The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042173	Yersinia sp. KBS0713 chromosome, complete genome	4539645	402837	488408	4539645	plate,tRNA,integrase,portal,protease,tail,head,lysis,capsid,holin	Salmonella_phage(42.11%)	92	409061:409076	458775:458790
WP_138774716.1|402837_403803_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_032896618.1|404218_405103_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_057648828.1|405214_406669_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005271356.1|406658_406901_-	YhdT family protein	NA	NA	NA	NA	NA
WP_005271359.1|407420_408770_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_004711025.1|408781_409246_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
409061:409076	attL	GACAGCGGCGGCCAGA	NA	NA	NA	NA
WP_032896624.1|409278_409731_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_032896626.1|409950_410550_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_005271370.1|410549_411590_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_005271373.1|411790_412768_-	oxidoreductase	NA	NA	NA	NA	NA
WP_032896630.1|413050_414970_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_004875762.1|415303_416347_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.0e-06
WP_005271379.1|416457_417441_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_032814839.1|417437_417926_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_005271381.1|417939_418533_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_032814841.1|418522_419992_+	ribonuclease G	NA	NA	NA	NA	NA
WP_138774717.1|420069_423942_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_049602645.1|423938_424793_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_005271388.1|424805_426251_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005271390.1|426279_427191_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_005271391.1|427533_427737_+	AaeX family protein	NA	NA	NA	NA	NA
WP_005271393.1|427744_428680_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_005271395.1|428681_430637_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_138775185.1|430758_432228_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_138775186.1|432336_432795_+	ribonuclease	NA	NA	NA	NA	NA
WP_005271405.1|432799_433066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005271408.1|433203_433752_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_050323587.1|433889_434882_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	60.4	3.6e-109
WP_050917242.1|434948_435251_-	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	54.0	9.5e-21
WP_138774718.1|435368_435692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774719.1|435688_435898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774720.1|435894_436209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775187.1|436389_436695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774721.1|436777_436975_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_138774722.1|436982_437807_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	54.6	5.1e-77
WP_138774723.1|437799_440346_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	35.5	6.0e-124
WP_138774724.1|440494_441178_+	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	62.7	6.2e-76
WP_138774725.1|441180_441432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774726.1|441424_441733_+	hypothetical protein	NA	Q7Y3Y1	Yersinia_phage	40.4	4.8e-12
WP_080382447.1|441732_442077_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	40.7	6.6e-18
WP_138774727.1|442771_443026_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_138774728.1|443175_444204_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	66.6	6.3e-133
WP_057618789.1|444200_444926_-	hypothetical protein	NA	A0A077K8Q7	Ralstonia_phage	35.4	3.2e-30
WP_049598908.1|444925_446689_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	63.4	5.2e-228
WP_082397885.1|446764_447670_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	54.1	1.8e-54
WP_049598912.1|447706_448762_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	64.7	1.7e-125
WP_049598914.1|448767_449421_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	44.9	1.6e-41
WP_049598917.1|449654_450146_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	48.4	1.6e-30
WP_049598920.1|450145_450349_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	67.2	3.0e-23
WP_071841755.1|450379_450766_+|holin	holin	holin	NA	NA	NA	NA
WP_049598922.1|450752_451148_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	2.0e-47
WP_049598925.1|451152_451578_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	48.1	3.5e-21
WP_072083670.1|451465_451690_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	48.5	2.5e-10
WP_049598928.1|451676_452144_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	55.8	1.8e-42
WP_138774729.1|452140_452587_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	49.3	8.5e-34
WP_049598934.1|452602_452860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049598936.1|452921_453623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049598939.1|453971_454262_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	39.4	1.8e-05
WP_049598943.1|454242_454515_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_049598946.1|454651_455287_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	62.9	5.4e-66
WP_049598948.1|455283_455640_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	57.7	1.1e-31
WP_049598951.1|455639_456548_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.5	1.3e-118
WP_049598954.1|456540_457149_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	76.0	1.3e-88
WP_074007273.1|457145_458315_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	63.6	1.2e-98
WP_054872124.1|458317_458797_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	45.5	2.1e-38
458775:458790	attR	TCTGGCCGCCGCTGTC	NA	NA	NA	NA
WP_049598960.1|458920_460096_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	80.1	2.7e-180
WP_042562520.1|460107_460623_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	68.0	3.2e-61
WP_049598964.1|460779_461091_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	53.6	5.9e-18
WP_042562521.1|461105_461225_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	56.4	1.4e-07
WP_049598967.1|461217_464142_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	46.1	3.7e-154
WP_049598971.1|464153_464618_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	64.6	8.5e-45
WP_049598974.1|464614_465715_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	65.4	2.9e-128
WP_013649733.1|465789_466005_+	phage transcriptional activator, Ogr/Delta	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
WP_054872105.1|466476_467829_+	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	25.2	8.6e-13
WP_138775188.1|468069_468330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005271411.1|468608_469949_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_054872818.1|470147_470534_+	cytochrome b562	NA	NA	NA	NA	NA
WP_032896665.1|470634_471045_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_054872817.1|471441_471786_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_005271418.1|471809_472175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032815603.1|472174_472471_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_004701420.1|472555_473332_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_005188514.1|473350_474004_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_138774730.1|474086_475256_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_138774731.1|475239_476352_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_005271427.1|476355_477096_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_138774732.1|477292_479221_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_138774733.1|479272_482005_-	magnesium-translocating P-type ATPase	NA	M1HN09	Paramecium_bursaria_Chlorella_virus	26.4	1.4e-38
WP_138774734.1|482547_483495_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_005271434.1|483821_485237_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_054872814.1|485317_486979_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_032898338.1|487673_488408_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP042173	Yersinia sp. KBS0713 chromosome, complete genome	4539645	784216	893328	4539645	plate,tRNA,integrase,portal,tail,head,lysis,capsid,holin	Salmonella_phage(50.0%)	100	859398:859416	893420:893438
WP_138774778.1|784216_785278_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_138774779.1|785274_787140_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_138774780.1|787144_787723_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_138774781.1|787807_788857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138774782.1|788969_789467_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_005272148.1|789715_791218_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_005272151.1|791221_791749_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_054873073.1|791877_792900_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_138774783.1|792969_796602_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_138774784.1|796616_797828_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_032896924.1|797830_799177_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_032896926.1|799218_799749_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_005272173.1|799874_800267_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_005272176.1|800276_800912_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_138774785.1|800937_801999_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_138774786.1|801998_804536_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_005272179.1|805241_807296_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.9	3.1e-30
WP_005272180.1|807369_807846_+	Dabb family protein	NA	NA	NA	NA	NA
WP_005272181.1|808100_808487_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_138775197.1|808812_809082_+	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_050413677.1|809155_809575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005272183.1|809699_810416_-	transcription regulator SdiA	NA	NA	NA	NA	NA
WP_138774787.1|810990_814470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774788.1|814941_815826_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138774789.1|816070_818122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774790.1|818171_821099_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_138774791.1|821193_821880_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_138774792.1|821876_823289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005272195.1|823285_823723_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_138774793.1|824527_826477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005272200.1|826900_827629_+	aquaporin Z	NA	NA	NA	NA	NA
WP_032896938.1|828078_828654_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.8	5.6e-54
WP_138774794.1|829296_830259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005272214.1|831402_831984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005272215.1|832216_832723_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_138774795.1|833025_835593_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_054873082.1|835628_836357_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_138775198.1|836425_836938_+	fimbrial protein	NA	NA	NA	NA	NA
WP_005272228.1|837008_837545_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_138774796.1|837649_838732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774797.1|839060_840071_-	zinc-binding dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.6	1.6e-11
WP_005272233.1|840246_841143_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138774798.1|841174_841426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138774799.1|844285_845872_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_138774800.1|845903_847667_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_138775200.1|847666_848728_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_138775199.1|848747_849245_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_138774801.1|849246_849690_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_138774802.1|849714_851103_+	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_071984961.1|851689_851869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138774803.1|852015_854178_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_138774804.1|854252_855002_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_005279448.1|855171_856248_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_004876892.1|856299_856572_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_072083833.1|856635_857694_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_032899056.1|858318_859038_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_032815284.1|859037_859364_+	YggL family protein	NA	NA	NA	NA	NA
859398:859416	attL	CGCCTAAGCAGGCGCCTTT	NA	NA	NA	NA
WP_138774805.1|859531_859867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138774806.1|859995_860235_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	50.0	1.3e-09
WP_138774807.1|860297_861407_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	65.5	4.4e-132
WP_138774808.1|861547_862726_+|tail	phage tail sheath protein	tail	A0A0M4S6M1	Salmonella_phage	67.3	6.1e-156
WP_049601750.1|862737_863253_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	71.9	6.7e-67
WP_138774809.1|863722_866929_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	38.3	1.0e-160
WP_138774810.1|866934_867360_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	60.9	5.6e-43
WP_049601739.1|867668_868310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049601736.1|868290_868509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774811.1|868586_869159_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	68.9	1.6e-64
WP_138774812.1|869588_870008_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.6	9.8e-16
WP_138775201.1|870050_870428_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_053100131.1|870477_871848_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	52.3	3.6e-107
WP_138774813.1|871844_872453_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	73.6	5.3e-87
WP_138774814.1|872445_873354_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	76.2	3.2e-120
WP_138774815.1|873350_873701_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	53.6	6.7e-26
WP_138774816.1|873697_874345_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	50.7	2.2e-51
WP_138774817.1|874453_875041_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_138775202.1|875037_875226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138774818.1|875319_875937_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	42.0	1.3e-37
WP_138774819.1|875989_876451_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	50.0	4.2e-36
WP_138774820.1|876437_876662_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	53.0	1.7e-11
WP_138774821.1|876549_876975_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	43.0	2.8e-18
WP_138774822.1|876979_877375_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	7.0e-48
WP_138774823.1|877361_877748_-|holin	holin	holin	NA	NA	NA	NA
WP_138774824.1|877785_877989_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	67.2	1.1e-20
WP_138774825.1|877989_878472_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	51.2	9.8e-36
WP_138774826.1|879522_880563_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	60.3	2.0e-118
WP_138774827.1|880595_881450_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	50.9	4.0e-56
WP_138774828.1|881608_883327_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	59.9	3.2e-190
WP_138774829.1|883329_884361_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	64.6	3.0e-127
WP_138774830.1|884390_884708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138774831.1|884934_886122_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_138774832.1|886125_886920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774833.1|889325_890138_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	53.8	1.8e-74
WP_138774834.1|890134_890359_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	58.1	9.5e-18
WP_138774835.1|890358_890586_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	38.0	9.3e-05
WP_049603001.1|890659_890989_-	DUF5347 family protein	NA	NA	NA	NA	NA
WP_049603000.1|891013_891238_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	48.5	6.6e-11
WP_082153430.1|891234_891423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049602999.1|891485_891857_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	61.1	5.0e-32
WP_049602998.1|891966_892266_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	64.6	9.4e-29
WP_049602997.1|892332_893328_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	67.7	2.6e-131
893420:893438	attR	CGCCTAAGCAGGCGCCTTT	NA	NA	NA	NA
>prophage 3
NZ_CP042173	Yersinia sp. KBS0713 chromosome, complete genome	4539645	1501574	1561013	4539645	plate,tRNA,terminase,portal,protease,tail,head,capsid	Shigella_phage(31.82%)	73	NA	NA
WP_138774950.1|1501574_1502507_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_138774951.1|1502653_1503286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005274383.1|1503590_1503767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032897931.1|1504164_1505100_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_054872758.1|1505260_1506973_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_054872759.1|1507322_1507862_+	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_005189583.1|1507918_1508260_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_005274392.1|1508649_1509753_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_005274394.1|1509962_1510211_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005274396.1|1510392_1511229_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.2	9.1e-13
WP_138774952.1|1511265_1512195_+	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_072188500.1|1512444_1513248_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_138774953.1|1513247_1514153_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_005274408.1|1514423_1514894_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.0	6.6e-37
WP_054872765.1|1515259_1516528_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_138774954.1|1516612_1518214_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_032897937.1|1518213_1519290_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_049601534.1|1519286_1520123_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A1M7XV31	Cedratvirus	26.1	2.1e-09
WP_005274418.1|1520211_1520910_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.3	1.3e-12
WP_138774955.1|1520917_1521772_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_145522864.1|1522289_1522472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138774957.1|1522649_1523396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138774958.1|1523401_1524583_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.0	2.7e-31
WP_050077941.1|1524586_1524805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138774959.1|1524862_1525321_-	polyphosphate kinase	NA	A0A2L0V121	Agrobacterium_phage	58.7	6.9e-07
WP_138774960.1|1525304_1525934_-	methyltransferase domain-containing protein	NA	A0A0N7IRF6	Acinetobacter_phage	59.9	1.5e-55
WP_138774961.1|1525926_1526208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138774962.1|1526200_1526872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138774963.1|1527044_1527578_-	HD family hydrolase	NA	Q8SBG0	Shigella_phage	59.0	4.1e-51
WP_138774964.1|1527625_1527865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077173678.1|1527943_1528852_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	43.5	5.0e-57
WP_099460466.1|1529344_1529812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774965.1|1530216_1530939_-	helix-turn-helix domain-containing protein	NA	A0A0N7KZF6	Stx2-converting_phage	36.6	2.3e-25
WP_049602723.1|1531012_1531261_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	41.6	1.5e-08
WP_050946212.1|1531305_1531833_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	30.3	6.3e-12
WP_138774966.1|1531998_1532199_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_138774967.1|1532195_1533215_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	72.8	2.4e-31
WP_138774968.1|1533207_1534095_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	56.0	1.5e-93
WP_138774969.1|1534091_1535858_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	58.4	1.1e-220
WP_138775214.1|1535881_1536526_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	57.3	4.9e-59
WP_138774970.1|1536522_1537524_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	50.3	2.5e-94
WP_138774971.1|1537600_1538419_+	antitermination protein	NA	F1C595	Cronobacter_phage	41.7	9.4e-55
WP_077294250.1|1538757_1539804_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	65.1	1.1e-132
WP_138774972.1|1539950_1540166_+	peptidoglycan-binding protein LysM	NA	H9C183	Pectobacterium_phage	54.0	1.5e-12
WP_138774973.1|1540165_1540696_+	glycoside hydrolase family protein	NA	H9C184	Pectobacterium_phage	73.1	5.8e-74
WP_138774974.1|1540688_1541210_+	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	89.0	2.9e-78
WP_138775215.1|1541283_1541865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138774975.1|1541960_1542311_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	67.2	1.2e-43
WP_138774976.1|1542507_1542963_+|terminase	P27 family phage terminase small subunit	terminase	A0A1J0GV10	Halomonas_phage	52.9	2.1e-24
WP_138774977.1|1542965_1544696_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	60.7	1.7e-210
WP_138774978.1|1544706_1544895_+	DUF2244 domain-containing protein	NA	Q6UAX9	Klebsiella_phage	58.2	8.0e-10
WP_138774979.1|1544894_1546124_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	81.2	1.0e-190
WP_049617365.1|1546113_1546764_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	81.9	2.4e-101
WP_138774980.1|1546779_1547988_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	78.1	9.0e-179
WP_145528839.1|1548040_1548373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774982.1|1548391_1548706_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	52.8	3.3e-24
WP_138774983.1|1548702_1549095_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_049603051.1|1549094_1549613_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	59.3	1.7e-49
WP_049603052.1|1549609_1550161_+	hypothetical protein	NA	S5FM61	Shigella_phage	55.4	9.7e-56
WP_138774984.1|1550167_1550374_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	69.0	1.9e-09
WP_138774985.1|1550370_1551864_+|tail	phage tail protein	tail	A0A192Y7L1	Salmonella_phage	68.5	3.6e-185
WP_038277325.1|1551864_1552221_+|tail	tail protein	tail	U5P076	Shigella_phage	85.6	9.1e-55
WP_050159698.1|1552217_1552484_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	63.5	1.2e-24
WP_138775216.1|1552450_1552636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774986.1|1552625_1554455_+|tail	phage tail tape measure protein	tail	M1FQW0	Enterobacteria_phage	60.5	3.5e-174
WP_138774987.1|1554465_1554972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774988.1|1555036_1556341_+	DNA circularization protein	NA	S5FUX4	Shigella_phage	56.3	1.2e-136
WP_138774989.1|1556337_1557408_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	64.3	1.2e-131
WP_138774990.1|1557407_1557974_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	48.1	1.4e-33
WP_138774991.1|1557977_1558391_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	59.1	4.6e-42
WP_138774992.1|1558383_1559442_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	62.2	2.7e-131
WP_138774993.1|1559432_1560014_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	64.6	2.5e-70
WP_138774994.1|1560020_1561013_+	hypothetical protein	NA	U5P0I1	Shigella_phage	48.3	8.8e-23
>prophage 4
NZ_CP042173	Yersinia sp. KBS0713 chromosome, complete genome	4539645	1627357	1679369	4539645	integrase,portal,protease,transposase	Cronobacter_phage(28.57%)	50	1627256:1627286	1642390:1642420
1627256:1627286	attL	AATTCCAGGCAAGAAAAAACCCGACTAGTCT	NA	NA	NA	NA
WP_138775003.1|1627357_1628407_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	58.0	2.5e-113
WP_138775004.1|1628520_1629741_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_138775005.1|1629819_1631556_-	AIPR family protein	NA	NA	NA	NA	NA
WP_138775006.1|1631580_1632147_-	phage repressor protein	NA	F1BUN8	Cronobacter_phage	38.3	8.2e-34
WP_032819427.1|1632280_1632508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005276278.1|1632540_1633044_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	52.5	6.2e-41
WP_005276280.1|1633056_1633260_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_005276282.1|1633262_1633637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775007.1|1633645_1634053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775008.1|1634183_1636271_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	61.6	4.3e-229
WP_005276288.1|1636380_1636575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054872917.1|1636810_1637707_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.9	3.2e-72
WP_005276294.1|1638251_1638437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005276300.1|1638981_1639938_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	6.1e-146
WP_032898266.1|1640848_1641055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032898267.1|1641412_1642054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032898268.1|1642034_1642253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032898269.1|1642578_1644267_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
1642390:1642420	attR	AATTCCAGGCAAGAAAAAACCCGACTAGTCT	NA	NA	NA	NA
WP_004873700.1|1644636_1644900_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.5	1.0e-26
WP_032898270.1|1645207_1645516_+	YbjC family protein	NA	NA	NA	NA	NA
WP_099460424.1|1645536_1645629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032898271.1|1645635_1646121_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_049601471.1|1646523_1647633_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_138775009.1|1647754_1648888_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	1.3e-30
WP_138775010.1|1648938_1649904_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_032898273.1|1649900_1650746_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_005276328.1|1650910_1651381_+	YbjO family protein	NA	NA	NA	NA	NA
WP_032898275.1|1651473_1652610_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.6	1.4e-24
WP_005276333.1|1652668_1653400_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032899150.1|1653950_1654619_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_005279817.1|1654618_1655335_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_005279816.1|1655346_1656078_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_049601639.1|1656098_1656827_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.4	1.0e-28
WP_138775011.1|1657116_1657662_-	chorismate mutase	NA	NA	NA	NA	NA
WP_049601465.1|1657772_1658348_-	lipoprotein	NA	NA	NA	NA	NA
WP_049601462.1|1658468_1659479_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099460423.1|1659819_1661310_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_032898062.1|1661306_1662326_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_138775012.1|1662476_1663400_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054872790.1|1663880_1665602_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_072188381.1|1665762_1666803_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_005275056.1|1666930_1668583_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_005275057.1|1668800_1669700_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_054872792.1|1669932_1671597_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_138775013.1|1671607_1672567_-	DUF535 family protein	NA	NA	NA	NA	NA
WP_080375762.1|1672772_1673888_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_057646923.1|1673887_1675837_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	38.1	5.2e-35
WP_005275069.1|1676077_1676335_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.2e-16
WP_004873731.1|1676746_1677067_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.1e-14
WP_005275070.1|1677092_1679369_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.9e-166
>prophage 5
NZ_CP042173	Yersinia sp. KBS0713 chromosome, complete genome	4539645	2376304	2497745	4539645	coat,plate,tRNA,terminase,integrase,protease,tail,head,transposase	Pectobacterium_phage(46.27%)	137	2464849:2464862	2501852:2501865
WP_049601714.1|2376304_2376655_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	53.6	6.7e-26
WP_138775128.1|2376651_2377908_+|tail	phage tail protein I	tail	F1BUP3	Erwinia_phage	76.2	1.1e-91
WP_071984950.1|2378250_2378676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032898773.1|2379381_2379696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099460565.1|2379692_2380511_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_138775129.1|2380624_2381068_-|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	60.9	3.4e-43
WP_138775130.1|2381070_2381718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032896990.1|2381811_2382051_+	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	50.0	1.7e-09
WP_032896992.1|2382307_2382604_+	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	70.3	6.2e-17
WP_004875238.1|2382826_2383123_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_138775131.1|2383127_2385515_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.8	4.3e-07
WP_005272321.1|2385529_2386513_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_004706556.1|2386838_2387195_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004713020.1|2387232_2387430_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_011816226.1|2387526_2388078_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_049602842.1|2388081_2390010_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.9e-128
WP_005161573.1|2390331_2390544_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_005272323.1|2390660_2391374_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_072083918.1|2391660_2391915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032897051.1|2392004_2392184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005272329.1|2392254_2392497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086018773.1|2392560_2392875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005272344.1|2393142_2393826_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_005272347.1|2393951_2394614_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_032897001.1|2394825_2395794_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_032897003.1|2395790_2396681_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.9e-08
WP_005272352.1|2396680_2397565_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_138775132.1|2397561_2398470_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_005272356.1|2398808_2399678_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_005272359.1|2399872_2400427_-	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_005272362.1|2400615_2401281_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_032814453.1|2401364_2401697_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004875262.1|2402119_2402881_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	6.3e-21
WP_005272370.1|2403208_2404876_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_004875265.1|2404916_2405807_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_049602845.1|2405799_2406720_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_005272380.1|2406733_2407861_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.0e-11
WP_004875268.1|2407876_2409166_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005272382.1|2409478_2410177_+	porin	NA	NA	NA	NA	NA
WP_005272385.1|2410466_2411015_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	34.8	9.8e-08
WP_138775133.1|2411226_2412624_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_032897055.1|2412682_2413525_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	29.3	1.1e-10
WP_005272392.1|2413927_2414719_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_005272394.1|2414905_2416072_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_138775134.1|2416359_2417727_+	MFS transporter	NA	NA	NA	NA	NA
WP_005272400.1|2417845_2418727_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_138775135.1|2419052_2421119_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.3	5.6e-88
WP_005272404.1|2421138_2421852_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_138775136.1|2421947_2422445_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_005272409.1|2422669_2423917_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_138775137.1|2423885_2426516_+	MCE family protein	NA	NA	NA	NA	NA
WP_049602852.1|2426512_2427445_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138775138.1|2427567_2429001_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.8	7.7e-20
WP_005272417.1|2429309_2429864_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032897057.1|2429869_2430424_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032897021.1|2430436_2431000_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_049602854.1|2431053_2431803_+	molecular chaperone	NA	NA	NA	NA	NA
WP_138775139.1|2431889_2434331_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_138775140.1|2434350_2435358_+	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_032897025.1|2435572_2437282_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_005272435.1|2437396_2437639_+	YebV family protein	NA	NA	NA	NA	NA
WP_005272437.1|2437750_2438140_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005272441.1|2438857_2439091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775141.1|2439311_2439947_-	glutathione transferase	NA	NA	NA	NA	NA
WP_005272443.1|2440122_2440371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032897026.1|2440570_2440765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032897059.1|2440869_2441568_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	1.1e-08
WP_005272448.1|2441577_2442117_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_032897061.1|2442605_2443625_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005272455.1|2443584_2444640_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_032897027.1|2445131_2445656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049602858.1|2445777_2446596_-	oxidoreductase	NA	NA	NA	NA	NA
WP_138775142.1|2446726_2447509_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_138775143.1|2447778_2448339_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005272469.1|2449066_2449636_-	DUF2239 family protein	NA	NA	NA	NA	NA
WP_138775144.1|2450544_2452509_+	acyltransferase family protein	NA	A0A1R3Y5Q6	Salmonella_virus	30.5	3.0e-67
WP_138775145.1|2452663_2453284_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	43.6	1.4e-34
WP_138775227.1|2453283_2453937_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	51.1	7.8e-44
WP_019079691.1|2454565_2455210_-	DUF2612 domain-containing protein	NA	H9C1B4	Pectobacterium_phage	49.0	5.0e-43
WP_138775146.1|2455202_2456402_-|plate	phage baseplate protein	plate	H9C1B3	Pectobacterium_phage	66.8	1.3e-148
WP_049603932.1|2456401_2456752_-	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	64.7	8.4e-37
WP_138775228.1|2456824_2457502_-	hypothetical protein	NA	H9C1B1	Pectobacterium_phage	57.1	8.0e-68
WP_050535631.1|2457509_2458403_-	hypothetical protein	NA	H9C1B0	Pectobacterium_phage	46.8	6.0e-79
WP_138775147.1|2458395_2458686_-	hypothetical protein	NA	H9C1A9	Pectobacterium_phage	59.6	4.7e-25
WP_019079697.1|2458685_2459354_-	hypothetical protein	NA	H9C1A8	Pectobacterium_phage	48.9	6.7e-35
WP_138775148.1|2459353_2461042_-	lysozyme	NA	H9C1A7	Pectobacterium_phage	47.6	7.2e-118
WP_138775149.1|2461154_2463191_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_138775004.1|2463310_2464531_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_138775151.1|2464818_2465211_-	hypothetical protein	NA	H9C1A4	Pectobacterium_phage	57.7	3.3e-34
2464849:2464862	attL	CGCGTTTCTTCCCT	NA	NA	NA	NA
WP_138775152.1|2465213_2465618_-	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	80.6	2.7e-55
WP_138775153.1|2465624_2466782_-	DUF3383 family protein	NA	H9C1A2	Pectobacterium_phage	75.3	4.0e-168
WP_138775154.1|2466765_2467326_-	hypothetical protein	NA	H9C1A1	Pectobacterium_phage	62.9	9.9e-56
WP_138775155.1|2467325_2467745_-	hypothetical protein	NA	H9C1A0	Pectobacterium_phage	75.0	2.9e-60
WP_138775156.1|2467747_2468215_-	hypothetical protein	NA	H9C199	Pectobacterium_phage	80.0	4.4e-65
WP_138775157.1|2468211_2468619_-	DUF4054 domain-containing protein	NA	H9C198	Pectobacterium_phage	74.3	2.0e-50
WP_138775158.1|2468643_2469024_-	hypothetical protein	NA	H9C197	Pectobacterium_phage	39.2	4.9e-14
WP_138775159.1|2469026_2469962_-	DUF2184 domain-containing protein	NA	H9C196	Pectobacterium_phage	82.6	3.1e-147
WP_138775160.1|2469980_2470517_-	hypothetical protein	NA	H9C195	Pectobacterium_phage	66.5	1.4e-51
WP_138775161.1|2470516_2471716_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	71.7	1.1e-123
WP_138775229.1|2471727_2472477_-|head	phage head morphogenesis protein	head	H9C193	Pectobacterium_phage	75.9	1.2e-104
WP_138775162.1|2472535_2473921_-	DUF1073 domain-containing protein	NA	H9C192	Pectobacterium_phage	69.7	1.9e-188
WP_138775163.1|2473923_2475567_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	85.0	3.7e-292
WP_054872663.1|2475693_2475933_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	63.3	6.8e-22
WP_012105238.1|2475922_2476207_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	76.6	6.4e-35
WP_054872664.1|2476217_2477246_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.4	8.8e-42
WP_138775230.1|2477249_2477510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775164.1|2477512_2478127_-	protein Mom	NA	C9E2P8	Enterococcus_phage	62.1	8.0e-67
WP_138775165.1|2478123_2478633_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	50.6	9.3e-37
WP_138775166.1|2478999_2479740_-	serine/threonine-protein phosphatase	NA	I6PCV8	Cronobacter_phage	47.5	3.9e-60
WP_138775167.1|2479736_2480537_-	protein kinase	NA	M1HD21	Acanthocystis_turfacea_Chlorella_virus	31.0	2.7e-06
WP_138775231.1|2480666_2480861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775168.1|2480895_2481228_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_138775232.1|2481220_2481751_-	glycoside hydrolase family protein	NA	Q7Y3V3	Yersinia_phage	73.1	2.5e-72
WP_019082932.1|2481750_2481966_-	peptidoglycan-binding protein LysM	NA	H9C183	Pectobacterium_phage	55.6	4.0e-13
WP_138775169.1|2482289_2483357_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_138775170.1|2483319_2484819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775233.1|2484809_2485160_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	70.8	4.1e-44
WP_048615663.1|2485201_2485486_-	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	79.8	6.1e-38
WP_138775171.1|2485494_2486088_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	57.9	1.7e-61
WP_054872677.1|2486162_2486345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775172.1|2486499_2488650_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	50.7	1.0e-217
WP_138775173.1|2488646_2489147_-	hypothetical protein	NA	H9C166	Pectobacterium_phage	43.8	3.9e-19
WP_025378510.1|2489161_2489569_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	45.7	1.4e-30
WP_138775174.1|2489612_2490626_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	55.5	1.9e-41
WP_050135376.1|2490638_2490827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050291239.1|2490819_2491071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050291240.1|2491084_2491525_-|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	55.6	4.9e-34
WP_042546153.1|2491565_2491763_-	transcriptional regulator	NA	H9C161	Pectobacterium_phage	47.5	1.6e-08
WP_042546154.1|2491845_2492238_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	54.5	5.0e-30
WP_138775175.1|2492410_2492629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273932.1|2492650_2492824_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_138775176.1|2492837_2493170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050941904.1|2493358_2493673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775177.1|2493686_2495840_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	36.2	1.2e-101
WP_138775178.1|2495836_2496349_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	46.5	2.0e-34
WP_050152217.1|2496421_2496688_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.9	8.6e-10
WP_138775179.1|2496662_2497745_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.1	1.0e-104
2501852:2501865	attR	AGGGAAGAAACGCG	NA	NA	NA	NA
>prophage 6
NZ_CP042173	Yersinia sp. KBS0713 chromosome, complete genome	4539645	2553985	2618425	4539645	plate,terminase,integrase,portal,tail,head,transposase,capsid,lysis,holin	Salmonella_phage(23.53%)	87	2552136:2552149	2564288:2564301
2552136:2552149	attL	AATTCTCAATAATG	NA	NA	NA	NA
WP_138775242.1|2553985_2555017_-|integrase	tyrosine-type recombinase/integrase	integrase	Q1I119	Pasteurella_virus	63.0	1.3e-117
WP_138775004.1|2555133_2556354_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_138775243.1|2556661_2557231_-	Cro/Cl family transcriptional regulator	NA	Q6K1G0	Salmonella_virus	38.2	1.8e-25
WP_019079169.1|2557343_2557541_+	DNA-binding protein	NA	Q1I116	Pasteurella_virus	39.3	2.8e-05
WP_099529434.1|2557595_2558105_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	52.4	1.2e-44
WP_032909021.1|2558114_2558300_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_138775244.1|2558311_2558623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775245.1|2558688_2558961_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	46.7	1.7e-05
WP_138775246.1|2558960_2559266_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_072092323.1|2559374_2560280_+	hypothetical protein	NA	A0A140XFY3	Salmonella_phage	63.2	4.2e-104
WP_138775247.1|2560276_2562562_+	replication endonuclease	NA	Q858T4	Yersinia_virus	57.1	1.4e-241
WP_138775248.1|2563018_2563981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775954.1|2564679_2564862_+	hypothetical protein	NA	NA	NA	NA	NA
2564288:2564301	attR	CATTATTGAGAATT	NA	NA	NA	NA
WP_138775249.1|2565226_2565505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049611587.1|2565617_2566655_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	78.2	6.1e-160
WP_138775250.1|2566651_2567416_-|terminase	terminase	terminase	O80303	Escherichia_phage	45.4	1.6e-56
WP_138775251.1|2567412_2569185_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	80.8	8.5e-287
WP_138775252.1|2569335_2570190_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	61.8	2.4e-93
WP_138775253.1|2570266_2571487_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	74.6	5.2e-150
WP_138775254.1|2571490_2572150_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	71.7	1.9e-82
WP_050880712.1|2572249_2572729_+|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	59.4	1.1e-42
WP_005163749.1|2572728_2572932_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	62.7	1.0e-18
WP_005163750.1|2572934_2573144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775255.1|2573127_2573634_+	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	63.1	6.8e-56
WP_138775256.1|2573635_2574040_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	52.6	1.4e-27
WP_071826048.1|2574011_2574209_+|holin	holin	holin	F1BUQ0	Erwinia_phage	55.9	8.9e-12
WP_138775257.1|2574147_2574603_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	61.3	1.3e-45
WP_138775258.1|2574599_2575049_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	64.4	2.4e-44
WP_004705545.1|2575594_2575912_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	47.0	1.6e-15
WP_042840570.1|2575886_2576819_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_138775259.1|2576919_2577561_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	62.9	7.3e-71
WP_138775260.1|2577557_2577908_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	68.1	1.2e-38
WP_138775261.1|2577912_2578821_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	79.1	1.6e-124
WP_005163764.1|2578813_2579422_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	79.1	1.0e-90
WP_138775262.1|2579418_2580573_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	57.1	3.0e-107
WP_138775263.1|2580574_2581057_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	50.6	8.5e-40
WP_138775264.1|2581183_2582353_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	79.4	1.5e-183
WP_138775265.1|2582366_2582882_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	72.5	3.0e-67
WP_138775266.1|2582937_2583249_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	65.6	7.7e-26
WP_004875948.1|2583281_2583404_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	71.1	2.0e-09
WP_138775267.1|2583396_2585826_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	45.0	1.6e-150
WP_138775268.1|2585828_2586314_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	60.4	3.5e-49
WP_138775269.1|2586310_2587477_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	67.8	1.4e-149
WP_011192198.1|2587568_2587784_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	62.5	9.7e-20
WP_138775270.1|2588270_2588513_+	DinI-like family protein	NA	K7PKR6	Enterobacteria_phage	72.7	5.1e-25
WP_138775956.1|2588556_2588772_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	54.5	5.2e-13
WP_138775271.1|2588835_2589078_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	55.7	9.3e-19
WP_138775272.1|2589434_2589869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775273.1|2589907_2590420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775274.1|2590438_2591026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775275.1|2591260_2592079_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_138775276.1|2592056_2592386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775277.1|2592627_2593251_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	43.1	9.1e-34
WP_138775278.1|2594436_2595111_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	48.4	3.6e-52
WP_138775279.1|2595110_2596298_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	56.6	2.8e-116
WP_004712483.1|2596298_2596652_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	73.5	2.7e-43
WP_138775280.1|2596648_2597392_-|plate	phage baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	58.6	6.1e-77
WP_138775281.1|2597452_2597800_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	63.6	3.9e-18
WP_138775282.1|2597811_2598825_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	62.1	4.3e-126
WP_138775958.1|2598878_2599070_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	41.7	2.0e-08
WP_138775283.1|2599183_2599765_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	67.0	1.3e-63
WP_138775284.1|2599773_2601780_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	63.0	4.9e-238
WP_050079836.1|2601766_2601958_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	44.0	7.1e-06
WP_138775285.1|2601957_2602356_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	60.6	7.6e-34
WP_138775286.1|2602366_2602807_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	69.2	5.2e-52
WP_138775287.1|2602818_2604294_-	DUF3383 family protein	NA	A0A0P0I492	Acinetobacter_phage	53.7	1.3e-144
WP_138775960.1|2604296_2604680_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	62.4	9.5e-42
WP_138775288.1|2604825_2605224_-|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	80.6	3.9e-54
WP_138775289.1|2605210_2605705_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	64.7	3.8e-51
WP_138775290.1|2605701_2606106_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	67.4	1.9e-45
WP_138775291.1|2606059_2606404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775292.1|2606441_2607386_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	72.3	8.1e-135
WP_138775962.1|2607398_2607869_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	61.8	2.3e-50
WP_138775293.1|2607893_2609120_-	DUF2213 domain-containing protein	NA	A0A2H4J159	uncultured_Caudovirales_phage	52.6	8.4e-108
WP_138775964.1|2609123_2609717_-|head	phage head morphogenesis protein	head	A0A2H4JI47	uncultured_Caudovirales_phage	62.2	2.7e-67
WP_138775294.1|2609736_2611209_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	61.2	3.2e-178
WP_138775295.1|2611208_2612825_-	TerL protein	NA	A9YWZ6	Burkholderia_phage	72.6	5.3e-235
WP_138775296.1|2613053_2614076_-|terminase	terminase small subunit	terminase	A0A248SKT2	Klebsiella_phage	41.2	6.7e-42
WP_138775297.1|2614234_2614582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775298.1|2614616_2614829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775299.1|2614821_2615154_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_049602734.1|2615146_2615677_-	lysozyme	NA	Q7Y3V3	Yersinia_phage	72.6	1.4e-72
WP_138775300.1|2615676_2615892_-	peptidoglycan-binding protein LysM	NA	H9C183	Pectobacterium_phage	54.0	1.5e-12
WP_138775301.1|2615957_2616686_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	69.0	7.5e-88
WP_138775302.1|2616969_2617542_-	DUF1133 family protein	NA	NA	NA	NA	NA
WP_138775303.1|2617538_2617823_-	DUF1364 family protein	NA	H9C174	Pectobacterium_phage	76.6	3.4e-36
WP_138775304.1|2617831_2618425_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	55.3	4.9e-61
>prophage 7
NZ_CP042173	Yersinia sp. KBS0713 chromosome, complete genome	4539645	2621548	2633025	4539645	tRNA,integrase	Pectobacterium_phage(61.54%)	14	2631090:2631103	2633978:2633991
WP_138775308.1|2621548_2622922_-	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	48.4	6.3e-112
WP_138775309.1|2622918_2623893_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	62.5	5.6e-38
WP_138775310.1|2623895_2624120_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	66.2	1.4e-21
WP_138775311.1|2624136_2624601_-|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	56.1	1.8e-34
WP_138775312.1|2624661_2624847_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	68.9	9.2e-19
WP_138775968.1|2624951_2625602_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	70.8	5.6e-87
WP_054872105.1|2625936_2627289_-	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	25.2	8.6e-13
WP_138775313.1|2627852_2628188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775314.1|2628210_2628459_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	43.6	1.8e-09
WP_138775315.1|2628479_2630681_+	transcription termination factor	NA	H9C157	Pectobacterium_phage	44.1	2.2e-167
WP_138775316.1|2630677_2631178_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	76.1	8.2e-62
2631090:2631103	attL	AAAAAGCCATCAAA	NA	NA	NA	NA
WP_138775317.1|2631618_2631825_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	50.0	5.7e-09
WP_050143264.1|2631781_2632015_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	50.0	3.1e-11
WP_138775318.1|2632014_2633025_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	66.4	3.5e-128
2633978:2633991	attR	AAAAAGCCATCAAA	NA	NA	NA	NA
>prophage 8
NZ_CP042173	Yersinia sp. KBS0713 chromosome, complete genome	4539645	3147903	3245492	4539645	plate,tRNA,terminase,integrase,portal,protease,tail,head,capsid,holin	Enterobacteria_phage(15.38%)	106	3183980:3183997	3226749:3226766
WP_032898956.1|3147903_3149328_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_138775988.1|3149594_3150650_+	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	3.2e-47
WP_032898946.1|3150646_3151120_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_004873307.1|3151192_3152071_+	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_138775392.1|3152078_3153644_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_005279099.1|3153782_3154367_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_071984955.1|3154646_3154838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005279100.1|3154937_3155867_+	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004873312.1|3156044_3156785_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032898950.1|3156784_3157459_+	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_004873313.1|3157458_3158184_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.8e-26
WP_005279103.1|3158237_3158720_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_054872453.1|3159094_3161677_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.7	1.3e-187
WP_005279108.1|3161691_3162315_+	LPS assembly lipoprotein LptE	NA	NA	NA	NA	NA
WP_138775393.1|3162311_3163346_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_049599505.1|3163335_3163998_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_004873320.1|3164291_3164609_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005278057.1|3164612_3165083_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005278070.1|3165175_3167071_+	peptidoglycan DD-transpeptidase MrdA	NA	NA	NA	NA	NA
WP_005278071.1|3167093_3168206_+	peptidoglycan glycosyltransferase MrdB	NA	NA	NA	NA	NA
WP_032898663.1|3168215_3169328_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	52.6	9.9e-15
WP_032898665.1|3169609_3170821_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	51.3	2.9e-105
WP_032898667.1|3170950_3171214_+	YbeD family protein	NA	NA	NA	NA	NA
WP_005278075.1|3171365_3172052_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_005278076.1|3172244_3173210_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_005278078.1|3173406_3173628_-	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
WP_071984943.1|3173831_3174884_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.0	3.2e-15
WP_032898670.1|3174941_3175325_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	60.4	1.9e-26
WP_002210315.1|3175604_3175814_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
WP_005278086.1|3176080_3176560_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_074007306.1|3176752_3177364_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005278090.1|3177718_3178684_+	membrane protein	NA	NA	NA	NA	NA
WP_005278091.1|3178764_3179409_-	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	58.9	7.8e-73
WP_005278093.1|3179553_3179748_-	glycogen synthase	NA	NA	NA	NA	NA
WP_005278095.1|3180082_3180370_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_138775394.1|3180390_3182163_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.8	1.4e-47
WP_049599525.1|3182607_3183729_-	cupin domain-containing protein	NA	NA	NA	NA	NA
3183980:3183997	attL	ATGGTACGCCCTACAGGA	NA	NA	NA	NA
WP_138775395.1|3184536_3186066_-	recombinase family protein	NA	NA	NA	NA	NA
WP_071984944.1|3186195_3186243_+	DinI-like family protein	NA	NA	NA	NA	NA
WP_099462489.1|3186666_3187572_+	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	79.1	3.7e-145
WP_138775396.1|3188035_3188272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099460537.1|3188416_3189232_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_032899220.1|3189228_3189537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049602796.1|3190313_3190937_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	44.8	2.8e-35
WP_099460554.1|3190936_3191971_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	51.6	2.6e-33
WP_138775397.1|3192153_3192750_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.8	2.3e-34
WP_138775398.1|3192746_3193883_-|plate	baseplate J/gp47 family protein	plate	J9QE72	Clostridium_phage	28.6	4.4e-10
WP_138775399.1|3193886_3194324_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	46.2	1.8e-20
WP_138775400.1|3194320_3194914_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_032898843.1|3194910_3195984_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.9	1.2e-41
WP_138775402.1|3195980_3197387_-	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	27.4	1.3e-24
WP_005278834.1|3197444_3199310_-	hypothetical protein	NA	Q858G0	Salmonella_phage	41.8	1.1e-21
WP_005278837.1|3199427_3199730_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_005278840.1|3199731_3200106_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_138775404.1|3200118_3201627_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	45.4	7.4e-106
WP_138775406.1|3201626_3201818_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_138775408.1|3201823_3202369_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_138775411.1|3202365_3202710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775413.1|3202709_3203204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775415.1|3203205_3204252_-|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	32.1	8.3e-40
WP_138775416.1|3204360_3204762_-|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	33.6	1.3e-09
WP_138775418.1|3204761_3205355_-	DNA primase	NA	NA	NA	NA	NA
WP_138775420.1|3205347_3206211_-	S49 family peptidase	NA	K7P7A7	Enterobacteria_phage	39.2	3.0e-51
WP_138775990.1|3206207_3207776_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.3	3.5e-98
WP_005278866.1|3207844_3208108_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_032898867.1|3208116_3210093_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.0	3.1e-136
WP_005278871.1|3210064_3210676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049602778.1|3210788_3211313_-	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	50.0	3.1e-35
WP_138775422.1|3211389_3212034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775424.1|3212443_3212860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005277001.1|3212870_3213371_-	hypothetical protein	NA	Q7Y3V2	Yersinia_phage	82.5	5.3e-69
WP_005277004.1|3213388_3213781_-	M15 family metallopeptidase	NA	K0NZV5	Escherichia_virus	65.1	2.7e-36
WP_071984933.1|3213767_3214154_-|holin	holin	holin	NA	NA	NA	NA
WP_032898469.1|3214534_3214951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005277008.1|3215248_3215650_-	antitermination protein	NA	S5M7R9	Escherichia_phage	55.6	4.9e-33
WP_032898485.1|3215836_3216844_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	50.5	1.1e-68
WP_138775426.1|3216951_3219627_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	48.7	2.6e-231
WP_099465994.1|3219623_3220019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775428.1|3220131_3220335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775430.1|3220337_3220508_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_050096152.1|3220485_3220683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775432.1|3220675_3221476_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	60.0	5.2e-42
WP_050915401.1|3221468_3221765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775434.1|3221919_3222840_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_138775436.1|3222842_3223463_-	hypothetical protein	NA	A0A0P0J0J7	Acinetobacter_phage	39.7	6.5e-24
WP_138775438.1|3223571_3223778_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	45.3	4.1e-07
WP_138775440.1|3223922_3224981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005182448.1|3225396_3226584_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.0	2.3e-131
WP_005277034.1|3227039_3227906_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.3	3.1e-32
3226749:3226766	attR	ATGGTACGCCCTACAGGA	NA	NA	NA	NA
WP_005277036.1|3227920_3228133_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_138775442.1|3228277_3229663_-|tRNA	cysteine--tRNA ligase	tRNA	L7Y4R1	Megavirus	32.1	8.5e-40
WP_004873351.1|3229947_3230442_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_005277039.1|3230452_3231175_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032898477.1|3231369_3231894_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_032898478.1|3231890_3232955_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_138775444.1|3233011_3235444_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_005277049.1|3235440_3236127_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	9.3e-32
WP_072188426.1|3236094_3236733_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_005277053.1|3236789_3237566_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_138775446.1|3237854_3238709_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_138775448.1|3238903_3239818_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_005277057.1|3239820_3240270_+	NfeD family protein	NA	NA	NA	NA	NA
WP_005277059.1|3240390_3240810_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_138775450.1|3241017_3243822_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.2	2.4e-110
WP_005277062.1|3243908_3244727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005277064.1|3245012_3245492_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP042173	Yersinia sp. KBS0713 chromosome, complete genome	4539645	3312203	3383711	4539645	coat,tRNA,terminase,portal,protease,tail,lysis,holin	Salmonella_phage(20.0%)	85	NA	NA
WP_004714578.1|3312203_3313475_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.8	1.6e-130
WP_005272733.1|3313702_3314326_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.4	1.3e-64
WP_005272735.1|3314799_3316104_-	trigger factor	NA	NA	NA	NA	NA
WP_072083849.1|3316535_3316856_-	transcriptional regulator BolA	NA	NA	NA	NA	NA
WP_032897209.1|3317209_3317788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775489.1|3317868_3319347_+	muropeptide MFS transporter AmpG	NA	NA	NA	NA	NA
WP_005272741.1|3319631_3320411_+	ion channel protein Tsx	NA	NA	NA	NA	NA
WP_005272742.1|3320772_3321729_+	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004873454.1|3321733_3323725_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032897215.1|3323714_3324329_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_032812973.1|3324328_3324676_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_086018778.1|3324686_3325577_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_138775491.1|3325842_3327213_+	MFS transporter	NA	NA	NA	NA	NA
WP_032897217.1|3327273_3327765_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_138775492.1|3327960_3328872_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_138775494.1|3328834_3329425_+	protein deglycase YajL	NA	NA	NA	NA	NA
WP_138775495.1|3329517_3330969_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_005272755.1|3331243_3331498_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_054872702.1|3331503_3332424_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_049602300.1|3332551_3334411_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_049602297.1|3334460_3334958_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_032897224.1|3334950_3335940_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_005272763.1|3336009_3336426_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_005272766.1|3336451_3336922_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.7	3.5e-30
WP_138775497.1|3337056_3338166_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.6	8.0e-49
WP_004707531.1|3338245_3338695_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_138775499.1|3338788_3339988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005272774.1|3340352_3341321_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.7	7.2e-46
WP_138775501.1|3341331_3343179_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_005166605.1|3343206_3343539_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.3	4.9e-10
WP_032897228.1|3343728_3344853_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	1.0e-91
WP_138775503.1|3345125_3346538_+	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_108087946.1|3346537_3346876_+	EamA family transporter	NA	NA	NA	NA	NA
WP_138775505.1|3346886_3348482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775507.1|3348482_3350420_-	hypothetical protein	NA	Q716G1	Shigella_phage	54.8	1.0e-62
WP_138775509.1|3350511_3352599_-	DNA transfer protein	NA	A5VW64	Enterobacteria_phage	58.3	4.5e-194
WP_138775511.1|3352598_3353897_-	acyltransferase	NA	Q716G3	Shigella_phage	53.3	1.3e-106
WP_138775513.1|3353896_3354553_-	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	50.0	4.3e-42
WP_138775515.1|3354546_3355008_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	69.8	3.0e-58
WP_138775516.1|3355023_3355767_-|tail	phage tail protein	tail	A0A2D1GLK3	Escherichia_phage	43.4	6.5e-39
WP_138775518.1|3355766_3357182_-	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	71.8	1.4e-202
WP_138775520.1|3357153_3357651_-	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	57.2	4.0e-40
WP_138775522.1|3357634_3357865_-	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	71.4	2.4e-16
WP_138775524.1|3357905_3359189_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	67.1	1.3e-164
WP_138775526.1|3359188_3360097_-	scaffolding protein	NA	G5DA98	Enterobacteria_phage	75.2	6.0e-119
WP_138775994.1|3360110_3362276_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	68.8	1.7e-289
WP_138775528.1|3362275_3363778_-|terminase	terminase	terminase	I1TEI5	Salmonella_phage	87.6	1.1e-274
WP_138775530.1|3363755_3364244_-	DNA-packaging protein	NA	A0A192Y693	Salmonella_phage	88.3	9.5e-79
WP_049606326.1|3364302_3364905_-	hypothetical protein	NA	F8UBW3	Escherichia_phage	43.2	5.0e-05
WP_050296289.1|3364922_3365159_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	49.3	3.8e-09
WP_138775532.1|3365214_3365499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775534.1|3365658_3366117_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.6	1.2e-22
WP_138775535.1|3366113_3366503_-	M15 family metallopeptidase	NA	A0A1P8DTR0	Salmonella_phage	83.3	5.1e-59
WP_049602198.1|3366489_3366822_-|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	42.9	1.1e-17
WP_138775536.1|3367286_3367907_-	hypothetical protein	NA	F1C5D0	Cronobacter_phage	48.7	5.4e-47
WP_138775537.1|3367910_3368267_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.0	7.2e-36
WP_042562425.1|3368263_3368554_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	76.8	5.7e-39
WP_138775538.1|3368755_3368926_-	NinE family protein	NA	NA	NA	NA	NA
WP_138775540.1|3369097_3369547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038636037.1|3369555_3370005_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	69.8	3.4e-59
WP_138775542.1|3370008_3370248_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	61.3	1.8e-19
WP_138775544.1|3370438_3370888_-	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	37.3	4.2e-17
WP_138775546.1|3370884_3371277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138775549.1|3371273_3371558_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	42.9	6.8e-05
WP_138775551.1|3371541_3371856_-	DUF2591 family protein	NA	NA	NA	NA	NA
WP_138775553.1|3371901_3372138_-	hypothetical protein	NA	A0A2P1CKR1	Pantoea_phage	41.6	7.2e-08
WP_138775555.1|3372134_3372461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051406.1|3372460_3373054_-	hypothetical protein	NA	I3PUZ9	Vibrio_phage	38.5	1.3e-34
WP_138775557.1|3374039_3374720_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	41.0	9.6e-37
WP_138775559.1|3374744_3375083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050130533.1|3375233_3375461_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	53.7	6.7e-11
WP_050130532.1|3375560_3376295_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	45.3	3.5e-45
WP_138775561.1|3376894_3377221_+	superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	78.9	4.9e-39
WP_138775563.1|3377225_3377702_+	hypothetical protein	NA	A0A2H4J4Q4	uncultured_Caudovirales_phage	55.8	1.4e-39
WP_138775565.1|3377751_3378069_+	hypothetical protein	NA	A0A2I7RGU7	Vibrio_phage	45.1	5.3e-14
WP_049602130.1|3378321_3378522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049602126.1|3378559_3378937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775567.1|3379018_3380026_+	hypothetical protein	NA	A0A2I7QQ55	Vibrio_phage	36.6	8.9e-15
WP_138775569.1|3380041_3380170_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_138775571.1|3380279_3380528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138775573.1|3380499_3381180_+	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	69.9	5.2e-91
WP_138775575.1|3381176_3381773_+	DUF669 domain-containing protein	NA	K7PHD7	Enterobacteria_phage	51.1	1.3e-42
WP_138775577.1|3382224_3382815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774961.1|3382807_3383089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138774960.1|3383081_3383711_+	methyltransferase domain-containing protein	NA	A0A0N7IRF6	Acinetobacter_phage	59.9	1.5e-55
