The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040663	Escherichia coli strain EK2009 chromosome, complete genome	4605015	270601	320875	4605015	holin,integrase,transposase	Acinetobacter_phage(22.22%)	42	277724:277740	329153:329169
WP_001254938.1|270601_271753_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|274099_275116_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|275323_276727_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|276713_277646_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
277724:277740	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000192349.1|277754_278801_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000388269.1|280877_281609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|281699_282326_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|282597_283296_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|283322_284177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|284295_284520_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|284516_284957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|285073_286474_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|286758_287169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121359.1|287147_288104_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|288113_290312_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|290308_291265_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070700.1|291261_291951_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|292368_292983_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|293230_293560_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001310578.1|294552_296196_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|296185_298711_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716398.1|298736_299405_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|299462_300050_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|300124_300667_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|301490_301718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|301752_301893_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|301892_302156_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|302519_302621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020224.1|303735_304623_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_085947771.1|304669_305831_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001299021.1|307104_307698_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|307709_307946_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046307.1|308054_309380_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000339594.1|309605_310460_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001102108.1|310986_311706_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023927.1|311716_313144_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370307.1|313136_313832_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209100.1|314074_314743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159094.1|314955_316626_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|316639_318112_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|318125_318713_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|318841_320875_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
329153:329169	attR	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 2
NZ_CP040663	Escherichia coli strain EK2009 chromosome, complete genome	4605015	508361	571299	4605015	protease,transposase,tRNA,terminase,integrase,lysis	Enterobacteria_phage(46.43%)	64	553966:554012	575259:575305
WP_001295836.1|508361_508985_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|508955_509642_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|509638_512053_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_138795913.1|512483_516794_+	DUF4329 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|516790_517159_+	immunity protein	NA	NA	NA	NA	NA
WP_001157938.1|519342_520437_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|520505_521432_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|521661_522144_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|522221_523037_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|523126_524908_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|524920_525697_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|525796_526675_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|526843_528298_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|528357_529719_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|529775_531077_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|531098_532244_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|532471_533257_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|533267_534503_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|534524_535574_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|535890_537558_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|537567_538827_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|538837_539653_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|539649_540543_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|540737_541805_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|541801_542311_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|542428_543151_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|543153_543648_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|543821_545207_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|545242_545764_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|545871_546084_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|546085_546952_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|547422_547965_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|548184_548877_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|548907_551511_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|551489_552530_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|552540_553056_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|553058_553691_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
553966:554012	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|554025_555189_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_088238778.1|555308_555572_-	hypothetical protein	NA	A0A0N6WET1	Escherichia_phage	98.9	6.3e-45
WP_000145909.1|555894_555990_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|556052_557214_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|557525_557858_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|557905_558055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|558112_559639_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|560103_560655_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|560664_561462_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|561578_561680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|561676_562132_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|562131_562302_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|562294_562585_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|562581_562944_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|562940_563081_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|563166_563550_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|563947_564964_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_138795914.1|564924_566028_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.8	6.1e-150
WP_000839596.1|566600_566816_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|566815_567313_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|567529_567712_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738501.1|567802_568096_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	99.0	2.0e-47
WP_012775990.1|568385_568796_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_001031427.1|569081_569288_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|569452_569647_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|570035_570581_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|570555_571299_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
575259:575305	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP040663	Escherichia coli strain EK2009 chromosome, complete genome	4605015	1181841	1203234	4605015	tail,tRNA,integrase,portal,plate	Shigella_phage(25.0%)	32	1173836:1173850	1209937:1209951
1173836:1173850	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1181841_1182948_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1183001_1183463_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1183472_1184126_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1184297_1185548_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1186041_1186707_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1186707_1187412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1187869_1188763_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1188853_1189981_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1189961_1190207_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1190243_1190555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1190671_1191013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1190950_1191259_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1191433_1192108_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1192198_1192399_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1192442_1193000_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1193175_1193355_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1193344_1194712_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1194723_1194906_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1194905_1195379_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1195305_1196097_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1196087_1196672_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|1196675_1197305_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_010723096.1|1197306_1197720_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|1197691_1198294_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|1198293_1198788_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1198859_1199414_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1199520_1200354_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000943927.1|1200587_1200752_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1200854_1201178_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1201714_1201825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1201877_1202282_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1202502_1203234_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1209937:1209951	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP040663	Escherichia coli strain EK2009 chromosome, complete genome	4605015	1395480	1459426	4605015	tail,transposase,tRNA,integrase,lysis	Escherichia_phage(39.39%)	63	1386140:1386158	1416514:1416532
1386140:1386158	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000628058.1|1395480_1396713_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1396967_1397951_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1398427_1399801_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1399929_1400865_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1400916_1402152_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1402153_1402369_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1402447_1402657_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1402649_1402844_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1402900_1403710_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1403702_1406303_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1406404_1406680_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1406754_1406925_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1406924_1407146_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1407587_1408076_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1408072_1408228_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|1408238_1408373_-	phage protein	NA	NA	NA	NA	NA
WP_000948459.1|1408681_1409158_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1409281_1409578_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1409600_1410023_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1410035_1410893_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1410899_1411646_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1411668_1412229_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1412316_1412502_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1412698_1414156_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1414293_1414557_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1414537_1414897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|1415004_1415205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1416662_1417643_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1416514:1416532	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_089418980.1|1417685_1417901_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
WP_138795930.1|1417965_1421328_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	2.1e-12
WP_001698950.1|1421327_1421903_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1422000_1422591_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1422907_1423141_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1423209_1423323_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1424101_1424536_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_138795931.1|1424676_1425810_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	5.4e-117
WP_000628244.1|1426176_1429701_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1429974_1430241_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|1430237_1430660_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|1430770_1431760_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_000900941.1|1431967_1434607_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|1434603_1434789_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|1434796_1435123_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|1435294_1436200_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|1436435_1437935_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|1437992_1440266_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|1440513_1442559_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|1442843_1443773_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|1443784_1444072_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|1444080_1444827_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|1444841_1445339_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|1445346_1446417_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|1446413_1447181_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|1447180_1447969_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|1447970_1449398_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|1449387_1449810_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|1449809_1451015_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|1451041_1452355_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|1452455_1453406_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|1453387_1453978_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|1454081_1454147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|1456837_1458111_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001254932.1|1458274_1459426_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 5
NZ_CP040663	Escherichia coli strain EK2009 chromosome, complete genome	4605015	1618369	1637580	4605015	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1618369_1619830_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1619918_1621202_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1621806_1621920_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1621988_1622222_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1622538_1623129_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1623226_1623802_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1623801_1624764_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1624714_1625284_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1625672_1625906_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1625963_1626374_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1626525_1626699_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1626870_1627026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1627104_1627170_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1627172_1627361_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1627371_1627584_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1627946_1628444_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1628440_1628974_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1628970_1629282_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1629286_1629502_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1630255_1630471_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1630771_1630984_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1631038_1631128_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1631405_1632158_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1632171_1633221_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1633222_1633501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1633567_1633819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1634035_1634191_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1634262_1634550_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1634549_1634789_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1634813_1635119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1635321_1635654_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1636090_1636240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1636536_1636767_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1636850_1637258_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1637424_1637580_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 6
NZ_CP040663	Escherichia coli strain EK2009 chromosome, complete genome	4605015	2178509	2187950	4605015		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|2178509_2179646_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001375261.1|2179642_2181643_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2181767_2182229_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2182268_2182739_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2182785_2183505_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2183501_2185187_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2185408_2186140_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2186199_2186307_+	protein YohO	NA	NA	NA	NA	NA
WP_000783123.1|2186287_2187019_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569315.1|2187023_2187950_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 7
NZ_CP040663	Escherichia coli strain EK2009 chromosome, complete genome	4605015	2435844	2447054	4605015	tail,integrase	Enterobacteria_phage(50.0%)	17	2433819:2433835	2450729:2450745
2433819:2433835	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2435844_2436777_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2437088_2438246_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2438398_2438761_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2438757_2439678_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2439674_2441006_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2441040_2441322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2441620_2442061_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2442087_2442606_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2442655_2442931_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2442930_2443425_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2443421_2443790_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2444147_2444510_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2444575_2445400_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2445527_2446064_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2446054_2446417_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2446416_2446722_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2446853_2447054_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2450729:2450745	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
NZ_CP040663	Escherichia coli strain EK2009 chromosome, complete genome	4605015	2820805	2827944	4605015		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2820805_2823367_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2823472_2824129_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2824179_2824947_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2825142_2826051_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2826047_2827214_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2827305_2827944_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
