The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040668	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 chromosome, complete genome	4904134	361373	406407	4904134	terminase,coat,portal,lysis,protease,integrase	Enterobacteria_phage(77.61%)	68	352143:352159	414702:414718
352143:352159	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|361373_362426_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|362708_363812_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|363823_365074_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_000051897.1|365279_366443_-|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000002104.1|366881_367166_-	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_000371199.1|367158_367443_-	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_025617570.1|367442_368087_-	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_071533029.1|368073_368307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000812203.1|368303_368813_-	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_001214777.1|368809_368980_-	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_001111291.1|368990_369284_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001253476.1|369330_369615_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001046968.1|369614_370322_-	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_000156731.1|370451_370640_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000141641.1|370620_370779_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000776963.1|370863_371178_-	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000713613.1|371453_371741_-	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_023139341.1|371774_372209_-	pentapeptide repeat-containing protein	NA	A0A220NQW1	Salmonella_phage	93.9	1.4e-52
WP_000213982.1|372292_372487_-	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_001066179.1|372700_373288_+	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000216178.1|373300_373603_-	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_000834175.1|373966_374170_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_001532928.1|374208_375288_-	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000712403.1|375452_376142_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000182204.1|376252_376468_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|376578_376860_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000539342.1|377042_377864_+	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_001248410.1|377860_379237_+	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_001036030.1|379233_379503_+	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_000736891.1|379576_380014_+	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_000679703.1|380010_380184_+	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000113770.1|380150_380327_+	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_001532927.1|380329_380671_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000950963.1|380663_380840_+	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001108073.1|380832_381444_+	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000036320.1|381440_381665_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_000149882.1|381661_381865_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000219133.1|381845_382025_+	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_001047566.1|382021_382795_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_071533031.1|382907_383141_+	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	87.0	1.1e-21
WP_000286100.1|383225_383429_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_024136257.1|383406_383904_+	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_001687043.1|383900_384368_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_071533034.1|384402_384627_+	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	88.7	3.6e-25
WP_000877028.1|384580_385111_+	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_000808099.1|385333_385576_+	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|385579_385969_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_001687044.1|385968_386373_+	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_000729923.1|386376_386865_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_000417860.1|386842_388342_+|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000774652.1|388341_390519_+|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000433855.1|390532_391444_+	scaffold protein	NA	Q76H22	Enterobacteria_phage	100.0	1.5e-162
WP_001196937.1|391443_392736_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000538670.1|392776_393337_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001166103.1|393320_393821_+	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_001122420.1|393780_395199_+	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_000774917.1|395202_395904_+	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_000627593.1|395903_396359_+	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000964904.1|396361_397051_+	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000246977.1|397061_398498_+	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_001029860.1|398497_400474_+	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_071533035.1|400612_400906_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000532177.1|400926_401175_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_000129933.1|401310_403314_+	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000671496.1|403372_404830_-	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000703639.1|404819_405752_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|405748_406111_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_077942643.1|406227_406407_+	hypothetical protein	NA	M1E3P7	Enterobacteria_phage	92.3	4.3e-13
414702:414718	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 2
NZ_CP040668	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 chromosome, complete genome	4904134	998911	1007643	4904134	transposase,protease	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|998911_1000030_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1000026_1001973_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1002102_1002324_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1002647_1002968_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1002998_1005275_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1005466_1005925_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_119920232.1|1006097_1006373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085983316.1|1006387_1007643_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP040668	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 chromosome, complete genome	4904134	1057627	1156436	4904134	terminase,tRNA,portal,tail,holin,lysis,protease,integrase	Salmonella_phage(43.64%)	100	1060536:1060555	1132324:1132343
WP_001154025.1|1057627_1058431_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1058423_1059746_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1059726_1060431_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_022742649.1|1060430_1064897_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1060536:1060555	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1065241_1067083_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1067342_1067891_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1067918_1068566_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1068627_1069818_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1070002_1071094_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1071700_1073101_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1073301_1073763_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|1073759_1073993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544849.1|1074079_1075294_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000191399.1|1077051_1078254_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1078448_1079741_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1079785_1080034_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1080074_1080314_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1080356_1081514_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_063503113.1|1081476_1084362_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	97.5	0.0e+00
WP_001668146.1|1084488_1084788_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1084809_1084968_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_010989002.1|1084960_1085221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1085270_1085681_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1085800_1086040_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1086005_1086380_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1086464_1087448_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1087450_1088200_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1088210_1088558_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1088554_1088866_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1088943_1089234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1089525_1089759_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1089870_1090092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241019.1|1090776_1090983_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_001096552.1|1090985_1091597_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1091593_1091740_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_022742653.1|1091729_1092527_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	5.2e-151
WP_010989004.1|1092593_1092911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1093084_1093210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1093345_1093795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1094155_1094842_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1095117_1095447_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1095430_1095883_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1095900_1096380_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1096587_1097121_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1097077_1099216_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1099212_1099419_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1099445_1100963_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1100886_1102968_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1103058_1103382_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1103374_1103674_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1103654_1104221_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1104217_1104619_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1104630_1105380_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1105425_1105824_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1105820_1106150_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1106229_1109217_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1109213_1109546_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1109644_1110142_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1110258_1110792_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_022742655.1|1110881_1111577_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.2	6.5e-89
WP_000246065.1|1112221_1112926_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_126834981.1|1114780_1116349_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	63.9	1.2e-127
WP_000178849.1|1116387_1116630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742660.1|1116683_1119122_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	1.7e-91
WP_022742661.1|1119121_1119703_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.5	3.3e-94
WP_001533476.1|1120178_1121147_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1121794_1122421_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1122489_1122789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1122773_1123460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1123730_1123922_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1124348_1126961_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_022742665.1|1127168_1128179_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1128344_1128887_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1128883_1129993_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1130091_1132200_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1132212_1134120_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1132324:1132343	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1134134_1135388_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1135392_1137033_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1137029_1137593_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1137848_1138016_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1138115_1138634_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1138702_1140463_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1140648_1141101_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1141172_1142225_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1142581_1143091_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1143307_1143913_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1143899_1146053_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1146071_1146518_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1146641_1148696_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1148731_1149190_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1149284_1149947_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1150117_1150534_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1150578_1150896_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1150953_1152165_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1152379_1152928_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1152953_1153733_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1153781_1154063_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1154059_1154389_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1154475_1155135_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1155755_1156436_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP040668	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 chromosome, complete genome	4904134	1919845	1996740	4904134	terminase,tail,lysis,transposase,protease,head,integrase	Edwardsiella_phage(16.36%)	104	1952642:1952656	1994580:1994594
WP_000984498.1|1919845_1920727_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|1920920_1922969_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|1922988_1923675_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_000145727.1|1923772_1924357_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|1924398_1925682_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_000551143.1|1925644_1928284_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001542138.1|1928361_1929801_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_000978525.1|1929915_1930155_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457836.1|1930265_1930457_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986176.1|1930475_1931126_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_001134856.1|1931349_1931514_-	membrane protein	NA	NA	NA	NA	NA
WP_000182072.1|1931798_1932521_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_022742706.1|1933204_1933600_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.0	6.0e-15
WP_000030934.1|1933929_1934406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354408.1|1934793_1935213_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001526544.1|1935341_1935536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752421.1|1935582_1935852_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_001617922.1|1936017_1936158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000684835.1|1937621_1937990_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
WP_001531557.1|1938475_1938676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233446.1|1939293_1940208_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|1940340_1940499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|1940508_1941123_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_071590377.1|1941875_1942142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|1942270_1942396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520426.1|1942658_1942775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989029.1|1942965_1943166_+	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000275418.1|1943262_1944144_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1944616_1944805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1944869_1945037_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1945293_1945827_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1945880_1946111_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1946300_1946795_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1946854_1947709_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_022742707.1|1948616_1949759_+	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_022742708.1|1950021_1950921_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_022742709.1|1951416_1952073_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024150649.1|1952073_1952769_-	hypothetical protein	NA	NA	NA	NA	NA
1952642:1952656	attL	GCATTAATGCCAACT	NA	NA	NA	NA
WP_022742711.1|1953151_1953727_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	2.9e-95
WP_022742712.1|1953726_1955178_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	71.2	2.9e-43
WP_022742713.1|1955167_1955770_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
WP_022742714.1|1955771_1957013_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.6	4.5e-101
WP_001191865.1|1957009_1957366_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_022742715.1|1957378_1958056_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	35.5	4.6e-31
WP_000122818.1|1958036_1958906_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000890115.1|1958902_1959205_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_022742716.1|1959204_1959915_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
WP_022742717.1|1959911_1962083_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_000228831.1|1962066_1962249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101348.1|1962290_1962695_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000016414.1|1962694_1963141_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_001748488.1|1963141_1964626_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	4.0e-96
WP_000094504.1|1964606_1965152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748490.1|1965136_1965502_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
WP_022742718.1|1965498_1966083_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
WP_023139348.1|1966076_1966532_-	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	46.0	1.2e-19
WP_001748493.1|1966538_1966886_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
WP_001031915.1|1966889_1967918_-	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_001525451.1|1967917_1968400_-	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
WP_023139349.1|1968401_1969748_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
WP_000552017.1|1969744_1970434_-|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_023139350.1|1970474_1971995_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	7.5e-106
WP_022742723.1|1971994_1973416_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.8e-186
WP_022742724.1|1973381_1974134_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	75.6	5.3e-12
WP_001113128.1|1974204_1974387_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_085983312.1|1974612_1975053_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	84.3	3.5e-56
WP_001208103.1|1975073_1975562_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	2.1e-57
WP_001526513.1|1975539_1975842_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000502119.1|1976008_1976467_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_022742726.1|1976744_1977290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139352.1|1977280_1977487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071590376.1|1977603_1977831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139353.1|1977964_1978894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742728.1|1978880_1979411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139354.1|1979442_1979784_-	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.1e-54
WP_023139355.1|1980123_1980435_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	84.8	6.1e-39
WP_021000145.1|1980431_1980626_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_022742730.1|1980622_1981222_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
WP_024150651.1|1981285_1981591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024150652.1|1981783_1981936_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_023139357.1|1982142_1982415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742732.1|1982411_1982807_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	6.4e-17
WP_000140163.1|1982819_1983281_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
WP_022742734.1|1983273_1984281_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	1.8e-124
WP_001534383.1|1984324_1984819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033911.1|1984805_1985060_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001574209.1|1985158_1985557_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_000783771.1|1985854_1986043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024135672.1|1985987_1986167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103933.1|1986427_1986703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|1986706_1986913_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000799627.1|1986988_1987324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742735.1|1987464_1990155_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
WP_001534364.1|1990147_1990978_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033921.1|1991013_1991334_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_023139358.1|1991326_1991659_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	72.7	8.5e-15
WP_023139359.1|1992269_1992449_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	60.3	7.3e-13
WP_077907869.1|1992739_1992976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001575998.1|1993036_1993315_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_022742740.1|1993289_1994369_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
WP_000722368.1|1994751_1995105_-	YebY family protein	NA	NA	NA	NA	NA
1994580:1994594	attR	AGTTGGCATTAATGC	NA	NA	NA	NA
WP_000979702.1|1995121_1995997_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1995997_1996372_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1996509_1996740_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP040668	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 chromosome, complete genome	4904134	2072190	2150850	4904134	capsid,terminase,portal,tail,holin,transposase,protease,plate,head,integrase	Salmonella_phage(79.71%)	105	2078728:2078743	2152473:2152488
WP_000502119.1|2072190_2072649_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000659236.1|2072829_2074035_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2074113_2075601_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2075857_2077261_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2077275_2077683_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2077682_2078051_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2078122_2079607_+	alpha-amylase	NA	NA	NA	NA	NA
2078728:2078743	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2079646_2080072_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2080257_2081463_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2081459_2081693_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2081957_2082344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2082463_2082778_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2082994_2084677_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2084669_2085665_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2085657_2086365_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2086364_2087735_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2087756_2088200_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2088196_2089414_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2089518_2089986_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2089990_2090995_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2090991_2091405_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2091404_2091782_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2091781_2092519_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2092528_2092798_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2092806_2093601_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2093882_2094506_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2094544_2094793_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2094867_2095095_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2095404_2096220_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2096198_2097911_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2098075_2098321_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2098337_2099249_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2099424_2100345_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2100333_2100804_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2100784_2102215_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2102288_2102984_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2103075_2103375_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2104024_2105221_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2105481_2105670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2105680_2105893_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2106347_2107616_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2107618_2108038_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2108164_2108326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2109519_2109732_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2109728_2110142_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2110189_2110303_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2110377_2110611_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2110724_2111330_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_020899405.1|2111299_2112862_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_001207832.1|2112848_2113436_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|2113438_2114518_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|2114510_2114924_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2114928_2115462_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066630.1|2115461_2116520_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|2116516_2117857_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_000785390.1|2117890_2119819_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_000588854.1|2119903_2120230_-|tail	phage tail assembly protein	tail	A0A192Y6C5	Salmonella_phage	100.0	1.3e-52
WP_000515952.1|2120226_2120583_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007996.1|2120582_2122079_-|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000497740.1|2122068_2122233_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_000779216.1|2122236_2122797_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_001135699.1|2122793_2123306_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000702410.1|2123277_2123682_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2123678_2124002_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601352.1|2124004_2124205_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000257526.1|2124255_2125461_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_001193639.1|2125475_2126126_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_020899404.1|2126103_2127345_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_000605609.1|2127344_2127527_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088175.1|2127538_2129272_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000929171.1|2129268_2129763_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_001135098.1|2129888_2130239_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2130289_2130622_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_097053918.1|2130921_2131200_-	peptidase	NA	Q8SBD8	Shigella_phage	74.4	1.3e-24
WP_001530346.1|2131084_2131477_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2131473_2132088_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2132087_2132369_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2132355_2132742_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2132887_2133145_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2133295_2134048_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_020899400.1|2134061_2135051_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899399.1|2135058_2135919_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_001241579.1|2135935_2136325_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2136321_2137215_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2137214_2137697_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2137698_2138517_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2138513_2138738_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2138734_2139892_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2139888_2140443_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2140471_2140696_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071529734.1|2140634_2140820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020640.1|2140793_2141489_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_001067432.1|2141694_2142033_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_000997191.1|2142759_2143131_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2143188_2144016_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2144152_2144692_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2144762_2145296_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2145297_2145555_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2145565_2146147_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2146150_2146720_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2146744_2146987_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2146988_2147978_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2148269_2149067_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2149438_2149729_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2150376_2150850_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2152473:2152488	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP040668	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 chromosome, complete genome	4904134	2237555	2248061	4904134		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2237555_2238869_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2238895_2239975_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2239979_2240753_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2240749_2241742_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2241747_2242299_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2242299_2243178_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2243225_2244125_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2244124_2245210_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2245586_2246480_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2246657_2248061_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP040668	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 chromosome, complete genome	4904134	2316369	2325540	4904134	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2316369_2318403_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2318643_2319102_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2319273_2319804_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2319860_2320328_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2320374_2321094_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2321090_2322776_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2322998_2323730_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2323789_2323897_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2323877_2324609_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2324592_2325540_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_CP040668	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 chromosome, complete genome	4904134	2344778	2411167	4904134	lysis,tail,holin	Salmonella_phage(25.0%)	59	NA	NA
WP_000989296.1|2344778_2345474_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2345627_2346512_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2346688_2347408_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2347404_2347650_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2347854_2349096_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2349089_2350325_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2350399_2351410_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2351425_2352946_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2353079_2354078_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2354576_2355599_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2355748_2356891_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2356905_2357574_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2357903_2358761_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2358749_2359139_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2359143_2360511_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2360727_2361615_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2361647_2362970_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2363013_2365005_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2365350_2366820_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2367009_2367873_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2367993_2369043_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2369121_2369979_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2370043_2371732_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2371748_2372687_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2372686_2373817_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2374185_2375367_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2375431_2376097_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2376098_2376221_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2376608_2376863_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2377186_2377759_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2377971_2378958_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2378987_2379707_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2380120_2380693_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2381018_2382575_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2382681_2384487_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2384496_2385591_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2385590_2386616_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2386617_2388207_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2388210_2388555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2388945_2390136_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2390163_2390859_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2391010_2392771_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2392895_2393180_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2393288_2393909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2393936_2394944_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2395123_2395351_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2395382_2397143_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2397423_2397927_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2397954_2398245_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2400468_2400912_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2401289_2401817_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2401819_2403061_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2403653_2403983_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2404279_2405611_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2405639_2406008_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2406022_2407012_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2407340_2409707_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2409875_2410079_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2410375_2411167_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP040668	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 chromosome, complete genome	4904134	2750045	2855611	4904134	capsid,terminase,tRNA,portal,tail,holin,lysis,transposase,head,integrase	Salmonella_phage(35.0%)	112	2774590:2774606	2863515:2863531
WP_000940032.1|2750045_2750777_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2750895_2751699_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2751843_2752722_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2752903_2753947_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2753950_2754769_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2754779_2755793_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2755793_2756780_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2756770_2757409_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2757534_2758812_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2758806_2759946_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2760141_2761395_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2761719_2762910_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2763091_2764636_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2764996_2766328_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2766410_2768555_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2768610_2770071_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2770119_2770458_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2770534_2771872_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2771868_2772633_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2772634_2774065_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2774590:2774606	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2774714_2778602_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2778623_2778857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2778857_2780402_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2780452_2781004_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2781028_2781664_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2781667_2783029_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2783039_2783933_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2784048_2784897_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2784935_2785853_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2785874_2787071_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2787186_2788113_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2788150_2788411_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2788522_2788903_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2788902_2789634_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2789645_2790374_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2790385_2791291_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2791287_2791968_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2792241_2793216_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2793232_2795032_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2795436_2796930_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2797414_2797552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2798264_2798429_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2799008_2799074_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2799136_2799349_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2799455_2799683_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2799779_2800358_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2800347_2801172_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_022742779.1|2801168_2803541_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	65.4	2.0e-89
WP_000178853.1|2803594_2803837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2803875_2807238_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2807299_2807947_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2807844_2808582_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2808588_2809287_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2809296_2809626_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_022742781.1|2809628_2812724_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.1e-276
WP_010989052.1|2812695_2813034_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2813030_2813426_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971953.1|2813476_2814223_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_022742782.1|2814230_2814632_-	hypothetical protein	NA	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
WP_000677089.1|2814628_2815207_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|2815193_2815571_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201485.1|2815581_2815947_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_022742784.1|2816004_2817033_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.3e-114
WP_000011260.1|2817087_2817435_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189498.1|2817447_2818944_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
WP_000831821.1|2818933_2820514_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2820510_2820714_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623088.1|2820697_2822629_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_001102153.1|2822600_2823146_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669689.1|2823431_2823833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603581.1|2824089_2824593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050955063.1|2824920_2825367_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	9.3e-57
WP_022742788.1|2825399_2826014_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.6	2.2e-109
WP_021000643.1|2826013_2826295_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294873.1|2826281_2826671_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_023221874.1|2826760_2826949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071786602.1|2827003_2827195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024150660.1|2827475_2827901_-	subtilase	NA	NA	NA	NA	NA
WP_022742790.1|2828033_2828759_-	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	66.2	4.0e-81
WP_022742791.1|2828959_2829538_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.1e-49
WP_050196634.1|2829552_2830542_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	3.5e-189
WP_024150661.1|2830549_2831410_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.3	9.2e-162
WP_000767086.1|2831426_2831816_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_024150662.1|2832704_2833187_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	1.8e-85
WP_022742797.1|2833188_2834148_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.2e-117
WP_000620702.1|2834144_2834369_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_031609052.1|2834365_2835508_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	98.2	1.0e-208
WP_023139406.1|2835504_2836059_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	1.2e-101
WP_001191666.1|2836087_2836312_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071529734.1|2836250_2836436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020640.1|2836409_2837105_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000917563.1|2837458_2837617_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_022742800.1|2837638_2837989_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_138858464.1|2838115_2841043_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	98.8	0.0e+00
WP_022742802.1|2841005_2842163_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	4.7e-217
WP_001237031.1|2842205_2842445_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2842485_2842770_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_022742803.1|2842747_2843977_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	93.9	5.4e-232
WP_000589087.1|2844474_2844954_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2844950_2845907_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2845906_2846557_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2846588_2847164_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2847160_2847325_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001521719.1|2847324_2847504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742804.1|2847588_2849211_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2849195_2849933_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2850063_2851398_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2851415_2852315_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2852417_2853005_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2853066_2853450_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2853768_2854458_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2854573_2855611_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2863515:2863531	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 10
NZ_CP040668	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 chromosome, complete genome	4904134	4465002	4485421	4904134	plate,tail	Burkholderia_phage(47.37%)	25	NA	NA
WP_000587738.1|4465002_4465731_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4465927_4466218_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4466466_4466922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4466918_4467524_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4467528_4469274_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4469276_4469909_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4469901_4471017_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4471007_4471367_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4471530_4473078_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4473077_4474007_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4474003_4474366_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4474693_4475416_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4475425_4476469_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4476456_4476666_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_001262499.1|4477617_4479972_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4480068_4480197_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4480156_4480474_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4480525_4481050_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4481049_4482477_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4482466_4482664_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4482660_4483116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4483275_4483590_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4483602_4484208_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4484210_4484498_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4485073_4485421_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP040669	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 plasmid pSA20082869.1, complete sequence	107560	17982	57603	107560	transposase,protease,integrase,tRNA	Escherichia_phage(44.44%)	43	50136:50152	63017:63033
WP_000911322.1|17982_18381_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_001526804.1|18380_18611_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_001067845.1|23842_24547_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_000616800.1|24950_25604_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|25696_25954_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000439434.1|25955_26288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262766.1|26572_28345_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000429836.1|29037_29472_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|29543_29894_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|29907_30183_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|30218_30641_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|30692_32387_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|32404_32767_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_138858472.1|32763_33000_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|32996_33704_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|33742_35047_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|35093_35798_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001240331.1|35862_36423_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.7	1.3e-31
WP_000098783.1|36406_38071_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_001576625.1|38003_39029_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001121399.1|39217_40255_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000346691.1|40863_41757_+	virulence genes transcriptional activator SpvR	NA	NA	NA	NA	NA
WP_001576629.1|41930_42095_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
WP_001526990.1|42268_43036_+	virulence protein SpvA	NA	NA	NA	NA	NA
WP_001676648.1|43217_44993_+	SPI-2 type III secretion system effector NAD(+)--protein-arginine ADP-ribosyltransferase SpvB	NA	NA	NA	NA	NA
WP_001122242.1|45273_45999_+	type III secretion system effector phosphothreonine lyase SpvC	NA	NA	NA	NA	NA
WP_001575489.1|46259_46910_+	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
WP_001541541.1|47517_47868_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
WP_000900095.1|47934_48495_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000905606.1|49214_49700_-	membrane protein	NA	NA	NA	NA	NA
WP_001541544.1|49693_50203_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
50136:50152	attL	TTGCTCTGCCTGCCGGC	NA	NA	NA	NA
WP_138858473.1|50206_50374_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000545754.1|50367_50919_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000082169.1|50927_51710_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_000198608.1|51744_52266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001266176.1|52262_52553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159863.1|52554_52860_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813641.1|52861_53080_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_010999942.1|53755_54277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001687482.1|54760_55057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527061.1|55550_56540_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.6	1.2e-101
WP_136571548.1|56590_56908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|56898_57603_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
63017:63033	attR	TTGCTCTGCCTGCCGGC	NA	NA	NA	NA
>prophage 2
NZ_CP040669	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 plasmid pSA20082869.1, complete sequence	107560	79783	89079	107560	transposase	Escherichia_phage(28.57%)	12	NA	NA
WP_001541564.1|79783_80200_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|80383_80719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|80775_81342_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|81373_82315_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|82729_83935_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_001541561.1|83931_84909_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_022743179.1|84990_86265_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.9	3.9e-156
WP_000925627.1|86264_86687_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|87197_87668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|87660_88017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091632.1|88065_88254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|88398_89079_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
