The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	146038	155581	2702943		unidentified_phage(16.67%)	10	NA	NA
WP_002348948.1|146038_147427_-	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.0	7.0e-10
WP_071974475.1|147794_147983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297115.1|147995_148373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|148628_149357_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|149356_149611_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|149612_150284_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|150284_152507_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|152491_153931_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002378443.1|153962_155006_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|155002_155581_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 2
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	466066	488668	2702943	protease,integrase,transposase	Streptococcus_phage(25.0%)	24	462525:462542	498563:498580
462525:462542	attL	ACAACATTTTCTTATTTT	NA	NA	NA	NA
WP_002378019.1|466066_466906_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|467090_467978_+	rotamase	NA	NA	NA	NA	NA
WP_002311093.1|468571_469267_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|469250_469649_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|470057_471308_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296760.1|471449_472445_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|472462_473017_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289422.1|473004_473496_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002378335.1|473488_475357_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|475375_476176_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002289418.1|476399_476615_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|476753_477239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|477694_478108_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002322258.1|478244_478505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303865.1|478432_478672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321532.1|478622_478913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|479158_480337_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|480492_481446_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002288357.1|481502_482630_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_002288355.1|482723_484559_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	3.4e-20
WP_002288353.1|484705_485926_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288352.1|485945_486440_+	nucleoside deoxyribosyltransferase	NA	A0A1W6JK28	Lactococcus_phage	56.5	7.2e-42
WP_002288350.1|486432_487104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|487372_488668_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
498563:498580	attR	ACAACATTTTCTTATTTT	NA	NA	NA	NA
>prophage 3
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	613961	736106	2702943	protease,tRNA,transposase	Streptococcus_phage(20.0%)	118	NA	NA
WP_002288520.1|613961_614885_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002294143.1|618062_618284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294142.1|618391_618739_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002294141.1|618765_621072_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288509.1|621084_621396_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288501.1|621392_621686_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002301262.1|621707_622883_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288499.1|622906_623380_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002294138.1|623523_627876_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	41.4	3.9e-22
WP_002294137.1|628087_629797_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|629864_631133_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|631293_632094_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|632090_632903_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002287107.1|633311_634562_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002293875.1|634880_635438_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|635440_636163_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|636298_637180_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|637278_638061_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|638419_638899_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|639115_640207_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002288432.1|641329_643021_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|643440_644388_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|644502_645522_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|645612_646842_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|647302_648004_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326809.1|648175_649471_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002301319.1|650134_651151_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|651147_651612_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002348676.1|651618_652161_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|652144_652969_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|653057_654038_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|654061_655546_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|655557_656547_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|656794_656962_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288458.1|657023_658835_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|658831_659197_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|659359_659755_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|659772_660735_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|660734_660947_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|660967_661666_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|661685_662228_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|662359_663364_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|663360_664350_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|664346_665153_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293906.1|665318_666275_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|666351_666870_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|666957_667107_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|667334_667781_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002288533.1|667975_669871_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|670195_671170_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_002296332.1|671735_672302_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002348678.1|672557_673889_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|673854_674205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296337.1|674716_675061_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|675326_676286_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287776.1|676475_677072_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|677195_678995_+	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297218.1|679209_680505_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002297633.1|680794_681007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|681870_682830_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002326704.1|683042_683951_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002288573.1|683999_684386_+	YxeA family protein	NA	NA	NA	NA	NA
WP_002288574.1|684693_686040_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|686151_687501_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288576.1|687617_688871_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288577.1|688941_689427_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288579.1|689449_690208_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|690223_691402_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|691631_693752_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_099119703.1|693687_693963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296838.1|693974_694700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|694689_695199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|695268_696717_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|696716_697433_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|697413_697764_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|697907_698681_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002302293.1|699437_699740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|700178_701357_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|701693_701933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|702294_702555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|702739_703237_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|703366_704077_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|704089_705754_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|705958_706621_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|706630_707446_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|707707_708151_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|708284_708623_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302962.1|708610_708988_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322902.1|709211_710405_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|710570_710993_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002303955.1|711581_712037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293154.1|712004_712202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|712198_713371_-	class C sortase	NA	NA	NA	NA	NA
WP_002288981.1|713576_714392_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002303960.1|715002_716016_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002303962.1|716046_716505_-	cell wall anchor	NA	NA	NA	NA	NA
WP_002303963.1|716501_718829_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002296840.1|719100_720288_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288972.1|720944_721058_+|protease	CAAX amino protease	protease	NA	NA	NA	NA
WP_002288970.1|721145_721439_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002311684.1|721475_721661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286913.1|721696_722044_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293717.1|722179_722941_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|722930_723452_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|723621_724413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|724537_724789_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|724800_725076_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|725328_725883_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|725961_726483_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|726486_727065_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|727176_728595_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|728615_728954_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|728913_729417_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|729547_730252_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002303966.1|730248_731985_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002297196.1|732087_734559_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_099745856.1|734563_734746_-	RNA helicase	NA	NA	NA	NA	NA
WP_002326707.1|734831_736106_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
>prophage 4
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	739684	796517	2702943	transposase,tRNA,integrase	Streptococcus_phage(21.05%)	48	732572:732587	796874:796889
732572:732587	attL	AAGAAAGATGGAAGTC	NA	NA	NA	NA
WP_010782561.1|739684_740644_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002301623.1|740766_741741_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	7.1e-25
WP_002297404.1|742150_743401_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|743686_743944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266934.1|744175_744589_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002326711.1|744845_746024_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002295743.1|746184_747094_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_099098442.1|747395_748558_-|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_099745852.1|748662_750001_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	3.4e-78
WP_002301695.1|750041_750734_-	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	43.4	4.0e-30
WP_002296536.1|750728_750995_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	56.5	1.4e-07
WP_002294835.1|751170_751740_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002304701.1|751813_752137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294839.1|752290_753103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304700.1|753456_754305_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002304699.1|754449_755391_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002299539.1|759185_761357_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002312937.1|761376_763563_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	5.3e-121
WP_002289040.1|763562_763772_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002294855.1|763784_764225_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002304690.1|764298_764838_-	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002288779.1|765452_766919_-	amino acid permease	NA	NA	NA	NA	NA
WP_002304688.1|767229_769311_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.6	2.4e-115
WP_002288776.1|769834_770194_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002326717.1|770223_770565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304684.1|770561_771236_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288767.1|772288_773587_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002304682.1|773626_774817_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002348809.1|774837_775365_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002304681.1|775411_778201_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
WP_002288762.1|778347_778548_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002323868.1|778999_779320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|779597_780893_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288760.1|781344_782463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304680.1|782933_784241_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002297218.1|784324_785620_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002340453.1|785881_787081_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002289547.1|787107_788376_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	2.2e-42
WP_002306245.1|789256_789460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002291751.1|789592_790096_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002294889.1|790218_790983_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002297293.1|791303_792491_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002289551.1|792710_792986_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002348852.1|793053_793245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312285.1|793423_794374_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002312284.1|794552_794753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348851.1|794753_794936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010782560.1|795557_796517_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
796874:796889	attR	GACTTCCATCTTTCTT	NA	NA	NA	NA
>prophage 5
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	1066814	1123596	2702943	transposase,tRNA,bacteriocin	Bacillus_phage(17.65%)	50	NA	NA
WP_002301399.1|1066814_1067774_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287122.1|1068144_1069026_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.3	1.3e-73
WP_002287121.1|1069068_1070088_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002287119.1|1070720_1071725_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002287118.1|1071737_1072787_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002287116.1|1072803_1073625_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002287115.1|1073611_1074391_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002287114.1|1074407_1074878_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287112.1|1074889_1075309_-	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002302892.1|1075389_1078158_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002294014.1|1078357_1078582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294013.1|1079360_1081076_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	1.7e-50
WP_002289511.1|1081078_1082842_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	1.5e-44
WP_002326809.1|1083021_1084317_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289509.1|1084403_1084940_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002289508.1|1085262_1085685_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002289507.1|1085893_1087003_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	33.0	1.2e-20
WP_002294011.1|1087126_1087756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294004.1|1088206_1089091_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002305490.1|1089083_1089653_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_002294001.1|1089645_1090422_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_002294000.1|1090576_1091899_-	amino acid permease	NA	NA	NA	NA	NA
WP_002293998.1|1092073_1092661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296623.1|1093225_1094521_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002289325.1|1094650_1096660_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.3	1.4e-96
WP_002289337.1|1096927_1097206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289327.1|1097302_1098124_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	32.8	2.7e-25
WP_080441679.1|1098128_1098347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1098414_1099710_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289328.1|1099930_1100941_-	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	40.8	2.8e-56
WP_002289330.1|1100952_1101906_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.2	3.0e-20
WP_002289332.1|1101895_1102966_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.5e-20
WP_002289334.1|1102971_1104015_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002293573.1|1104015_1104957_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002293992.1|1105040_1105388_+	DUF3899 domain-containing protein	NA	NA	NA	NA	NA
WP_002289796.1|1105457_1107119_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293990.1|1107297_1107417_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_002289795.1|1107664_1108213_-	aminoglycoside N-acetyltransferase AAC(6')-Ii	NA	NA	NA	NA	NA
WP_002303623.1|1108765_1109869_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002297218.1|1109959_1111255_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002377896.1|1111381_1111594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293986.1|1111583_1112651_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002289244.1|1112880_1115328_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	50.7	8.1e-86
WP_002289243.1|1115516_1116953_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.4	1.4e-48
WP_002289242.1|1117271_1118087_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002289241.1|1118104_1118740_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	8.4e-27
WP_002289240.1|1118758_1119400_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002289239.1|1119879_1120365_+|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002321669.1|1120636_1122772_-	collagen-binding MSCRAMM adhesin Acm	NA	NA	NA	NA	NA
WP_002289237.1|1123296_1123596_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 6
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	1189352	1222784	2702943	protease,transposase,bacteriocin	uncultured_virus(16.67%)	32	NA	NA
WP_000997695.1|1189352_1190531_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002288864.1|1190931_1192557_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	2.2e-156
WP_002288862.1|1192607_1192892_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	40.2	2.0e-12
WP_002288860.1|1193116_1193779_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002288858.1|1193854_1195147_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288856.1|1195316_1195946_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002288854.1|1196048_1196858_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002288853.1|1196912_1197782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288852.1|1197782_1199099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288851.1|1199095_1200931_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	4.0e-37
WP_002288850.1|1200935_1201640_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002288847.1|1201829_1202690_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	2.7e-12
WP_002322652.1|1202676_1203246_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002286097.1|1203875_1204829_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002321654.1|1204825_1204972_-|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_002287810.1|1205075_1205387_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002304799.1|1205388_1205586_-	enterocin	NA	NA	NA	NA	NA
WP_002287807.1|1205979_1207707_-	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_002287805.1|1207699_1208893_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-29
WP_002287801.1|1209080_1209725_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002304795.1|1209672_1209864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290587.1|1209818_1209953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287799.1|1209954_1212087_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_002287797.1|1212083_1212557_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002287795.1|1212957_1213182_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.7	1.7e-11
WP_002287793.1|1213340_1215500_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.2	3.8e-265
WP_002287792.1|1215549_1216515_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.4	3.4e-128
WP_002287791.1|1216603_1217743_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002287788.1|1218051_1218765_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.7	6.5e-20
WP_002287787.1|1219018_1219720_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002290558.1|1219953_1221486_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.3e-45
WP_002295743.1|1221875_1222784_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	1376959	1408738	2702943	transposase,tRNA,holin	Bacillus_phage(33.33%)	23	NA	NA
WP_002285932.1|1376959_1377139_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002321622.1|1377132_1377345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104674935.1|1377332_1377503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099704171.1|1377926_1378667_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002285924.1|1379092_1382164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002285920.1|1384931_1386653_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.7e-37
WP_002285918.1|1386667_1388452_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.7e-46
WP_002285917.1|1388832_1390386_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285916.1|1390733_1393148_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002301403.1|1393574_1395593_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|1395962_1396619_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|1396618_1397575_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|1397574_1398141_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_002378238.1|1398576_1398807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|1398999_1400187_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_025479400.1|1400283_1400586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303477.1|1401360_1402380_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002301818.1|1402390_1402597_-|holin	holin	holin	NA	NA	NA	NA
WP_002301399.1|1402729_1403689_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002304713.1|1403891_1404824_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	53.8	1.8e-57
WP_002341521.1|1404895_1405252_+	hypothetical protein	NA	U4KJ82	Streptococcus_phage	42.2	9.2e-15
WP_000997695.1|1405349_1406528_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|1407398_1408738_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
>prophage 8
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	1542843	1555958	2702943		Streptococcus_phage(83.33%)	17	NA	NA
WP_002297366.1|1542843_1543158_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|1543170_1543545_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002311649.1|1543545_1543890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343904.1|1543972_1545118_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	62.8	6.0e-132
WP_002348644.1|1545483_1545714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297361.1|1545832_1547692_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_002297360.1|1547785_1548025_+	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	80.3	2.1e-23
WP_002297358.1|1548102_1548777_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002321810.1|1549009_1549444_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|1549444_1550152_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|1550141_1550432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|1550690_1551875_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|1551871_1552009_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|1552754_1554665_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|1554768_1554993_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|1555005_1555509_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|1555568_1555958_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
>prophage 9
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	1583136	1606703	2702943	transposase,integrase	Bacillus_phage(50.0%)	28	1600065:1600080	1610310:1610325
WP_002297332.1|1583136_1583331_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_138816292.1|1583369_1583516_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_077828743.1|1583522_1583678_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002304821.1|1585329_1585572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297326.1|1585534_1587151_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_002317220.1|1587268_1587487_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106913778.1|1587618_1588143_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	8.8e-14
WP_002304820.1|1588335_1588575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297324.1|1588598_1590122_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002322279.1|1590139_1590262_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002304819.1|1590291_1591275_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002297320.1|1591298_1591448_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002297319.1|1591468_1591846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297318.1|1591877_1592057_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297316.1|1592071_1592341_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002297310.1|1592863_1594606_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-30
WP_002297309.1|1594589_1596344_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002297308.1|1596453_1597023_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002311663.1|1597040_1598465_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.9e-20
WP_002297304.1|1598466_1599135_-	cobalt transporter	NA	NA	NA	NA	NA
WP_071858995.1|1599265_1599850_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
1600065:1600080	attL	ACCTTTTCTAAAATAA	NA	NA	NA	NA
WP_002297302.1|1600180_1600414_-	iron-dependent repressor	NA	NA	NA	NA	NA
WP_002297295.1|1600428_1601379_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297294.1|1601375_1602218_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002297293.1|1602539_1603727_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002297292.1|1603818_1604559_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	5.7e-19
WP_002320809.1|1605246_1605405_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297291.1|1605476_1606703_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1610310:1610325	attR	TTATTTTAGAAAAGGT	NA	NA	NA	NA
>prophage 10
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	1828064	1887211	2702943	transposase,tRNA	Bacillus_phage(18.75%)	60	NA	NA
WP_002287909.1|1828064_1828361_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	NA	NA	NA	NA
WP_002287910.1|1828716_1829073_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002348747.1|1829082_1829982_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_010782507.1|1830214_1831174_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002331051.1|1831431_1832877_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	7.5e-124
WP_002348590.1|1832922_1833657_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_002301190.1|1833982_1834393_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002294273.1|1834385_1835087_+	LrgB family protein	NA	NA	NA	NA	NA
WP_002348592.1|1835086_1836700_+	M protein trans-acting positive regulator	NA	NA	NA	NA	NA
WP_002290506.1|1836689_1836911_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	33.3	1.1e-05
WP_002297929.1|1836907_1837669_+	3-oxoacyl-ACP reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.7	1.2e-16
WP_002294268.1|1838049_1838559_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	31.8	7.5e-10
WP_002294267.1|1838628_1839168_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002294265.1|1839307_1839919_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002324284.1|1840234_1841032_+	formate/nitrite transporter	NA	NA	NA	NA	NA
WP_002294262.1|1841059_1841695_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002294261.1|1841714_1842488_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002297924.1|1842484_1842643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348595.1|1842895_1843693_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_002297923.1|1843670_1844084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294258.1|1844067_1846713_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.1	3.6e-39
WP_002301736.1|1846730_1848839_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	1.8e-57
WP_002348596.1|1848860_1849421_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002285758.1|1849592_1849787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|1849776_1850130_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|1850231_1851779_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002348864.1|1851858_1853847_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_002294254.1|1854069_1854783_+	trehalose operon repressor	NA	A0A291LID1	Streptomyces_phage	39.7	1.2e-05
WP_002294252.1|1854859_1855306_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002290528.1|1855475_1856078_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002289812.1|1856090_1857092_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.8	2.3e-07
WP_002341570.1|1857120_1857699_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002294249.1|1857750_1858233_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002289815.1|1858349_1858724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294246.1|1859523_1860876_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002297079.1|1861022_1861613_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_002294242.1|1861740_1863090_-	amino acid permease	NA	NA	NA	NA	NA
WP_002294240.1|1863257_1863998_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	5.5e-30
WP_002297081.1|1864010_1865603_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002325201.1|1865641_1865833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293448.1|1866170_1866467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294236.1|1866642_1867368_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_002301156.1|1867360_1868203_+	chorismate mutase	NA	NA	NA	NA	NA
WP_002294232.1|1868205_1868727_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002304058.1|1868765_1868975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289284.1|1868979_1869543_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	2.3e-12
WP_002289282.1|1869793_1870063_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_002297086.1|1870250_1872377_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002289280.1|1872762_1873029_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002289279.1|1873172_1875164_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.9	8.4e-65
WP_002294228.1|1875517_1876819_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002326809.1|1877194_1878490_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_010782510.1|1878557_1879736_-|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	39.9	3.8e-65
WP_002289277.1|1880082_1881453_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002289744.1|1881634_1881958_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002299254.1|1882282_1882891_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_002348768.1|1883220_1883937_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_002289749.1|1883949_1884645_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_002289751.1|1884728_1885358_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.2	3.1e-34
WP_086953915.1|1885872_1887211_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
>prophage 11
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	1900859	1937656	2702943	transposase,tRNA,holin	Lysinibacillus_phage(22.22%)	26	NA	NA
WP_002326809.1|1900859_1902155_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002301399.1|1902421_1903381_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002294203.1|1903606_1906312_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_002317078.1|1906500_1906722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294202.1|1906908_1908732_+	APC family permease	NA	NA	NA	NA	NA
WP_002348885.1|1908873_1909059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294199.1|1909533_1909797_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002301121.1|1909796_1910063_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002301116.1|1911293_1911965_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002301114.1|1911961_1912879_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293405.1|1912875_1913517_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002348889.1|1913520_1914696_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	32.9	1.0e-17
WP_002352545.1|1914888_1915920_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002341590.1|1917596_1918550_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002319878.1|1918640_1919936_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
WP_002326809.1|1920097_1921393_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289743.1|1922102_1924742_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.2	1.6e-84
WP_002294185.1|1924909_1925608_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002341590.1|1925710_1926664_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294183.1|1926892_1928038_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.5e-82
WP_002300794.1|1928134_1928515_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_076005167.1|1928611_1928791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010782512.1|1928819_1931417_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010782513.1|1931324_1932935_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	8.4e-124
WP_002300788.1|1935212_1935692_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_086953915.1|1936317_1937656_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
>prophage 12
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	1963847	1974026	2702943		Streptococcus_phage(77.78%)	11	NA	NA
WP_002290101.1|1963847_1965137_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	5.7e-22
WP_002345011.1|1965564_1966044_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_001825268.1|1966254_1966374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420682.1|1966396_1966711_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_000985015.1|1966726_1967113_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000813488.1|1967141_1968527_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000398284.1|1968705_1969911_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_002286940.1|1970694_1972605_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_032509114.1|1972708_1972933_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	97.1	8.5e-27
WP_002345010.1|1973049_1973547_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	97.6	1.3e-88
WP_002345009.1|1973633_1974026_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	99.2	4.6e-68
>prophage 13
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	2398766	2407238	2702943		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|2398766_2399411_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002378197.1|2399425_2399755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|2399768_2400707_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|2400742_2401567_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|2401559_2401907_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|2401975_2402848_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|2402956_2404078_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|2404131_2404734_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|2405048_2407238_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 14
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	2460248	2535695	2702943	head,transposase,protease,portal,holin,integrase,tRNA,terminase,capsid,tail	Enterococcus_phage(25.64%)	91	2515832:2515847	2519185:2519200
WP_002286621.1|2460248_2463047_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|2463095_2464622_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|2464636_2465284_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|2465467_2465797_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|2465973_2466702_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|2466717_2467731_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|2467730_2469008_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|2469070_2471773_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|2471924_2472242_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|2472271_2472592_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|2472699_2474160_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|2474227_2474449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|2474479_2474662_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|2474661_2475075_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|2475197_2476379_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286587.1|2476909_2478049_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|2478347_2478983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|2479095_2479731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|2479764_2480226_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002348715.1|2480355_2480787_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|2480804_2481125_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|2481423_2482200_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|2482214_2482418_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|2482433_2482772_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|2482758_2482938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|2482980_2483451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|2483537_2484236_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|2484413_2484755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|2484747_2485419_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|2485424_2486111_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|2486113_2486863_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286696.1|2486874_2487144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|2487305_2487608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|2487604_2487766_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|2487762_2488068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|2488067_2488424_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002296604.1|2488383_2488629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|2488625_2489045_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|2489041_2489599_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|2489595_2489892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|2489968_2490382_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002300143.1|2490839_2491115_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|2491568_2491775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|2491970_2492138_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|2492163_2492508_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|2492512_2492794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|2492896_2493211_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|2493188_2494883_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|2494902_2496081_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|2496043_2496730_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|2496729_2497890_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|2497899_2498775_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|2498771_2499083_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|2499072_2499426_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|2499415_2499817_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|2499809_2500214_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|2500225_2500834_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|2500853_2501216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|2501218_2501401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348716.1|2501417_2504849_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286500.1|2504899_2505637_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002286497.1|2505646_2507938_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.0	9.6e-89
WP_002286495.1|2507961_2510088_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002286491.1|2510250_2510697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|2510698_2510836_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|2510873_2511167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|2511163_2511388_+|holin	holin	holin	NA	NA	NA	NA
WP_002349643.1|2511384_2512410_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_087046766.1|2513349_2514511_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286474.1|2515434_2515842_+	hypothetical protein	NA	NA	NA	NA	NA
2515832:2515847	attL	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002296902.1|2515855_2516257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|2516258_2516630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286680.1|2516665_2516968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076005172.1|2517216_2517417_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002348827.1|2517721_2518954_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|2519210_2519780_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2519185:2519200	attR	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002297963.1|2519957_2520398_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|2520555_2521320_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|2521351_2522275_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002331243.1|2522350_2523490_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|2523482_2524283_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|2524282_2525110_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|2525087_2525822_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|2525921_2526788_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|2526801_2527374_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|2527395_2528424_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|2528521_2529373_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002348826.1|2529406_2531440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348825.1|2531483_2532764_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002297185.1|2532860_2534156_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_010782578.1|2534420_2535695_-|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	8.6e-55
>prophage 15
NZ_CP040706	Enterococcus faecium strain HOU503 chromosome, complete genome	2702943	2612524	2678998	2702943	transposase,tRNA	Streptococcus_phage(18.18%)	53	NA	NA
WP_002287651.1|2612524_2614465_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.2	3.3e-114
WP_002287653.1|2614688_2615537_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296946.1|2615830_2617984_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_002296623.1|2618205_2619501_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002296740.1|2619680_2620490_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002295362.1|2620782_2622219_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.0	3.8e-43
WP_002290958.1|2622388_2623585_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002295359.1|2623646_2623832_-	YjzD family protein	NA	NA	NA	NA	NA
WP_002311576.1|2624062_2627377_+	DNA polymerase III subunit alpha	NA	R4TB75	Streptomyces_phage	33.0	1.8e-149
WP_002304759.1|2627544_2628507_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002295355.1|2628580_2630365_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_002295354.1|2630399_2631302_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295352.1|2631487_2632057_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_002290970.1|2632114_2632294_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002295350.1|2632463_2633885_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D8KPW3	Synechococcus_phage	31.1	4.2e-34
WP_002290973.1|2634077_2634764_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.2	4.8e-28
WP_002298265.1|2634760_2636266_+	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.1	3.9e-06
WP_002322034.1|2638687_2638885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|2643644_2644940_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002326809.1|2645297_2646593_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002288809.1|2646784_2647660_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002288811.1|2647763_2648528_+	carbohydrate deacetylase	NA	NA	NA	NA	NA
WP_002288812.1|2648544_2649957_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002303716.1|2649973_2651299_+	maltose-6'-phosphate glucosidase	NA	NA	NA	NA	NA
WP_002288815.1|2651311_2651770_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002288817.1|2652061_2653363_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002295336.1|2653389_2653650_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002303719.1|2654164_2654353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288819.1|2654648_2655884_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_002288821.1|2656451_2657279_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002288823.1|2657551_2658322_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002288825.1|2658539_2659607_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_002295331.1|2659624_2660086_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002288827.1|2660105_2661590_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288830.1|2661632_2661932_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002288832.1|2661946_2662585_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_002289048.1|2662589_2663450_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002295327.1|2663439_2664150_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_002289050.1|2664381_2664816_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002289065.1|2664912_2665212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289063.1|2665480_2665675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|2665831_2667010_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002297183.1|2668466_2670329_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002291790.1|2670328_2670661_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002287107.1|2670803_2672054_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002288314.1|2672463_2672820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288312.1|2672835_2673186_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_002288309.1|2673214_2673994_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_002296962.1|2674004_2674682_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_002288305.1|2674700_2675807_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_002288304.1|2675796_2676888_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_002288301.1|2676900_2677641_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_002296840.1|2677810_2678998_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
>prophage 1
NZ_CP040704	Enterococcus faecium strain HOU503 plasmid p1, complete sequence	206851	0	45235	206851	transposase,integrase	Streptococcus_phage(26.32%)	48	3149:3167	46222:46240
WP_002351511.1|266_503_-	addiction module antitoxin	NA	NA	NA	NA	NA
WP_002351510.1|639_873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002351509.1|857_1460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002351507.1|2322_2511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340535.1|2531_2744_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002340534.1|2733_3129_+	hypothetical protein	NA	NA	NA	NA	NA
3149:3167	attL	GGTTCTGTTGCAAAGTTTT	NA	NA	NA	NA
WP_002340533.1|3221_3902_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	1.3e-110
WP_002340532.1|3984_4602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340531.1|4765_5098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002351685.1|5162_5384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340530.1|5421_5583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111944786.1|5614_6295_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	1.6e-108
WP_002340528.1|6292_6571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002339787.1|6729_6996_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002339788.1|6985_7342_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002340527.1|7424_8204_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_002340526.1|8217_8934_-	Fic family protein	NA	NA	NA	NA	NA
WP_002340525.1|8982_9582_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.6	4.2e-28
WP_002351732.1|10533_11130_-	YdhK family protein	NA	NA	NA	NA	NA
WP_002307659.1|11150_11357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002351733.1|11371_12421_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.8	4.2e-39
WP_002340523.1|12417_12765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071974500.1|12948_13137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098049569.1|13120_14283_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.9	1.0e-78
WP_002301358.1|14793_15336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002307628.1|15648_16200_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	41.7	2.9e-31
WP_002340522.1|16492_18424_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.9	1.2e-97
WP_002320191.1|18722_19037_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002340521.1|19078_19987_+	cation transporter	NA	NA	NA	NA	NA
WP_002340520.1|20088_20700_-	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_002340519.1|20716_21079_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	41.3	1.4e-15
WP_002307621.1|21388_23293_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.5	1.7e-99
WP_002292161.1|23490_23724_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_002340518.1|23870_24725_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_025476824.1|24876_25584_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002307615.1|25768_26341_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	42.6	3.9e-23
WP_002340516.1|26875_28066_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	26.6	2.3e-22
WP_138816284.1|28510_29419_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002329978.1|30250_30565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340513.1|30731_33722_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	70.7	0.0e+00
WP_002340512.1|33742_35587_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	51.6	3.0e-165
WP_002351807.1|35614_36337_-	DUF4391 family protein	NA	A0A2K5B2C0	Erysipelothrix_phage	51.3	5.9e-69
WP_002340510.1|36337_39595_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	80.7	0.0e+00
WP_002340509.1|39643_39844_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	55.6	3.1e-12
WP_002340507.1|41683_42811_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	32.9	3.2e-13
WP_002295679.1|42840_43569_-	peptidase	NA	A0A1B0T6A2	Bacillus_phage	26.1	3.1e-09
WP_002292681.1|43828_44377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292680.1|44377_45235_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
46222:46240	attR	GGTTCTGTTGCAAAGTTTT	NA	NA	NA	NA
>prophage 2
NZ_CP040704	Enterococcus faecium strain HOU503 plasmid p1, complete sequence	206851	54972	178880	206851	holin,transposase,protease,bacteriocin	Streptococcus_phage(23.68%)	118	NA	NA
WP_010729506.1|54972_55944_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.4	1.2e-05
WP_002313084.1|56978_57584_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	32.6	3.6e-19
WP_002340501.1|57629_57809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348862.1|58702_58912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340500.1|58972_59932_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	7.7e-32
WP_002313088.1|60082_60298_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002313090.1|60298_60640_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_108676098.1|60783_61946_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002297185.1|62302_63598_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.8	5.3e-44
WP_002290394.1|64012_64330_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002290397.1|64330_64585_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295675.1|66875_67916_+	replication protein RepA	NA	NA	NA	NA	NA
WP_002322486.1|68739_69072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311521.1|69690_70032_+	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	63.4	3.1e-36
WP_002311523.1|70050_70341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311524.1|70532_70766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311526.1|71185_71857_+	class A sortase	NA	NA	NA	NA	NA
WP_002311527.1|71909_73538_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002311528.1|74046_74448_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	62.4	6.9e-43
WP_002311530.1|74471_75590_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QMQ9	Streptococcus_phage	50.8	1.1e-95
WP_002311532.1|76033_76789_+	class C sortase	NA	NA	NA	NA	NA
WP_002311533.1|76785_77613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311534.1|77622_77871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002349469.1|77901_80013_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002311537.1|80048_82100_-|protease	serine protease	protease	NA	NA	NA	NA
WP_002311538.1|82219_82429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|82764_83718_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_137217503.1|83695_84142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002307547.1|84138_84381_+	DUF5415 family protein	NA	NA	NA	NA	NA
WP_002295662.1|84398_84701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311542.1|84770_86825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002378383.1|86824_89434_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_002340494.1|89430_91827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340493.1|91878_92211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340492.1|92211_92805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340490.1|92967_94992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323679.1|94991_96197_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	42.4	1.1e-32
WP_002340489.1|96212_96857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311549.1|96867_97674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340488.1|97696_97927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340487.1|98044_99004_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	1.1e-35
WP_002311551.1|99497_99785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311552.1|99802_100225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033583488.1|100244_101837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002316755.1|102092_102287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287107.1|102422_103673_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002311557.1|104082_106455_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	28.9	1.1e-10
WP_002353044.1|106515_107976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301799.1|109964_110096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299811.1|110341_110938_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002311562.1|110950_111850_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002295625.1|112358_112616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311565.1|112774_112909_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002295623.1|113051_113312_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	1.2e-11
WP_002295619.1|113760_113967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293542.1|113966_114218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311567.1|114233_114671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033795402.1|114890_115091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293546.1|115351_115747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002314432.1|115728_115995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340480.1|116004_116238_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_002335346.1|116580_116763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340479.1|116752_116974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956687.1|117014_118176_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002290556.1|118967_119735_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002290555.1|120223_120649_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_002290554.1|120665_121181_+	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	36.0	3.3e-05
WP_002340477.1|121191_122124_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_002378516.1|122126_122666_+	tagatose 1,6-diphosphate aldolase	NA	NA	NA	NA	NA
WP_002354485.1|122688_123375_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000751236.1|123499_123952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000718009.1|123965_124655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|124779_127131_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_002304891.1|127210_127606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|127930_128548_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_000366408.1|128588_128888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000824191.1|128921_129089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321606.1|129133_129739_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	33.2	1.2e-19
WP_000343406.1|129863_132851_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	38.3	7.3e-206
WP_029756604.1|133501_133858_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	60.9	3.4e-25
WP_005228365.1|134371_134539_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	64.0	8.1e-14
WP_002354485.1|134948_135635_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000713874.1|136969_137344_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002324322.1|137756_138935_-|transposase	IS256-like element ISEfm2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	24.9	2.6e-29
WP_002302078.1|140673_142113_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|142114_143077_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|143246_144673_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|144915_145371_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002325009.1|145391_145625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289255.1|145956_146187_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|146416_147235_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|147395_148085_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|148098_149601_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|149613_150090_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086956687.1|150587_151750_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002322543.1|152015_152207_-	fructokinase	NA	NA	NA	NA	NA
WP_002305874.1|152252_152501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287870.1|152867_153386_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002313170.1|153728_153932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301591.1|155461_156547_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002286097.1|156654_157608_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	4.8e-34
WP_002301126.1|157738_158989_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298736.1|159007_159934_-	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_002301128.1|160012_161008_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|161023_162193_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|162208_162943_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087043335.1|163713_164876_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_002297185.1|166889_168185_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.8	5.3e-44
WP_002287522.1|168580_168985_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|169001_170150_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002313174.1|170423_170684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|170839_172018_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002300494.1|172107_173427_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|173423_174077_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002364827.1|174138_174279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348630.1|175216_175933_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	50.0	4.5e-45
WP_002302256.1|175982_176192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302261.1|177848_178880_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
>prophage 3
NZ_CP040704	Enterococcus faecium strain HOU503 plasmid p1, complete sequence	206851	185931	205242	206851	transposase,integrase	Streptococcus_phage(25.0%)	17	195315:195374	201840:202085
WP_002330696.1|185931_187554_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.5	1.2e-122
WP_002298085.1|187839_189216_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|189215_189872_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|189881_191159_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_111944785.1|191408_192570_+|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_010706480.1|193207_193558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115250354.1|194024_195186_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.8	5.9e-79
195315:195374	attL	CAACCAATCTAATCGAGTCTTTCAATAAGCAAATTAAAAGATACAGCCGTAGAAAAGAGC	NA	NA	NA	NA
WP_002305938.1|195657_195864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305939.1|196001_196961_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.9	4.5e-32
WP_002305121.1|196947_197553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002343836.1|197792_198941_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	90.8	3.9e-200
WP_002287522.1|198957_199362_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002303574.1|199610_200165_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.7	6.6e-36
WP_085807902.1|200629_201583_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.0	2.0e-11
WP_000997695.1|201705_202884_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
201840:202085	attR	GCTCTTTTCTACGGCTGTATCTTTTAATTTGCTTATTGAAAGACTCGATTAGATTGGTTGAGTAAATGGTTCTACGAATGCTAGGTGGAAAATCATAAAAAGTTAATAAGTCTTGGTTTTCTATGAGTGACTGCGTCACTTTAGGATAGTTTTTCTTCCATTTCTCAATCATGCCGGATAAGAAGGTATTCGCTTCTTCTTTTGAGTTAGCTTGATAAACAGCCTTAAAGTCATCACAGATTTCTT	NA	NA	NA	NA
WP_010729766.1|203973_204585_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.7	7.9e-99
WP_002351514.1|204645_205242_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.4	2.9e-13
>prophage 1
NZ_CP040708	Enterococcus faecium strain HOU503 plasmid p2	71214	764	54084	71214	transposase	Streptococcus_phage(52.94%)	61	NA	NA
WP_000122610.1|764_2057_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_001059542.1|2388_3357_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_001079843.1|3349_4381_+	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_000402348.1|4386_4995_+	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_000732308.1|5422_6334_+	VanY-A/VanY-F/VanY-M family D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_000516404.1|6486_6972_+	glycopeptide resistance protein VanZ-A	NA	NA	NA	NA	NA
WP_000754864.1|7258_7588_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	44.6	2.6e-16
WP_000629052.1|7892_8222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312841.1|8211_8499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000017403.1|8777_9341_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	46.4	2.3e-36
WP_000222572.1|9983_10937_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_000443455.1|10914_12390_+	RNA-directed DNA polymerase	NA	Q2P9X6	Enterobacteria_phage	34.8	3.5e-68
WP_002354485.1|14228_14915_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001232859.1|15095_15512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353844.1|15514_15799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311817.1|16144_16390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138816312.1|16691_16763_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_002354485.1|16821_17508_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001033544.1|18308_18509_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001120991.1|18524_18704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000388479.1|18834_19104_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000588503.1|19096_19354_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_001809248.1|19991_20816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261742.1|20980_21595_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	3.8e-16
WP_000969590.1|22044_23370_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	44.0	6.3e-101
WP_000568378.1|23362_23713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001021554.1|23709_23889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000026576.1|24024_24315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000101106.1|24682_25471_+	ParA family protein	NA	H7BUL8	unidentified_phage	35.7	4.7e-27
WP_000796719.1|25457_25784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997689.1|26132_27173_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_014748749.1|27788_28475_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.0e-126
WP_001814874.1|28614_28698_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001038792.1|28822_29560_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	7.0e-134
WP_138816310.1|29564_29756_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	100.0	2.9e-15
WP_002326809.1|29823_31119_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.5	5.3e-44
WP_000567888.1|32375_32621_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228166.1|32723_33593_+	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
WP_000662263.1|33573_34308_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_001255866.1|34340_35249_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_000627290.1|35245_35788_+	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001096887.1|35880_36675_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_002354485.1|37119_37806_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000599739.1|38003_38609_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_000170424.1|38624_39197_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_002360715.1|39533_39773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073120187.1|39669_40242_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_086953888.1|40342_41505_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_077828739.1|41545_41929_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	45.5	1.6e-12
WP_000199136.1|41910_42165_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_001196543.1|42357_42633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429439.1|42604_43558_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
WP_000947691.1|44169_45663_+	replication protein RepR	NA	NA	NA	NA	NA
WP_000053907.1|45797_46094_+	replication control protein PrgN	NA	NA	NA	NA	NA
WP_000222573.1|46117_47077_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	2.0e-32
WP_002354485.1|47203_47890_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002354485.1|48179_48866_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001280781.1|49566_50262_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|50239_51394_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_000122610.1|51491_52784_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_001059542.1|53115_54084_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
