assembly_id	genome_id	genome_def	crispr_array_locus_merge	crispr_array_location_merge	crispr_locus_id	crispr_pred_method	array_in_prot	prot_within_array_20000	prot_in_genome	crispr_type_by_cas_prot	consensus_repeat	repeat_length	self-targeting_spacer_number	self-targeting_target_number	spacer_location	protospacer_location	repeat_type	spacer_locus_num	spacer_num	correct_crispr_type	genome_cas_prots	unknown_protein_around_crispr	L10	L10_domain	L9	L9_domain	L8	L8_domain	L7	L7_domain	L6	L6_domain	L5	L5_domain	L4	L4_domain	L3	L3_domain	L2	L2_domain	L1	L1_domain	R1	R1_domain	R2	R2_domain	R3	R3_domain	R4	R4_domain	R5	R5_domain	R6	R6_domain	R7	R7_domain	R8	R8_domain	R9	R9_domain	R10	R10_domain
GCF_006007905.1_ASM600790v1	NZ_CP040747	Bacillus altitudinis strain HQ-51-Ba chromosome, complete genome	1	776315-776537	1	PILER-CR	no		csa3,DEDDh,WYL,DinG,cas3	Orphan	AGGCGCCACAGGTGCGACAGGTGTAACAGGAGATACGGGTGCAACAGGGGCTACAG	56	2	2	776371-776401|776458-776488	NZ_CP040747.1_776538-776568|NZ_CP040747.1_776538-776568	NA	2	2	Orphan	csa3,DEDDh,WYL,DinG,cas3	NA,NA|142aa|down_8|NZ_CP040747.1_786365_786791_+	NA|518aa|up_9|NZ_CP040747.1_762655_764209_-	COG0488, Uup, ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]	NA|381aa|up_8|NZ_CP040747.1_764361_765504_+	COG0513, SrmB, Superfamily II DNA and RNA helicases [DNA replication, recombination, and repair / Transcription / Translation, ribosomal structure and biogenesis]	NA|335aa|up_7|NZ_CP040747.1_765541_766546_-	cd05288, PGDH, Prostaglandin dehydrogenases	NA|126aa|up_6|NZ_CP040747.1_766667_767045_-	pfam11486, DUF3212, Protein of unknown function (DUF3212)	NA|116aa|up_5|NZ_CP040747.1_767267_767615_+	pfam11181, YflT, Heat induced stress protein YflT	NA|219aa|up_4|NZ_CP040747.1_768755_769412_+	pfam13649, Methyltransf_25, Methyltransferase domain	NA|242aa|up_3|NZ_CP040747.1_769929_770655_+	cd00641, GTP_cyclohydro2, GTP cyclohydrolase II (RibA)	NA|268aa|up_2|NZ_CP040747.1_770687_771491_+	pfam03781, FGE-sulfatase, Sulfatase-modifying factor enzyme 1	NA|586aa|up_1|NZ_CP040747.1_771495_773253_+	cd00200, WD40, WD40 domain, found in a number of eukaryotic proteins that cover a wide variety of functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly; typically contains a GH dipeptide 11-24 residues from its N-terminus and the WD dipeptide at its C-terminus and is 40 residues long, hence the name WD40; between GH and WD lies a conserved core; serves as a stable propeller-like platform to which proteins can bind either stably or reversibly; forms a propeller-like structure with several blades where each blade is composed of a four-stranded anti-parallel b-sheet; instances with few detectable copies are hypothesized to form larger structures by dimerization; each WD40 sequence repeat forms the first three strands of one blade and the last strand in the next blade; the last C-terminal WD40 repeat completes the blade structure of the first WD40 repeat to create the closed ring propeller-structure; residues on the top and bottom surface of the propeller are proposed to coordinate interactions with other proteins and/or small ligands; 7 copies of the repeat are present in this alignment	NA|361aa|up_0|NZ_CP040747.1_773534_774617_+	TIGR00326, eubact_ribD, riboflavin biosynthesis protein RibD	NA|532aa|down_0|NZ_CP040747.1_777244_778840_+	COG3290, CitA, Signal transduction histidine kinase regulating citrate/malate metabolism [Signal transduction mechanisms]	NA|233aa|down_1|NZ_CP040747.1_778843_779542_+	COG4565, CitB, Response regulator of citrate/malate metabolism [Transcription / Signal transduction mechanisms]	NA|326aa|down_2|NZ_CP040747.1_779544_780522_+	COG3181, COG3181, Uncharacterized protein conserved in bacteria [Function unknown]	NA|433aa|down_3|NZ_CP040747.1_780713_782012_+	TIGR00784, Mg2+/citrate_complex_secondary_transporter, citrate transporter, CitMHS family	NA|544aa|down_4|NZ_CP040747.1_782193_783825_+	cd06242, M14-like, Peptidase M14-like domain; uncharacterized subgroup	NA|162aa|down_5|NZ_CP040747.1_783897_784383_-	pfam05870, PA_decarbox, Phenolic acid decarboxylase (PAD)	NA|186aa|down_6|NZ_CP040747.1_784496_785054_+	COG1695, COG1695, Predicted transcriptional regulators [Transcription]	NA|369aa|down_7|NZ_CP040747.1_785158_786265_+	pfam02898, NO_synthase, Nitric oxide synthase, oxygenase domain	NA|142aa|down_8|NZ_CP040747.1_786365_786791_+	NA	NA|91aa|down_9|NZ_CP040747.1_786805_787078_-	PRK14420, PRK14420, acylphosphatase; Provisional
