The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040700	Salmonella enterica subsp. enterica serovar Saintpaul strain 5 isolate CFSAN047351 chromosome, complete genome	4767334	1597506	1627117	4767334	protease,tail,holin	Salmonella_phage(38.46%)	32	NA	NA
WP_021000536.1|1597506_1598001_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1598414_1598906_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1598895_1599159_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1599155_1601642_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1601648_1602344_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1602330_1603200_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1603315_1603765_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1603774_1604377_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1604397_1605015_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1605011_1605671_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1605722_1606460_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1606456_1606669_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1606665_1607145_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_138766866.1|1607141_1609073_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_138766867.1|1609069_1609627_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_138766868.1|1609623_1610667_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001115498.1|1610710_1611358_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1612087_1612651_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1612842_1613046_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1613348_1614140_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1614436_1614640_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1614808_1617175_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1617503_1618493_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1618507_1618876_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1618904_1620236_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1620532_1620862_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1621454_1622696_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215678.1|1622698_1623226_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	5.3e-11
WP_000022213.1|1623603_1624047_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1624100_1625930_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1626295_1626586_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1626613_1627117_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 2
NZ_CP040700	Salmonella enterica subsp. enterica serovar Saintpaul strain 5 isolate CFSAN047351 chromosome, complete genome	4767334	1699198	1708369	4767334	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1699198_1700146_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1700129_1700861_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1700841_1700949_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1701008_1701740_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1701962_1703648_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1703644_1704364_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1704410_1704878_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1704934_1705465_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1705636_1706095_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195343.1|1706335_1708369_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 3
NZ_CP040700	Salmonella enterica subsp. enterica serovar Saintpaul strain 5 isolate CFSAN047351 chromosome, complete genome	4767334	1776677	1787183	4767334		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111840.1|1776677_1778081_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	2.3e-21
WP_000981471.1|1778258_1779152_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697838.1|1779528_1780614_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	9.4e-103
WP_001023662.1|1780613_1781513_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1781560_1782439_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1782439_1782991_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1782996_1783989_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1783985_1784759_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1784763_1785843_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1785869_1787183_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP040700	Salmonella enterica subsp. enterica serovar Saintpaul strain 5 isolate CFSAN047351 chromosome, complete genome	4767334	1873176	1883761	4767334		Morganella_phage(25.0%)	12	NA	NA
WP_001219015.1|1873176_1873650_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001669246.1|1874297_1874588_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	5.2e-08
WP_000598920.1|1874959_1875757_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001521460.1|1876237_1876399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1876525_1876945_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1876947_1878216_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1878670_1878883_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1878893_1879082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080668.1|1879342_1880521_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	6.6e-110
WP_000107430.1|1881170_1881470_+	membrane protein	NA	NA	NA	NA	NA
WP_000377042.1|1881561_1882257_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157301.1|1882330_1883761_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP040700	Salmonella enterica subsp. enterica serovar Saintpaul strain 5 isolate CFSAN047351 chromosome, complete genome	4767334	1986996	1993805	4767334	integrase,tail	Salmonella_phage(33.33%)	11	1989206:1989228	1998921:1998943
WP_000856224.1|1986996_1987227_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1987364_1987739_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|1987739_1988615_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1988631_1988985_+	YebY family protein	NA	NA	NA	NA	NA
1989206:1989228	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|1989358_1990213_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|1990272_1990767_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|1990956_1991187_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|1991240_1991774_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|1992030_1992198_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|1992262_1992451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|1992923_1993805_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
1998921:1998943	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP040700	Salmonella enterica subsp. enterica serovar Saintpaul strain 5 isolate CFSAN047351 chromosome, complete genome	4767334	2780419	2863906	4767334	portal,protease,tRNA,integrase,tail,lysis,holin,terminase	Salmonella_phage(47.17%)	92	2804513:2804532	2875055:2875074
WP_000938191.1|2780419_2781100_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2781720_2782380_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2782466_2782796_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2782792_2783074_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2783122_2783902_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2783927_2784476_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2784690_2785902_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2785959_2786277_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2786321_2786738_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2786908_2787571_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2787665_2788124_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420517.1|2788159_2790214_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2790337_2790784_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950875.1|2790802_2792956_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2792942_2793548_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2793764_2794274_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2794630_2795683_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2795754_2796207_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2796392_2798153_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2798221_2798740_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2798839_2799007_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2799262_2799826_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2799822_2801463_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2801467_2802721_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2802735_2804643_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2804513:2804532	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2804655_2806764_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2806862_2807972_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2807968_2808511_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2808676_2809687_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_138766874.1|2809894_2812507_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497442.1|2812933_2813140_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	98.5	4.5e-30
WP_001536069.1|2813615_2814416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|2814895_2815618_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143175.1|2815813_2816389_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	3.4e-96
WP_023205986.1|2816388_2818830_-|tail	Gifsy-2 prophage tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	63.1	1.2e-86
WP_000178851.1|2818883_2819126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077911794.1|2819164_2820040_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	79.7	1.5e-50
WP_001576012.1|2822586_2823291_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_023205988.1|2823188_2823926_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.2e-114
WP_023205989.1|2823935_2824631_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.7e-89
WP_000877926.1|2824720_2825254_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2825370_2825868_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978295.1|2825966_2826299_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_077911799.1|2826295_2829283_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.8	1.5e-264
WP_010989009.1|2829362_2829692_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478858.1|2829688_2830087_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_023205991.1|2830132_2830882_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.2	5.3e-89
WP_000196703.1|2830893_2831295_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000453194.1|2831291_2831858_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2831838_2832138_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2832130_2832454_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2832544_2834626_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077911800.1|2834549_2836067_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.9	4.4e-175
WP_000196190.1|2836093_2836300_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2836296_2838435_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2838391_2838925_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2839132_2839612_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2839629_2840082_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2840065_2840395_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2840670_2841357_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798705.1|2841717_2842167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2842302_2842428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2842601_2842919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2842985_2843783_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2843772_2843919_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096547.1|2843915_2844527_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001241019.1|2844529_2844736_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929805.1|2844735_2845338_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2845420_2845642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2845753_2845987_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2846278_2846569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2846646_2846958_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2846954_2847302_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2847312_2848062_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2848064_2849048_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2849132_2849507_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2849472_2849712_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2849831_2850242_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_077911795.1|2850291_2850552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917563.1|2850544_2850703_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_023205995.1|2850724_2851075_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	96.6	3.2e-60
WP_023205996.1|2851201_2854129_+	gifsy-1 prophage RecE	NA	S4TNL0	Salmonella_phage	99.0	0.0e+00
WP_077911796.1|2854091_2855249_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	3.6e-217
WP_001237031.1|2855291_2855531_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2855571_2855820_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2855864_2857157_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|2857351_2858554_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2858631_2860068_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2860312_2861527_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000301921.1|2861613_2861847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762342.1|2861843_2862305_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2862505_2863906_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
2875055:2875074	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 7
NZ_CP040700	Salmonella enterica subsp. enterica serovar Saintpaul strain 5 isolate CFSAN047351 chromosome, complete genome	4767334	3128327	3213244	4767334	capsid,portal,tRNA,head,integrase,tail,holin,lysis,plate,terminase	Enterobacteria_phage(52.38%)	91	3149085:3149108	3186295:3186318
WP_000824704.1|3128327_3128894_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	54.4	4.3e-51
WP_001521652.1|3128953_3129085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001017923.1|3129408_3130143_-	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_000932043.1|3130132_3131065_-	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_001188370.1|3131058_3131715_-	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_000798847.1|3131730_3132474_-	radiation resistance protein YbgI	NA	NA	NA	NA	NA
WP_001041123.1|3132802_3134284_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.7	1.1e-45
WP_001142016.1|3134322_3135744_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.7	6.0e-57
WP_000401437.1|3135854_3136061_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001670793.1|3136397_3136487_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000730066.1|3136486_3138166_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000088022.1|3138186_3140235_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.3	1.9e-27
WP_000579804.1|3140243_3140828_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_000997487.1|3140824_3143509_+	two-component system sensor histidine kinase KdbD	NA	NA	NA	NA	NA
WP_000186054.1|3143505_3144183_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	5.8e-26
WP_015632840.1|3144460_3144565_+	DUF2618 domain-containing protein	NA	NA	NA	NA	NA
WP_001292402.1|3144944_3147143_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_000042658.1|3147139_3148459_+	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_000070056.1|3148523_3149009_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
3149085:3149108	attL	AAAGGAGCCGTAAGGCTCCTTTTT	NA	NA	NA	NA
WP_058111971.1|3149214_3150189_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	50.2	4.6e-85
WP_129467824.1|3150194_3150566_-	helix-turn-helix domain-containing protein	NA	A0A0S4L3B5	Pseudomonas_phage	36.2	2.0e-12
WP_129467819.1|3150641_3150848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094138065.1|3150844_3151159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058111970.1|3151609_3151996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154181.1|3152068_3152311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138766878.1|3152316_3152520_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_020844111.1|3152489_3152681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138766879.1|3152756_3153197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023207951.1|3153193_3153451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138766880.1|3153438_3153972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106653.1|3153968_3154208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138766881.1|3154204_3155188_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B2IH14	Erwinia_phage	41.2	1.7e-55
WP_138766882.1|3155187_3155493_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	58.6	3.3e-21
WP_071692098.1|3155489_3156026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094138068.1|3156022_3157141_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	66.0	7.8e-137
WP_138766883.1|3157137_3159642_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	47.7	1.7e-176
WP_138766884.1|3159634_3160045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138766885.1|3160387_3161386_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_080096862.1|3161389_3162034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138766908.1|3162085_3162268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138766886.1|3162517_3163567_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.4	3.3e-153
WP_138766887.1|3163566_3165300_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	74.6	2.4e-262
WP_138766888.1|3165456_3166293_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.5	1.3e-99
WP_058112088.1|3166316_3167402_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.7	7.6e-137
WP_058112087.1|3167448_3168279_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	65.8	6.3e-91
WP_001624329.1|3168380_3168875_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	59.5	3.8e-51
WP_000864914.1|3168874_3169075_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	80.0	1.3e-21
WP_023170337.1|3169065_3169443_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_058112086.1|3169439_3169883_+	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.9	1.6e-45
WP_138766889.1|3169889_3170381_+|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	56.1	6.0e-33
WP_024154161.1|3170367_3170844_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	50.3	7.1e-39
WP_138766890.1|3170840_3171476_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	59.3	8.6e-64
WP_058112083.1|3171472_3172063_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	70.2	4.4e-70
WP_000127183.1|3172059_3172428_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	71.3	2.9e-40
WP_058112082.1|3172414_3173311_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	69.5	6.8e-107
WP_058112081.1|3173303_3173831_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	61.2	1.4e-56
WP_138766891.1|3173836_3175540_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	54.0	8.3e-130
WP_138766892.1|3176040_3176361_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	82.1	1.1e-46
WP_058112078.1|3176350_3176926_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.2	1.6e-88
WP_058112077.1|3176966_3178109_-	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_058112076.1|3178395_3178884_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	78.9	5.6e-71
WP_138766893.1|3178897_3181858_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.1	1.9e-251
WP_001627826.1|3181844_3182003_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	79.6	2.4e-15
WP_077946052.1|3182008_3182365_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	52.6	3.4e-17
WP_138766894.1|3182407_3182920_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	67.5	2.9e-62
WP_138766895.1|3182920_3184108_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	82.5	1.5e-186
WP_138766896.1|3184266_3185412_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	73.5	1.1e-149
WP_024153979.1|3185457_3185739_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_024143244.1|3185951_3186092_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	73.9	8.2e-12
WP_000974387.1|3186333_3187974_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
3186295:3186318	attR	AAAGGAGCCGTAAGGCTCCTTTTT	NA	NA	NA	NA
WP_000848395.1|3187998_3188541_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_000773246.1|3188725_3189496_+	esterase	NA	NA	NA	NA	NA
WP_001040939.1|3189629_3189923_+	LexA regulated protein	NA	NA	NA	NA	NA
WP_001018621.1|3190073_3190604_+	flavodoxin FldA	NA	NA	NA	NA	NA
WP_000131699.1|3190885_3191338_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_000423363.1|3191452_3192379_+	tricarballylate utilization LysR family transcriptional regulator TcuR	NA	NA	NA	NA	NA
WP_000228709.1|3192476_3193880_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	1.0e-08
WP_000811134.1|3193866_3195006_+	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
WP_000057014.1|3195056_3196361_+	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	34.9	1.2e-59
WP_000722261.1|3196409_3196742_-	lipoprotein	NA	NA	NA	NA	NA
WP_001258803.1|3196791_3198198_-	chitoporin	NA	NA	NA	NA	NA
WP_001287181.1|3198643_3200311_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	96.0	0.0e+00
WP_001023068.1|3200521_3202474_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.9e-09
WP_001237059.1|3202800_3203601_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_000271185.1|3203660_3204815_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_000187578.1|3204819_3206040_+	DNA-binding transcriptional regulator NagC	NA	NA	NA	NA	NA
WP_000153143.1|3206086_3206839_+	ribonucleotide monophosphatase NagD	NA	NA	NA	NA	NA
WP_000337034.1|3207128_3208793_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.0	4.7e-85
WP_001109083.1|3209858_3210434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184628.1|3210500_3211676_-	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_001519200.1|3211819_3213244_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP040700	Salmonella enterica subsp. enterica serovar Saintpaul strain 5 isolate CFSAN047351 chromosome, complete genome	4767334	4352929	4400533	4767334	tRNA,tail,plate	Burkholderia_phage(40.91%)	51	NA	NA
WP_001182230.1|4352929_4353928_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|4354015_4355326_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4355572_4356088_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4356186_4356396_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4356417_4356531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4356527_4357853_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4358031_4358640_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4358748_4359117_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4359287_4361708_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4361806_4362679_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4362692_4363190_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4363370_4364288_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4364451_4365810_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4365898_4367008_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4367369_4368560_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4368691_4370236_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4370250_4371141_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4371306_4371717_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4371859_4373956_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4373955_4374693_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4374689_4375358_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4375391_4375634_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4376077_4377727_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4378071_4379421_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4379553_4379901_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4380476_4380764_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4380766_4381372_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4381384_4381699_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4381858_4382314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4382310_4382508_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4382497_4383925_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_023137586.1|4383924_4384449_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	3.6e-68
WP_001003639.1|4384500_4384818_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4384777_4384906_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023137585.1|4385002_4387357_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.2	7.3e-68
WP_023137584.1|4387356_4388310_+	bacteriophage protein	NA	A4JWL1	Burkholderia_virus	51.5	1.0e-36
WP_001269716.1|4388309_4388519_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023137583.1|4388506_4389550_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679390.1|4389559_4390282_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_012512893.1|4390290_4390530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000593184.1|4390605_4390968_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_023137582.1|4390964_4391894_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_023137581.1|4391893_4393441_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	5.5e-48
WP_001093501.1|4393604_4393964_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951737.1|4393954_4395070_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.0	2.0e-100
WP_000359509.1|4395062_4395695_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000368193.1|4395697_4397356_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_001151758.1|4397362_4397977_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084336.1|4397973_4398429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024133214.1|4398809_4399226_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000587740.1|4399804_4400533_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	7.3e-35
