_2076380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057814380.1|2076379_2077723_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	31.5	6.1e-27
WP_057814378.1|2077799_2079497_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_057813091.1|2079600_2080494_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	1.4e-16
WP_149029769.1|2080490_2081195_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	33.9	2.5e-24
WP_057812631.1|2081611_2082025_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_057812629.1|2082312_2083482_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	63.9	4.2e-133
>prophage 18
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	2242934	2346660	2558218	bacteriocin,transposase	unidentified_phage(17.39%)	98	NA	NA
WP_149029777.1|2242934_2243966_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.8	1.0e-42
WP_057813579.1|2244122_2245184_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_057813581.1|2245192_2246512_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_057813577.1|2246527_2246863_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_149029771.1|2247038_2248070_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	1.0e-42
WP_057811883.1|2248110_2249178_-	aminopeptidase	NA	NA	NA	NA	NA
WP_057811884.1|2249192_2249513_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_083484523.1|2249517_2251464_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_057811886.1|2251606_2252527_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_057811887.1|2252674_2253586_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_057813091.1|2253735_2254629_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	1.4e-16
WP_149029769.1|2254625_2255330_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	33.9	2.5e-24
WP_057814720.1|2255754_2256810_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_057814718.1|2256983_2257928_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_057814716.1|2258067_2260797_+	HAD-IC family P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	29.7	7.4e-64
WP_057814714.1|2261253_2261943_-	RNase HI	NA	C1KFJ1	Lactobacillus_virus	36.2	1.6e-31
WP_057814712.1|2262012_2262768_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_083484615.1|2262893_2265569_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_057814710.1|2265589_2266036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010018255.1|2266041_2266740_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_057814708.1|2266851_2268318_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_057814706.1|2268382_2269114_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_057814704.1|2269183_2269519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057814702.1|2269583_2269847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057814700.1|2269999_2270650_+	endonuclease III	NA	NA	NA	NA	NA
WP_057814697.1|2270620_2271214_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057814695.1|2271408_2272329_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	6.5e-20
WP_057814693.1|2272318_2273935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057814691.1|2274001_2274991_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_057814688.1|2275042_2276305_-	aluminum resistance protein	NA	NA	NA	NA	NA
WP_057814686.1|2276316_2278410_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_057814684.1|2278627_2280097_+	APC family permease	NA	NA	NA	NA	NA
WP_057814682.1|2280392_2280719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149029868.1|2280822_2281107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149029777.1|2281160_2282192_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.8	1.0e-42
WP_057814158.1|2282843_2283185_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_029606431.1|2283205_2283511_-	Gar-IM	NA	NA	NA	NA	NA
WP_057814159.1|2283713_2284007_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_057814160.1|2284123_2284408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029777.1|2285242_2286274_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.8	1.0e-42
WP_149029869.1|2286378_2286537_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_149029870.1|2286567_2286741_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_057812724.1|2287157_2287484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057812722.1|2287769_2288090_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_057812720.1|2288453_2288633_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_057812718.1|2288706_2288964_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057812716.1|2288983_2290363_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_057812714.1|2290374_2292531_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	8.3e-42
WP_149029810.1|2292682_2293603_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.4	1.1e-48
WP_149029871.1|2293801_2293936_+|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_057812840.1|2293971_2295285_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_057812837.1|2295281_2296028_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_057812834.1|2296059_2296353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057812832.1|2296555_2296906_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_057812830.1|2296916_2297252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057812828.1|2297293_2297590_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_010018220.1|2297689_2298157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057812826.1|2299994_2300291_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_057812824.1|2300290_2300626_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_057812822.1|2300965_2301736_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	45.2	3.7e-45
WP_057812820.1|2301750_2303154_-	amino acid permease	NA	NA	NA	NA	NA
WP_057812817.1|2303287_2304694_-	amino acid permease	NA	NA	NA	NA	NA
WP_057812842.1|2304823_2305546_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057812815.1|2305693_2306053_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_057812813.1|2306222_2306660_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_057812811.1|2307282_2308779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057812809.1|2308796_2309747_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_057812806.1|2309987_2310692_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_057812804.1|2310702_2311311_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_057812802.1|2311515_2312865_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.9	3.3e-65
WP_149029769.1|2313408_2314113_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	33.9	2.5e-24
WP_057813091.1|2314109_2315003_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	1.4e-16
WP_057813185.1|2315156_2317028_-	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_010018202.1|2317167_2318052_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.7	2.7e-63
WP_057813183.1|2318128_2318917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813181.1|2319026_2319803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813178.1|2320061_2321354_-	purine permease	NA	NA	NA	NA	NA
WP_057813176.1|2321479_2322916_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_057813174.1|2323000_2323471_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_010018193.1|2323654_2324572_+	EamA family transporter	NA	NA	NA	NA	NA
WP_057813172.1|2324957_2325950_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_057813171.1|2326064_2327072_+	D-2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	33.7	1.1e-41
WP_149029872.1|2327181_2328186_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	35.9	2.0e-46
WP_149029770.1|2328474_2329395_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.0	4.3e-48
WP_057811802.1|2329464_2331936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057811801.1|2332348_2333476_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	39.8	3.9e-67
WP_057811800.1|2333703_2334087_+	YxeA family protein	NA	NA	NA	NA	NA
WP_057811799.1|2334154_2335528_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_057811798.1|2335647_2336784_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_057811797.1|2337147_2338611_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_057811796.1|2339050_2339980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057811795.1|2340064_2340709_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_057811794.1|2340945_2341368_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057811793.1|2341380_2342322_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_057811792.1|2342556_2343468_+	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.2	2.6e-61
WP_057811791.1|2343556_2344708_+	MFS transporter	NA	NA	NA	NA	NA
WP_057814501.1|2345101_2345770_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.3	5.9e-31
WP_057814503.1|2345766_2346660_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	29.0	1.0e-17
>prophage 19
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	2362475	2407247	2558218	tRNA,terminase,integrase,transposase	Bacillus_phage(21.05%)	47	2380863:2380882	2403712:2403731
WP_057814326.1|2362475_2362820_-|terminase	terminase small subunit	terminase	V9QKX0	Oenococcus_phage	47.3	1.5e-17
WP_083484590.1|2364854_2365358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083484589.1|2365365_2365824_-	hypothetical protein	NA	D2IYV6	Enterococcus_phage	35.0	5.9e-14
WP_149029873.1|2365951_2367202_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	29.0	2.1e-13
WP_057812875.1|2367812_2369675_+	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_057812879.1|2369775_2371173_+	amino acid permease	NA	NA	NA	NA	NA
WP_057812881.1|2371211_2372606_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_057812883.1|2372670_2373936_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	42.1	6.2e-82
WP_149029900.1|2374106_2374367_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011373852.1|2374405_2375326_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_149029874.1|2375410_2376394_-|transposase	transposase	transposase	Q6V7R1	Burkholderia_virus	29.0	5.7e-14
WP_149029875.1|2376580_2377405_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_149029876.1|2377500_2378275_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_057812853.1|2378398_2379082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057812850.1|2379247_2380210_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.0	5.9e-16
2380863:2380882	attL	ATGTTCCATGTGAAACATTT	NA	NA	NA	NA
WP_057812848.1|2381238_2381601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149029877.1|2382710_2382803_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_057813639.1|2382832_2384326_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_149029878.1|2384420_2384948_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_057813643.1|2384993_2385740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083484568.1|2385756_2386479_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_149029879.1|2386863_2387808_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.1	2.8e-42
WP_057813652.1|2387759_2388293_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	26.9	1.5e-08
WP_057813654.1|2388370_2388577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813656.1|2388602_2389352_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	33.6	1.9e-17
WP_083484569.1|2389355_2390192_-	DnaD domain protein	NA	F0PII1	Enterococcus_phage	42.7	4.0e-37
WP_057813660.1|2390260_2390488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813661.1|2390487_2390694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813663.1|2390760_2391453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813665.1|2391734_2391998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813668.1|2392023_2392230_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057813670.1|2392381_2393053_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	26.6	1.4e-11
WP_057813672.1|2393089_2394256_+|integrase	site-specific integrase	integrase	J7KBT5	Streptococcus_phage	36.2	1.3e-52
WP_057813674.1|2395541_2396330_-	hypothetical protein	NA	Q6SE85	Lactobacillus_prophage	48.8	6.7e-58
WP_057813676.1|2396497_2397376_-	DUF4373 domain-containing protein	NA	D2IZY0	Enterococcus_phage	36.9	5.5e-37
WP_057813678.1|2397378_2397672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813680.1|2397722_2398502_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_057813682.1|2398523_2398793_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_057813684.1|2398792_2398978_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083484570.1|2399112_2399820_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JH10	uncultured_Caudovirales_phage	37.7	2.4e-06
WP_057813688.1|2399867_2401019_+|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	32.3	2.3e-46
WP_083484572.1|2401748_2402273_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_057813692.1|2402457_2402733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149029880.1|2402774_2403545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057813697.1|2403778_2404723_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
2403712:2403731	attR	AAATGTTTCACATGGAACAT	NA	NA	NA	NA
WP_057813699.1|2404879_2406163_+	amino acid permease	NA	NA	NA	NA	NA
WP_057813091.1|2406353_2407247_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	1.4e-16
>prophage 20
NZ_CP040736	Lactobacillus futsaii strain Y97 chromosome, complete genome	2558218	2525054	2531917	2558218	transposase	Paenibacillus_phage(16.67%)	6	NA	NA
WP_057814501.1|2525054_2525723_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.3	5.9e-31
WP_057814503.1|2525719_2526613_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	29.0	1.0e-17
WP_057814272.1|2526718_2527894_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	27.6	4.2e-24
WP_149029794.1|2528126_2529158_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.6	3.6e-43
WP_057812328.1|2529322_2531338_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	33.7	1.2e-63
WP_057812330.1|2531362_2531917_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	39.3	2.5e-27
